miRTarBase - #MIRT624185


—
pre-miRNA Information
pre-miRNA hsa-mir-3152   
Genomic Coordinates chr9: 18573306 - 18573379
Description Homo sapiens miR-3152 stem-loop
Comment Berezikov et al. proposed this sequence as a miRNA candidate based on the RAKE method .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3152-5p
Sequence 11| AUUGCCUCUGUUCUAACACAAG |32
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1019691326 2 dbSNP
rs1282676806 8 dbSNP
rs762305650 11 dbSNP
rs1364318615 12 dbSNP
rs556364307 18 dbSNP
rs1002755159 19 dbSNP
rs1238555909 21 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DDX19B   
Synonyms DBP5, DDX19, RNAh
Description DEAD-box helicase 19B
Transcript NM_001014449   
Other Transcripts NM_001014451 , NM_007242   
Expression
Putative miRNA Targets on DDX19B
3'UTR of DDX19B
(miRNA target sites are highlighted)		 
>DDX19B|NM_001014449|3'UTR
   1 GAAGCTCCACCAGCCACTGATGCCAGCCCTGGCACTGCCCCTGCACAGGAGACAAGTGCGTTCAGGGCACAGGCCCCGAC
  81 ATCACCCCAAGGACAACGGCACAAGTAGAGAGAAACTACCTACCTCACTTCAAATTATGTTTGGACTTGACAAAAATGTA
 161 TGCAAATGATGGGGGATGGTAGAAAAAAATTATTTACACAACCTTGGAAGATTAGGCATGAATACACAGAGATTTACCTT
 241 TTGGAAGTTT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gaacacaauCUUGU-CUCCGUUa 5'
                   | ||| ||| ||| 
Target 5' actgcccctGCACAGGAGACAAg 3'
 34 - 56 117.00 -5.12
2 
miRNA  3' gaacacAAUCUUGU-CUCCGUua 5'
                ||:||| |  |||||  
Target 5' acaaccTTGGAAGATTAGGCAtg 3'
 198 - 220 108.00 -9.00
3 
miRNA  3' gaacACAAUCUUGUCU-CCGUUA----- 5'
              || |:|:  :|| ||:|:      
Target 5' caaaTGATGGG--GGATGGTAGAAAAAA 3'
 163 - 188 70.00 -6.44
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30151066 30 COSMIC
COSN6092961 49 COSMIC
COSN30530301 53 COSMIC
COSN26973032 60 COSMIC
COSN5836739 61 COSMIC
COSN30162677 67 COSMIC
COSN30509433 69 COSMIC
COSN13685606 72 COSMIC
COSN26973031 75 COSMIC
COSN30101565 78 COSMIC
COSN30463531 78 COSMIC
COSN30458568 83 COSMIC
COSN30500731 90 COSMIC
COSN26570946 103 COSMIC
COSN30507795 131 COSMIC
COSN31526723 148 COSMIC
COSN26638480 163 COSMIC
COSN31524951 185 COSMIC
COSN20078635 227 COSMIC
COSN26129785 258 COSMIC
COSN26890411 1015 COSMIC
COSN6092963 1034 COSMIC
COSN7269618 1210 COSMIC
COSN32064513 1621 COSMIC
rs12325419 1425 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs775932350 1 dbSNP
rs768171364 2 dbSNP
rs773949645 3 dbSNP
rs761474735 4 dbSNP
rs750197591 5 dbSNP
rs376017053 6 dbSNP
rs201011219 7 dbSNP
rs757531353 10 dbSNP
rs536725056 11 dbSNP
rs370170630 15 dbSNP
rs770117112 18 dbSNP
rs908265409 23 dbSNP
rs780555899 24 dbSNP
rs1372218998 30 dbSNP
rs1427715737 33 dbSNP
rs1236390528 39 dbSNP
rs1181287787 42 dbSNP
rs943722495 44 dbSNP
rs1307361284 45 dbSNP
rs1345547427 46 dbSNP
rs193274058 47 dbSNP
rs768102177 50 dbSNP
rs1207840741 59 dbSNP
rs185027717 60 dbSNP
rs397821730 61 dbSNP
rs148606610 64 dbSNP
rs1300775673 66 dbSNP
rs1283663669 68 dbSNP
rs996416861 77 dbSNP
rs544912514 79 dbSNP
rs904020959 82 dbSNP
rs1014525642 92 dbSNP
rs1343817386 93 dbSNP
rs1382714780 93 dbSNP
rs1167446606 95 dbSNP
rs1294515975 97 dbSNP
rs1001017221 98 dbSNP
rs1031516717 99 dbSNP
rs1058436 103 dbSNP
rs111343596 123 dbSNP
rs906199715 147 dbSNP
rs1248212031 148 dbSNP
rs1679 150 dbSNP
rs1484735920 152 dbSNP
rs1058442 160 dbSNP
rs1058447 179 dbSNP
rs1058453 181 dbSNP
rs1002328718 183 dbSNP
rs1025019601 191 dbSNP
rs1321030000 202 dbSNP
rs1289561246 204 dbSNP
rs1243825736 212 dbSNP
rs1344436848 214 dbSNP
rs969370629 217 dbSNP
rs1298536013 224 dbSNP
rs752303919 224 dbSNP
rs113436130 232 dbSNP
rs1437689455 236 dbSNP
rs981105799 237 dbSNP
rs1262595268 243 dbSNP
rs1026865955 252 dbSNP
rs1431048926 255 dbSNP
rs370932426 260 dbSNP
rs1486439037 262 dbSNP
rs1426358615 282 dbSNP
rs192524377 287 dbSNP
rs1191527403 289 dbSNP
rs952547226 291 dbSNP
rs560853884 298 dbSNP
rs1207228101 303 dbSNP
rs1015452622 304 dbSNP
rs1185029414 307 dbSNP
rs1203985304 311 dbSNP
rs1305962943 318 dbSNP
rs961248662 326 dbSNP
rs1385422108 336 dbSNP
rs1443666498 337 dbSNP
rs922556738 348 dbSNP
rs1162009572 355 dbSNP
rs982609837 358 dbSNP
rs1454237510 364 dbSNP
rs985945136 366 dbSNP
rs997359024 367 dbSNP
rs1176366889 369 dbSNP
rs1432325254 370 dbSNP
rs908373371 371 dbSNP
rs1184160355 374 dbSNP
rs943827587 377 dbSNP
rs528080873 387 dbSNP
rs1251050254 392 dbSNP
rs920934878 405 dbSNP
rs1257925550 410 dbSNP
rs932279762 416 dbSNP
rs184328300 420 dbSNP
rs1382259149 424 dbSNP
rs1211100633 426 dbSNP
rs1323187276 437 dbSNP
rs1244055357 438 dbSNP
rs913418716 440 dbSNP
rs950307364 442 dbSNP
rs1351612334 443 dbSNP
rs1306957034 446 dbSNP
rs1045991368 462 dbSNP
rs906185595 466 dbSNP
rs547078254 477 dbSNP
rs1309156809 480 dbSNP
rs1317652119 481 dbSNP
rs1303000217 497 dbSNP
rs112611049 499 dbSNP
rs1403522677 516 dbSNP
rs151167259 517 dbSNP
rs1055267543 519 dbSNP
rs936905459 521 dbSNP
rs551016121 529 dbSNP
rs1005271846 533 dbSNP
rs139209433 540 dbSNP
rs1179603633 548 dbSNP
rs1259536334 549 dbSNP
rs1326313292 550 dbSNP
rs1258352289 554 dbSNP
rs530266825 555 dbSNP
rs1052640813 556 dbSNP
rs1461026733 578 dbSNP
rs1241579034 579 dbSNP
rs1210930875 595 dbSNP
rs1015359183 607 dbSNP
rs1204670969 609 dbSNP
rs892636068 613 dbSNP
rs1237531571 617 dbSNP
rs896997435 618 dbSNP
rs772720847 619 dbSNP
rs1451344948 620 dbSNP
rs1460557238 624 dbSNP
rs1322171253 629 dbSNP
rs1435481475 630 dbSNP
rs1383984068 632 dbSNP
rs1179817491 638 dbSNP
rs567382414 654 dbSNP
rs144072638 662 dbSNP
rs538053600 663 dbSNP
rs762373689 664 dbSNP
rs1002188617 668 dbSNP
rs1158258498 669 dbSNP
rs985506763 671 dbSNP
rs1470933923 672 dbSNP
rs1176799731 675 dbSNP
rs1405096948 677 dbSNP
rs1446070909 678 dbSNP
rs1300182322 679 dbSNP
rs1374123181 682 dbSNP
rs1390847125 684 dbSNP
rs1305002845 685 dbSNP
rs1326199467 686 dbSNP
rs766012180 711 dbSNP
rs1442615295 712 dbSNP
rs1262895488 714 dbSNP
rs1029624787 717 dbSNP
rs1325558149 724 dbSNP
rs1315943929 726 dbSNP
rs1321941744 732 dbSNP
rs558483049 739 dbSNP
rs1252751154 749 dbSNP
rs751188695 751 dbSNP
rs1424035066 756 dbSNP
rs1480766624 760 dbSNP
rs1383465692 770 dbSNP
rs988895128 772 dbSNP
rs952692567 773 dbSNP
rs74026004 775 dbSNP
rs74026005 776 dbSNP
rs965146820 777 dbSNP
rs1435307984 779 dbSNP
rs557002638 785 dbSNP
rs1222413637 793 dbSNP
rs1412582790 794 dbSNP
rs183879353 797 dbSNP
rs556453363 801 dbSNP
rs542496882 802 dbSNP
rs1355298536 805 dbSNP
rs146490430 818 dbSNP
rs1205323524 827 dbSNP
rs1306202553 833 dbSNP
rs1268081287 837 dbSNP
rs1235083231 840 dbSNP
rs932328215 842 dbSNP
rs978474597 857 dbSNP
rs1054690688 861 dbSNP
rs1282483767 865 dbSNP
rs868478186 866 dbSNP
rs1403027021 867 dbSNP
rs1406087204 871 dbSNP
rs1309913849 885 dbSNP
rs1410646870 890 dbSNP
rs1395988902 894 dbSNP
rs1166390329 895 dbSNP
rs1467846167 897 dbSNP
rs925596601 905 dbSNP
rs1430428800 909 dbSNP
rs1199230211 911 dbSNP
rs572927304 913 dbSNP
rs888132001 932 dbSNP
rs1254653506 933 dbSNP
rs540337766 937 dbSNP
rs936973167 941 dbSNP
rs752549683 943 dbSNP
rs1307650406 949 dbSNP
rs1036750006 952 dbSNP
rs1345362837 955 dbSNP
rs1221516871 958 dbSNP
rs564831445 958 dbSNP
rs1352225723 961 dbSNP
rs1288948316 970 dbSNP
rs1490715640 980 dbSNP
rs949496088 982 dbSNP
rs1442956417 992 dbSNP
rs1046529483 1008 dbSNP
rs1223091591 1017 dbSNP
rs998051973 1020 dbSNP
rs1416375107 1035 dbSNP
rs905252894 1039 dbSNP
rs1334910633 1042 dbSNP
rs1029980018 1043 dbSNP
rs1002678729 1050 dbSNP
rs532175736 1051 dbSNP
rs889679421 1054 dbSNP
rs1027013370 1066 dbSNP
rs1414771949 1089 dbSNP
rs1007235307 1095 dbSNP
rs888445652 1104 dbSNP
rs1004137969 1107 dbSNP
rs544876715 1112 dbSNP
rs370751411 1118 dbSNP
rs1461475679 1119 dbSNP
rs530315150 1120 dbSNP
rs79488827 1124 dbSNP
rs988888434 1129 dbSNP
rs150160933 1132 dbSNP
rs1268619545 1139 dbSNP
rs1223147177 1147 dbSNP
rs1348532170 1148 dbSNP
rs1167021999 1153 dbSNP
rs1450354374 1164 dbSNP
rs1383760513 1175 dbSNP
rs527746863 1177 dbSNP
rs552274166 1178 dbSNP
rs953849018 1179 dbSNP
rs1302652258 1182 dbSNP
rs777696969 1183 dbSNP
rs1406492210 1184 dbSNP
rs570490699 1184 dbSNP
rs925680454 1193 dbSNP
rs1164466198 1200 dbSNP
rs1444752883 1206 dbSNP
rs1433509130 1207 dbSNP
rs955858392 1208 dbSNP
rs1271077907 1210 dbSNP
rs1236648153 1211 dbSNP
rs937584790 1225 dbSNP
rs537885722 1226 dbSNP
rs753917861 1245 dbSNP
rs985012268 1246 dbSNP
rs914126757 1251 dbSNP
rs1246024926 1262 dbSNP
rs1291988862 1267 dbSNP
rs1248211463 1269 dbSNP
rs1314551678 1273 dbSNP
rs909519432 1273 dbSNP
rs1244050880 1275 dbSNP
rs557211234 1279 dbSNP
rs941069241 1280 dbSNP
rs1367693885 1281 dbSNP
rs1290409066 1284 dbSNP
rs1036721651 1287 dbSNP
rs949548434 1291 dbSNP
rs1046622933 1297 dbSNP
rs926769302 1298 dbSNP
rs868291417 1300 dbSNP
rs1364409810 1301 dbSNP
rs1161199033 1309 dbSNP
rs757307675 1326 dbSNP
rs1048921775 1328 dbSNP
rs1450925470 1337 dbSNP
rs888463908 1338 dbSNP
rs1242483042 1341 dbSNP
rs1419849043 1344 dbSNP
rs1185682313 1349 dbSNP
rs933748124 1370 dbSNP
rs1248336421 1375 dbSNP
rs1004594316 1386 dbSNP
rs569101742 1387 dbSNP
rs538929637 1389 dbSNP
rs1291116319 1390 dbSNP
rs889618018 1394 dbSNP
rs779099251 1404 dbSNP
rs1296606062 1406 dbSNP
rs1006777496 1414 dbSNP
rs1285666646 1415 dbSNP
rs1491367443 1415 dbSNP
rs746049222 1416 dbSNP
rs901121967 1417 dbSNP
rs998045940 1419 dbSNP
rs536548989 1420 dbSNP
rs1300716952 1422 dbSNP
rs1431147133 1424 dbSNP
rs12325419 1425 dbSNP
rs1169332293 1440 dbSNP
rs117884257 1441 dbSNP
rs999950420 1455 dbSNP
rs1427006618 1458 dbSNP
rs145670600 1461 dbSNP
rs1033139905 1466 dbSNP
rs148926109 1472 dbSNP
rs769218170 1477 dbSNP
rs1197319157 1478 dbSNP
rs1481673071 1480 dbSNP
rs1402934568 1493 dbSNP
rs576764778 1500 dbSNP
rs143659530 1501 dbSNP
rs970994873 1505 dbSNP
rs1306048825 1515 dbSNP
rs1265365745 1520 dbSNP
rs982350868 1521 dbSNP
rs1345400049 1529 dbSNP
rs1281964036 1532 dbSNP
rs1433408414 1542 dbSNP
rs926816720 1543 dbSNP
rs777034019 1551 dbSNP
rs1384463002 1552 dbSNP
rs1439557835 1553 dbSNP
rs1360588175 1566 dbSNP
rs1176849447 1570 dbSNP
rs1452937884 1572 dbSNP
rs1283079280 1575 dbSNP
rs1353729849 1579 dbSNP
rs1048488049 1583 dbSNP
rs1420891704 1586 dbSNP
rs1284932256 1594 dbSNP
rs762472772 1597 dbSNP
rs190256900 1598 dbSNP
rs959136829 1600 dbSNP
rs1245240797 1606 dbSNP
rs985001052 1607 dbSNP
rs1323300176 1608 dbSNP
rs773949062 1612 dbSNP
rs1241812138 1615 dbSNP
rs759181912 1616 dbSNP
rs1318112554 1633 dbSNP
rs182432651 1640 dbSNP
rs1221617517 1645 dbSNP
rs1461895058 1648 dbSNP
rs1183278180 1654 dbSNP
rs901174376 1657 dbSNP
rs74026006 1661 dbSNP
rs775201479 1667 dbSNP
rs1403644854 1669 dbSNP
rs889635052 1670 dbSNP
rs1290479472 1688 dbSNP
rs186549992 1689 dbSNP
rs59333886 1694 dbSNP
rs1158433039 1697 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084068. RNA binding protein: AGO2. Condition:CLIP_noemetine_SigmaAb HITS-CLIP data was present in GSM1084078. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_AbnovaAb HITS-CLIP data was present in GSM1084079. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084068
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_SigmaAb
Location of target site ENST00000288071.6 | 3UTR | CAAGAGGUUGCAGUGAGCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084078
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep2_AbnovaAb
Location of target site ENST00000288071.6 | 3UTR | GCAAGAGGUUGCAGUGAGCCGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1084079
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_AbnovaAb
Location of target site ENST00000288071.6 | 3UTR | AAGAGGUUGCAGUGAGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
75 hsa-miR-3152-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT092535 KBTBD8 kelch repeat and BTB domain containing 8 2 6
MIRT461731 NDUFA2 NADH:ubiquinone oxidoreductase subunit A2 2 2
MIRT468456 SET SET nuclear proto-oncogene 2 2
MIRT482192 AHR aryl hydrocarbon receptor 2 2
MIRT507923 BZW1 basic leucine zipper and W2 domains 1 2 4
MIRT512208 C18orf25 chromosome 18 open reading frame 25 2 6
MIRT526238 STARD4 StAR related lipid transfer domain containing 4 2 2
MIRT536131 MAPK14 mitogen-activated protein kinase 14 2 2
MIRT536280 LIMA1 LIM domain and actin binding 1 2 2
MIRT544251 LRIF1 ligand dependent nuclear receptor interacting factor 1 2 2
MIRT548054 GOLGA7 golgin A7 2 2
MIRT563443 ISCA1 iron-sulfur cluster assembly 1 2 2
MIRT565643 SIX4 SIX homeobox 4 2 2
MIRT614870 PDE12 phosphodiesterase 12 2 2
MIRT614923 MARCH6 membrane associated ring-CH-type finger 6 2 2
MIRT615793 FAM124A family with sequence similarity 124 member A 2 2
MIRT618557 VLDLR very low density lipoprotein receptor 2 2
MIRT622147 SORBS2 sorbin and SH3 domain containing 2 2 2
MIRT622390 RSBN1 round spermatid basic protein 1 2 2
MIRT624185 DDX19B DEAD-box helicase 19B 2 2
MIRT624448 CALCOCO2 calcium binding and coiled-coil domain 2 2 2
MIRT625340 TAPBP TAP binding protein 2 2
MIRT625370 IRGQ immunity related GTPase Q 2 2
MIRT627276 WSB1 WD repeat and SOCS box containing 1 2 2
MIRT627746 RAD54L2 RAD54 like 2 2 2
MIRT629578 RFC2 replication factor C subunit 2 2 4
MIRT630537 LGALS8 galectin 8 2 4
MIRT630559 C3orf36 chromosome 3 open reading frame 36 2 4
MIRT630568 SOWAHA sosondowah ankyrin repeat domain family member A 2 4
MIRT630763 MSANTD3 Myb/SANT DNA binding domain containing 3 2 2
MIRT635424 LRP10 LDL receptor related protein 10 2 2
MIRT636011 GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 2 2
MIRT636337 PHAX phosphorylated adaptor for RNA export 2 2
MIRT638413 POU3F2 POU class 3 homeobox 2 2 2
MIRT639358 INIP INTS3 and NABP interacting protein 2 2
MIRT642124 DYRK1A dual specificity tyrosine phosphorylation regulated kinase 1A 2 4
MIRT642828 KIAA0319 KIAA0319 2 2
MIRT644017 NUCB1 nucleobindin 1 2 2
MIRT644038 WWC2 WW and C2 domain containing 2 2 2
MIRT644153 GIN1 gypsy retrotransposon integrase 1 2 2
MIRT644649 SNX9 sorting nexin 9 2 2
MIRT645798 OMA1 OMA1 zinc metallopeptidase 2 2
MIRT647633 FAIM2 Fas apoptotic inhibitory molecule 2 2 2
MIRT648528 KIAA1143 KIAA1143 2 2
MIRT648851 PDLIM3 PDZ and LIM domain 3 2 2
MIRT648880 TUBGCP5 tubulin gamma complex associated protein 5 2 2
MIRT650777 TNFRSF10A TNF receptor superfamily member 10a 2 2
MIRT654200 RNF19B ring finger protein 19B 2 2
MIRT654508 RAB5B RAB5B, member RAS oncogene family 2 2
MIRT655249 PEX26 peroxisomal biogenesis factor 26 2 2
MIRT656089 MTA3 metastasis associated 1 family member 3 2 2
MIRT656599 LRRC55 leucine rich repeat containing 55 2 2
MIRT659194 CYBB cytochrome b-245 beta chain 2 2
MIRT660000 C1orf115 chromosome 1 open reading frame 115 2 4
MIRT661715 KLF8 Kruppel like factor 8 2 2
MIRT661813 PRPSAP1 phosphoribosyl pyrophosphate synthetase associated protein 1 2 2
MIRT668360 FGD4 FYVE, RhoGEF and PH domain containing 4 2 2
MIRT679734 CABP4 calcium binding protein 4 2 2
MIRT708616 NUDT18 nudix hydrolase 18 2 2
MIRT709034 TROVE2 TROVE domain family member 2 2 2
MIRT709573 DMGDH dimethylglycine dehydrogenase 2 2
MIRT709665 AJAP1 adherens junctions associated protein 1 2 2
MIRT709874 TRAF1 TNF receptor associated factor 1 2 2
MIRT710821 NLRP12 NLR family pyrin domain containing 12 2 2
MIRT710883 PARL presenilin associated rhomboid like 2 2
MIRT711547 LCAT lecithin-cholesterol acyltransferase 2 2
MIRT712017 STX1B syntaxin 1B 2 2
MIRT713058 BLVRA biliverdin reductase A 2 2
MIRT713129 THRB thyroid hormone receptor beta 2 2
MIRT713878 MOB3A MOB kinase activator 3A 2 2
MIRT714154 NXPH3 neurexophilin 3 2 2
MIRT719755 FLYWCH1 FLYWCH-type zinc finger 1 2 2
MIRT720213 KCNK1 potassium two pore domain channel subfamily K member 1 2 2
MIRT722728 BRMS1 breast cancer metastasis suppressor 1 2 2
MIRT725652 ABI2 abl interactor 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3152-5p Palbociclib 5330286 NSC758247 approved resistant cell line (T47D)
hsa-miR-3152-5p Palbociclib 5330286 NSC758247 approved resistant tissue (breast cancer)

Error report submission