pre-miRNA Information
pre-miRNA hsa-mir-103b-1   
Genomic Coordinates chr5: 168560904 - 168560965
Description Homo sapiens miR-103b-1 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-103b-2   
Genomic Coordinates chr20: 3917502 - 3917563
Description Homo sapiens miR-103b-2 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-103b
Sequence 1| UCAUAGCCCUGUACAAUGCUGCU |23
Evidence Experimental
Experiments ChIP-seq
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN28198041 16 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs369221403 4 dbSNP
rs1283132774 7 dbSNP
rs1222085747 10 dbSNP
rs572980521 14 dbSNP
rs748411363 15 dbSNP
rs769854452 23 dbSNP
Putative Targets

Gene Information
Gene Symbol AKR7L
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084045. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep3 HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb HITS-CLIP data was present in GSM1084078. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Prostate Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRX1760631. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_B ...

- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.).

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' ucGUCGUAACAU--GUCCCGAUacu 5'
            | ||| |  |  | |||| |   
Target 5' caCUGCACUCCAGCCUGGGCGAc-- 3'
13 - 35
Article - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al.
- Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
CLIP-seq Support 1 for dataset GSM1084045
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep3
Location of target site ENST00000420396.2 | 3UTR | UGACUGUGCCACUGCACUCCAGCCUGGGCGAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000420396.2 | 3UTR | AUGACUGUGCCACUGCACUCCAGCCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1084078
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep2_AbnovaAb
Location of target site ENST00000420396.2 | 3UTR | UGACUGUGCCACUGCACUCCAGCCUGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla 0.242 2.1e-1 0.044 4.4e-1 13 Click to see details
GSE28544 Breast cancer -0.04 4.3e-1 0.035 4.4e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
53 hsa-miR-103b Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT218386 E2F3 E2F transcription factor 3 2 2
MIRT404221 RPL7L1 ribosomal protein L7 like 1 2 2
MIRT441502 SPG20 spartin 2 6
MIRT444124 ZNRF3 zinc and ring finger 3 2 2
MIRT454236 OSBPL10 oxysterol binding protein like 10 2 4
MIRT457919 ZNF212 zinc finger protein 212 2 2
MIRT462254 LAMA4 laminin subunit alpha 4 2 2
MIRT463176 ZNF281 zinc finger protein 281 2 2
MIRT472355 TSPAN1 tetraspanin 1 2 2
MIRT474133 LIN54 lin-54 DREAM MuvB core complex component 2 4
MIRT494946 IFFO2 intermediate filament family orphan 2 2 2
MIRT497403 NPY4R neuropeptide Y receptor Y4 2 2
MIRT497641 GLDN gliomedin 2 2
MIRT505340 TMEM245 transmembrane protein 245 2 6
MIRT505680 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT510706 SREK1IP1 SREK1 interacting protein 1 2 6
MIRT512198 C1orf43 chromosome 1 open reading frame 43 2 2
MIRT522089 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 4
MIRT525074 FRK fyn related Src family tyrosine kinase 2 2
MIRT531276 PPIL3 peptidylprolyl isomerase like 3 2 2
MIRT535119 PLXNA2 plexin A2 2 2
MIRT540836 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT541018 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 2
MIRT545752 CA12 carbonic anhydrase 12 2 4
MIRT546404 SRP9 signal recognition particle 9 2 2
MIRT547991 HCFC2 host cell factor C2 2 4
MIRT554502 SAE1 SUMO1 activating enzyme subunit 1 2 2
MIRT558360 DMTF1 cyclin D binding myb like transcription factor 1 2 2
MIRT558863 CD2AP CD2 associated protein 2 2
MIRT559939 ZNF567 zinc finger protein 567 2 2
MIRT566300 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT567490 FOXK1 forkhead box K1 2 2
MIRT617139 ZNF556 zinc finger protein 556 2 2
MIRT625400 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 2 2
MIRT626491 CEP89 centrosomal protein 89 2 2
MIRT629487 GSN gelsolin 2 4
MIRT638456 PLXDC2 plexin domain containing 2 2 2
MIRT648498 CMBL carboxymethylenebutenolidase homolog 2 2
MIRT654845 PPM1L protein phosphatase, Mg2+/Mn2+ dependent 1L 2 2
MIRT664587 HSD17B12 hydroxysteroid 17-beta dehydrogenase 12 2 2
MIRT664977 TDRD1 tudor domain containing 1 2 2
MIRT665028 ELK1 ELK1, ETS transcription factor 2 2
MIRT666043 STON2 stonin 2 2 2
MIRT668863 CRY2 cryptochrome circadian clock 2 2 2
MIRT669297 C17orf85 nuclear cap binding subunit 3 2 2
MIRT680975 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682267 RS1 retinoschisin 1 2 2
MIRT685283 KIAA1143 KIAA1143 2 2
MIRT693375 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT701785 MSL1 male specific lethal 1 homolog 2 2
MIRT709373 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 2 2
MIRT715154 IL12B interleukin 12B 2 2
MIRT734499 ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif 5 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1 Anthocyanin NULL 145858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Caffeic acid NULL 689043 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Ferulic acid NULL 445858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Hesperidin NULL 10621 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-1 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR myocardial differentiation of mouse ES cells 19521018 2009 down-regulated
miR-1 Sulfonyl-hydrazone-1 (SHZ) NULL NULL Quantitative real-time PCR Murine broblast-derived Induced pluripotent stem cells 21445862 2011 up-regulated
miR-1 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 up-regulated
miR-1 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-1 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-1 Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 Palmitic acid approved 985 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-1 Essential amino acids (EAA) NULL NULL Quantitative real-time PCR skeletal muscle of young adults 19828686 2009 up-regulated
miR-1 Hydrogen peroxide (H2O2) NULL 784 Quantitative real-time PCR Human umbilical vein endothelial cells 21527937 2011 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-1 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-1 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR cardia 22889704 2012 up-regulated
miR-1 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-1 Quinidine approved 441074 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 up-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 down-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR post-infarction rat cardiomyocytes 21220930 2011 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-1 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-103b Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-miR-103b Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-103b Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-103b Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-103b Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-103b Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-103b Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)

Error report submission