>MDC1|NM_014641|3'UTR
   1 GAACTCCACTACCCTTTTCCCTCCCAGACCACGAATTAGAAGATATGTGGAAGAAAGAACTCAGGGCGTTAGAAAGGATT
  81 GGGGTATATTGATACAACTTGTCCTGGAACATGGGTGGGACCAGAAATCTTTATGAATAAATGAAAAGATAAGGGATTTG
 161 GAAGCCACAGGTTGTTTTTTGTTTGTTTGTTTGTTTTTTTAATGGCCATTTTATTTTATTTGTATTTATAGTTTTTTATT
 241 TGTATAGATTTAGGGGATACAAGATTTCTTACATGCATGTATTAAATGGCCATTTTAAAATTAGCTAGTTTCATGCTCAG
 321 ATGTCATAAGTGGCAGCTATCTTTAGCCAGACTGTTGCAGTTATTGCTCGATGCCACTCATGGTGTCCTACCTCCTATTT
 401 GGAAACCATCTCTATTTTTTTCTTACTGAGATTCTTACTTTGGGGTCAGGAACTTGAAGGGATGCTTGGAGTGAGTAGAT
 481 TTGAGGGTCCAGTTATGGAGTGCTACTAAAACATTTTCTTCTCTCCTGGCCTCTGGAAGCATCTTTAGCTTTGACTTTGG
 561 GCAAGTCTCTGTACTTTTCTGGCCAGCTTTTCCAGGATTTATAAAATTAGAGCTTCGGCTTGACCTCTGTGATAAATAAA
 641 TATTCACTCTGTGCCTTAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' aggUAGUCCUCAGUACCUUCGa 5' || |||: |: ||||||| Target 5' aagATAAGGGATT-TGGAAGCc 3'	146 - 166	158.00	-13.40
2	miRNA 3' agguaGUCCUCAGUACCUUCGa 5' | || || ||||||| Target 5' ctctcCTGGCCTC-TGGAAGCa 3'	521 - 541	148.00	-13.00
3	miRNA 3' aggUAGUCCUCAGU--ACCUUCga 5' ||:|| || :| |||||| Target 5' cgaATTAGAAGATATGTGGAAGaa 3'	32 - 55	141.00	-11.30

Mutant ID	Mutant Position	Mutant Source
COSN509362	16	COSMIC
COSN30458232	21	COSMIC
COSN31551104	32	COSMIC
COSN31515402	33	COSMIC
COSN31488398	53	COSMIC
COSN509361	67	COSMIC
COSN14217216	68	COSMIC
COSN30156248	125	COSMIC
COSN30146779	151	COSMIC
COSN30528544	238	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs755122873	4	dbSNP
rs1356592483	5	dbSNP
rs1304981670	7	dbSNP
rs1464820746	11	dbSNP
rs763896174	12	dbSNP
rs192077052	14	dbSNP
rs114770843	16	dbSNP
rs766564459	17	dbSNP
rs772354979	19	dbSNP
rs760943919	29	dbSNP
rs773278323	32	dbSNP
rs767500271	33	dbSNP
rs762323882	39	dbSNP
rs1482139390	43	dbSNP
rs1255686214	44	dbSNP
rs774742623	46	dbSNP
rs1203472947	66	dbSNP
rs915265922	67	dbSNP
rs1047141994	68	dbSNP
rs989436681	76	dbSNP
rs576556895	81	dbSNP
rs7565	83	dbSNP
rs1287025767	95	dbSNP
rs118122910	99	dbSNP
rs1479142209	107	dbSNP
rs982563411	111	dbSNP
rs976975981	134	dbSNP
rs970936320	139	dbSNP
rs113970104	149	dbSNP
rs1391893760	152	dbSNP
rs781307650	153	dbSNP
rs1409022038	156	dbSNP
rs1324934355	166	dbSNP
rs910232810	170	dbSNP
rs61059475	171	dbSNP
rs199502906	182	dbSNP
rs751506751	185	dbSNP
rs1213094288	197	dbSNP
rs139775092	197	dbSNP
rs534317758	197	dbSNP
rs1293136228	201	dbSNP
rs1323332245	202	dbSNP
rs1222980637	203	dbSNP
rs1034811212	208	dbSNP
rs565380394	209	dbSNP
rs996522524	217	dbSNP
rs1489839462	219	dbSNP
rs1418505901	222	dbSNP
rs1263342216	229	dbSNP
rs549049195	233	dbSNP
rs371344246	263	dbSNP
rs1184450920	264	dbSNP
rs879496328	269	dbSNP
rs1477146069	271	dbSNP
rs899458009	290	dbSNP
rs148773470	304	dbSNP
rs1019379128	306	dbSNP
rs1214651767	308	dbSNP
rs550228125	314	dbSNP
rs188942971	320	dbSNP
rs1428861557	326	dbSNP
rs1215698638	338	dbSNP
rs549676087	339	dbSNP
rs1470500837	349	dbSNP
rs533162091	368	dbSNP
rs903044364	369	dbSNP
rs1041513061	374	dbSNP
rs1011487090	379	dbSNP
rs758207427	380	dbSNP
rs893046689	386	dbSNP
rs1380206668	394	dbSNP
rs13200913	396	dbSNP
rs1246350105	397	dbSNP
rs930023163	419	dbSNP
rs1055601468	428	dbSNP
rs144270739	434	dbSNP
rs1357169050	445	dbSNP
rs926592670	448	dbSNP
rs1225005296	456	dbSNP
rs1284312398	458	dbSNP
rs1046487139	476	dbSNP
rs760179643	478	dbSNP
rs1213065849	479	dbSNP
rs908751169	481	dbSNP
rs982942803	493	dbSNP
rs1483376008	505	dbSNP
rs531687554	508	dbSNP
rs952823476	510	dbSNP
rs942857948	511	dbSNP
rs1302256680	521	dbSNP
rs1383842367	521	dbSNP
rs112804650	525	dbSNP
rs541377120	529	dbSNP
rs1407920856	549	dbSNP
rs920177719	562	dbSNP
rs979034409	577	dbSNP
rs1452260242	582	dbSNP
rs527670141	583	dbSNP
rs946407837	585	dbSNP
rs1448878211	587	dbSNP
rs1280022146	592	dbSNP
rs975640353	599	dbSNP
rs963760746	616	dbSNP
rs1019684522	617	dbSNP
rs1280144786	620	dbSNP
rs914876330	621	dbSNP
rs1202715462	622	dbSNP
rs1241654338	643	dbSNP
rs1452941360	643	dbSNP
rs368295367	645	dbSNP
rs1232742462	649	dbSNP
rs1459296978	650	dbSNP
rs1363830967	653	dbSNP

- Genes & development, 2013

When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.

- Neoplasia (New York, N.Y.), 2016

MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.