pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4464 |
Genomic Coordinates | chr6: 90312742 - 90312833 |
Description | Homo sapiens miR-4464 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4464 | |||||||||||||||||||||||||||||||||||
Sequence | 12| AAGGUUUGGAUAGAUGCAAUA |32 | |||||||||||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||||||||||
Experiments | Illumina | |||||||||||||||||||||||||||||||||||
Editing Events in miRNAs |
|
|||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |
---|---|
Gene Symbol | RPLP1 |
Synonyms | LP1, P1, RPP1 |
Description | ribosomal protein lateral stalk subunit P1 |
Transcript | NM_001003 |
Other Transcripts | NM_213725 |
Expression | |
Putative miRNA Targets on RPLP1 | |
3'UTR of RPLP1 (miRNA target sites are highlighted) |
>RPLP1|NM_001003|3'UTR 1 ACCTCTTTTATAACATGTTCAATAAAAAGCTGAACTTT Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
DRVs in gene 3'UTRs | |
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293S |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084078. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_AbnovaAb
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
CLIP-seq Support 1 for dataset GSM1084078 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_nohippuristanol_rep2_AbnovaAb |
Location of target site | ENST00000260379.6 | 3UTR | AAGUGGAAAAAAAAAAAGAUUC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
81 hsa-miR-4464 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT056004 | ARL5B | ADP ribosylation factor like GTPase 5B | ![]() |
![]() |
2 | 2 | ||||||
MIRT061568 | BTG2 | BTG anti-proliferation factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT078651 | ICT1 | mitochondrial ribosomal protein L58 | ![]() |
![]() |
2 | 2 | ||||||
MIRT087551 | YWHAH | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta | ![]() |
![]() |
2 | 4 | ||||||
MIRT088139 | SEPT2 | septin 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT095089 | SEC24A | SEC24 homolog A, COPII coat complex component | ![]() |
![]() |
2 | 4 | ||||||
MIRT099065 | FOXC1 | forkhead box C1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT150194 | MIDN | midnolin | ![]() |
![]() |
2 | 2 | ||||||
MIRT178173 | EIF5AL1 | eukaryotic translation initiation factor 5A-like 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT178942 | C11ORF57 | chromosome 11 open reading frame 57 | ![]() |
![]() |
2 | 2 | ||||||
MIRT188776 | SESN2 | sestrin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT267026 | EFHD2 | EF-hand domain family member D2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT307213 | ACVR2B | activin A receptor type 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT324750 | ACER2 | alkaline ceramidase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT442732 | TEAD1 | TEA domain transcription factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT444087 | C12orf73 | chromosome 12 open reading frame 73 | ![]() |
![]() |
2 | 2 | ||||||
MIRT445527 | KLF9 | Kruppel like factor 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT449604 | INIP | INTS3 and NABP interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT451129 | ZNF99 | zinc finger protein 99 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452271 | RPL30 | ribosomal protein L30 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452486 | DDX4 | DEAD-box helicase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454868 | DNAJC15 | DnaJ heat shock protein family (Hsp40) member C15 | ![]() |
![]() |
2 | 6 | ||||||
MIRT455773 | TSPAN6 | tetraspanin 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT463844 | WRN | Werner syndrome RecQ like helicase | ![]() |
![]() |
2 | 2 | ||||||
MIRT465036 | TTC39C | tetratricopeptide repeat domain 39C | ![]() |
![]() |
2 | 2 | ||||||
MIRT465176 | TRPV2 | transient receptor potential cation channel subfamily V member 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT465294 | TRIB3 | tribbles pseudokinase 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT467931 | SLC16A7 | solute carrier family 16 member 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471906 | NUAK2 | NUAK family kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472724 | MTUS1 | microtubule associated scaffold protein 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT479785 | CCND1 | cyclin D1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT482446 | ADM | adrenomedullin | ![]() |
![]() |
2 | 10 | ||||||
MIRT485365 | MYLIP | myosin regulatory light chain interacting protein | ![]() |
![]() |
2 | 12 | ||||||
MIRT498399 | KIF6 | kinesin family member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT503202 | ACTB | actin beta | ![]() |
![]() |
2 | 6 | ||||||
MIRT503819 | TMEM242 | transmembrane protein 242 | ![]() |
![]() |
2 | 2 | ||||||
MIRT504706 | ZNF117 | zinc finger protein 117 | ![]() |
![]() |
2 | 2 | ||||||
MIRT507802 | CDKN1B | cyclin dependent kinase inhibitor 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT509968 | KANSL1L | KAT8 regulatory NSL complex subunit 1 like | ![]() |
![]() |
2 | 4 | ||||||
MIRT517306 | ELF4 | E74 like ETS transcription factor 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT523900 | ENPP6 | ectonucleotide pyrophosphatase/phosphodiesterase 6 | ![]() |
![]() |
2 | 6 | ||||||
MIRT532018 | NOX5 | NADPH oxidase 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT535334 | PHACTR2 | phosphatase and actin regulator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT536944 | HCN4 | hyperpolarization activated cyclic nucleotide gated potassium channel 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT539322 | AHSA2 | activator of HSP90 ATPase homolog 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540189 | GSTM4 | glutathione S-transferase mu 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT545015 | ZNF439 | zinc finger protein 439 | ![]() |
![]() |
2 | 2 | ||||||
MIRT545265 | TRIM36 | tripartite motif containing 36 | ![]() |
![]() |
2 | 4 | ||||||
MIRT547230 | PAG1 | phosphoprotein membrane anchor with glycosphingolipid microdomains 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT548425 | ELOVL5 | ELOVL fatty acid elongase 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT549910 | ADH4 | alcohol dehydrogenase 4 (class II), pi polypeptide | ![]() |
![]() |
2 | 2 | ||||||
MIRT550185 | TMEM106C | transmembrane protein 106C | ![]() |
![]() |
2 | 2 | ||||||
MIRT550775 | ENOX2 | ecto-NOX disulfide-thiol exchanger 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT552401 | ZNF487P | zinc finger protein 487 | ![]() |
1 | 1 | |||||||
MIRT554782 | RHEBP1 | RHEB pseudogene 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT557311 | HIF1A | hypoxia inducible factor 1 alpha subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT558635 | CNNM2 | cyclin and CBS domain divalent metal cation transport mediator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563168 | RPS14 | ribosomal protein S14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564886 | YWHAE | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon | ![]() |
![]() |
2 | 2 | ||||||
MIRT565778 | SEPHS1 | selenophosphate synthetase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT566480 | PDCD4 | programmed cell death 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT567206 | IGFBP5 | insulin like growth factor binding protein 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568931 | SMCR8 | Smith-Magenis syndrome chromosome region, candidate 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570698 | FBXO41 | F-box protein 41 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573474 | MTRNR2L9 | MT-RNR2-like 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT576170 | Hmox1 | heme oxygenase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT607555 | GLI2 | GLI family zinc finger 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT608203 | ERBB2 | erb-b2 receptor tyrosine kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT609779 | VWC2L | von Willebrand factor C domain containing protein 2 like | ![]() |
![]() |
2 | 4 | ||||||
MIRT616312 | CELF2 | CUGBP Elav-like family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617190 | CDH13 | cadherin 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT626842 | RPLP1 | ribosomal protein lateral stalk subunit P1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT636438 | MARCH1 | membrane associated ring-CH-type finger 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT639101 | GLIPR1L2 | GLI pathogenesis related 1 like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691018 | CRTC3 | CREB regulated transcription coactivator 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700008 | RPS21 | ribosomal protein S21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701144 | PANK1 | pantothenate kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712691 | NUDT7 | nudix hydrolase 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715505 | MAZ | MYC associated zinc finger protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT722509 | PTPRC | protein tyrosine phosphatase, receptor type C | ![]() |
![]() |
2 | 2 | ||||||
MIRT724982 | TNS1 | tensin 1 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Associations | |||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|