pre-miRNA Information
pre-miRNA hsa-mir-548t   
Genomic Coordinates chr4: 173268160 - 173268233
Description Homo sapiens miR-548t stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-548t-3p
Sequence 46| AAAAACCACAAUUACUUUUGCACCA |70
Evidence Not_experimental
Experiments
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 2 4 + 173268206 29233923 MiREDiBase
A-to-I 3 4 + 173268207 29233923 MiREDiBase
A-to-I 4 4 + 173268208 29233923 MiREDiBase
A-to-I 10 4 + 173268214 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs73872515 5 dbSNP
rs1426966747 6 dbSNP
rs1158401109 21 dbSNP
rs943938928 24 dbSNP
Putative Targets

Gene Information
Gene Symbol AP3B1   
Synonyms ADTB3, ADTB3A, HPS, HPS2, PE
Description adaptor related protein complex 3 beta 1 subunit
Transcript NM_003664   
Expression
Putative miRNA Targets on AP3B1
3'UTR of AP3B1
(miRNA target sites are highlighted)
>AP3B1|NM_003664|3'UTR
   1 CCTGCTTACATCTGGACTTTAGAATCTGGCACACAACAAAAGTGCCTGGCATCCACTACTGCTGCCTTTCATTTATAATA
  81 ATAGCCCTTCCATCTGGCAGTGGGGGTAGAATACACTCTTGACATTCTTGTCTCCTGCTTTAGAATGCTAGTGTGTATCT
 161 ATCATGTATGCAATACTTTCCCCCTTTTTGCTTTGCTAACCAAAGAGCATATATTTTACTGTCAGTTGTCTCAACTCTTG
 241 AATCCATGTGGCGTTTTCTCTGTCCTGCTGCTTCTTTTGGCCTCCTCGTTTTCCTTCTCTTTTTCGACAATGGTAGACAT
 321 GAATGAGATATTTAAAGTTCATTGGAAATCTTCTTCCCTACAGCAGTAAGCAAAAATTAGCAAAGAGATAGTCTAAATGG
 401 CCTCTCAGCTTGGTATGTGAAAATGAGATCACATACTTTTTAAATCCAAATACAAAAGCATAGTCTCTGCAAGATTTTGT
 481 TCTTTGAATTTCTTGATATTGTAATTGATTATTGATAACTGTCATCATGAAATTATCTCTCAATAATAAGATAAATAAAC
 561 TAGCATATGAATCATAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' accacGUUUUCA--UUA---ACAC--CAAAAa 5'
               |||   |  |||   ||||  ||||| 
Target 5' tgtctCAACTCTTGAATCCATGTGGCGTTTTc 3'
227 - 258 114.00 -7.20
2
miRNA  3' accACGUUUUC--AUUA---AC--ACCAAAAa 5'
             | ||||||  ||:|   ||   | |||| 
Target 5' aaaTACAAAAGCATAGTCTCTGCAAGATTTTg 3'
448 - 479 102.00 -6.82
3
miRNA  3' acCACGUUUUCAUUA--ACACCAAAAa 5'
            ||| ||| | :||    |  |||| 
Target 5' atGTGAAAATGAGATCACATACTTTTt 3'
415 - 441 97.00 -5.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1207984 41 ClinVar
906459 44 ClinVar
354219 70 ClinVar
354218 101 ClinVar
354217 107 ClinVar
354216 141 ClinVar
906458 191 ClinVar
354215 379 ClinVar
904843 380 ClinVar
904844 380 ClinVar
354214 447 ClinVar
904842 482 ClinVar
354213 507 ClinVar
354212 560 ClinVar
COSN31586346 12 COSMIC
COSN14179940 20 COSMIC
COSN26548293 26 COSMIC
COSN26554009 37 COSMIC
COSN17153502 41 COSMIC
COSN30455483 54 COSMIC
COSN31492258 57 COSMIC
COSN30457382 91 COSMIC
COSN14792393 107 COSMIC
COSN26565373 123 COSMIC
COSN31604053 132 COSMIC
COSN30132927 141 COSMIC
COSN30460943 180 COSMIC
COSN31504564 190 COSMIC
COSN31516201 287 COSMIC
COSN31595757 318 COSMIC
COSN31549929 399 COSMIC
COSN24777144 447 COSMIC
COSN31543978 560 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1021165592 1 dbSNP
rs755752427 2 dbSNP
rs1277325815 7 dbSNP
rs942517218 8 dbSNP
rs199521659 10 dbSNP
rs1390030764 14 dbSNP
rs1162592102 15 dbSNP
rs1398426452 19 dbSNP
rs1369968306 20 dbSNP
rs1009638675 24 dbSNP
rs200456538 27 dbSNP
rs780915786 28 dbSNP
rs375163910 29 dbSNP
rs763841787 36 dbSNP
rs1466601526 38 dbSNP
rs1423406222 39 dbSNP
rs112214336 41 dbSNP
rs182487478 44 dbSNP
rs1206790418 46 dbSNP
rs1268972846 47 dbSNP
rs765141824 49 dbSNP
rs760757738 51 dbSNP
rs1486440499 53 dbSNP
rs941977192 55 dbSNP
rs1213669190 59 dbSNP
rs1349978530 64 dbSNP
rs886060769 70 dbSNP
rs1286218825 78 dbSNP
rs1329847042 86 dbSNP
rs918624052 92 dbSNP
rs766029582 101 dbSNP
rs1469676030 102 dbSNP
rs1199071824 103 dbSNP
rs929044217 105 dbSNP
rs11552314 107 dbSNP
rs1159865656 116 dbSNP
rs1414822950 118 dbSNP
rs540703378 120 dbSNP
rs1332981670 123 dbSNP
rs570942210 130 dbSNP
rs1311668066 135 dbSNP
rs753283084 141 dbSNP
rs992209236 145 dbSNP
rs1324423823 147 dbSNP
rs1214978590 151 dbSNP
rs1335436050 157 dbSNP
rs1440106437 161 dbSNP
rs1281402252 166 dbSNP
rs959070738 167 dbSNP
rs1329947807 170 dbSNP
rs926831596 172 dbSNP
rs1287028640 179 dbSNP
rs190285646 182 dbSNP
rs369987939 183 dbSNP
rs1327396462 184 dbSNP
rs1210257683 185 dbSNP
rs6864605 191 dbSNP
rs1021123097 218 dbSNP
rs1348945440 229 dbSNP
rs1009753859 232 dbSNP
rs1164467388 239 dbSNP
rs1251829155 240 dbSNP
rs1474614632 246 dbSNP
rs544830395 248 dbSNP
rs970215199 251 dbSNP
rs868442378 252 dbSNP
rs867801817 253 dbSNP
rs1396023532 262 dbSNP
rs1408365912 264 dbSNP
rs1449453109 273 dbSNP
rs1405454504 279 dbSNP
rs899824806 281 dbSNP
rs1010683230 283 dbSNP
rs893452770 285 dbSNP
rs1038816649 287 dbSNP
rs575976353 288 dbSNP
rs1467281732 302 dbSNP
rs773135696 305 dbSNP
rs769645790 306 dbSNP
rs1265111406 316 dbSNP
rs1274932745 337 dbSNP
rs559226132 342 dbSNP
rs887724674 354 dbSNP
rs1309003047 355 dbSNP
rs901056728 356 dbSNP
rs1227553036 357 dbSNP
rs1040995881 361 dbSNP
rs1371655771 363 dbSNP
rs1304904590 366 dbSNP
rs115124715 379 dbSNP
rs911081557 380 dbSNP
rs1048945561 381 dbSNP
rs1056222654 385 dbSNP
rs937789738 386 dbSNP
rs1311202859 398 dbSNP
rs1404463183 401 dbSNP
rs1463262881 403 dbSNP
rs187770688 404 dbSNP
rs1804790 412 dbSNP
rs1294813663 413 dbSNP
rs554959862 415 dbSNP
rs931449825 417 dbSNP
rs926304522 418 dbSNP
rs1167116461 434 dbSNP
rs918581877 436 dbSNP
rs972670538 437 dbSNP
rs1230391887 440 dbSNP
rs960041888 441 dbSNP
rs886060768 447 dbSNP
rs1281768704 449 dbSNP
rs759104986 458 dbSNP
rs753338653 459 dbSNP
rs1445608580 460 dbSNP
rs928864823 466 dbSNP
rs1266818201 467 dbSNP
rs552733544 479 dbSNP
rs538570213 482 dbSNP
rs1172016011 485 dbSNP
rs970615539 499 dbSNP
rs1466640659 500 dbSNP
rs1288190526 505 dbSNP
rs865863660 507 dbSNP
rs1481772970 515 dbSNP
rs1436998194 519 dbSNP
rs1321043722 529 dbSNP
rs1011067836 532 dbSNP
rs1438175120 540 dbSNP
rs914176898 550 dbSNP
rs1204179254 552 dbSNP
rs957771030 557 dbSNP
rs1031175064 560 dbSNP
rs886060767 560 dbSNP
rs988271636 562 dbSNP
rs999162849 565 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084078. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' accacguUUUCAUUAACACCAAAAa 5'
                 ||||  :|| ||||||| 
Target 5' ------uAAAG--GUU-UGGUUUUu 3'
1 - 16
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084078
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep2_AbnovaAb
Location of target site ENST00000255194.6 | 3UTR | UAAAGGUUUGGUUUUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
168 hsa-miR-548t-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT059365 ANP32E acidic nuclear phosphoprotein 32 family member E 2 2
MIRT072839 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 6
MIRT076945 PCGF2 polycomb group ring finger 2 2 6
MIRT083941 TFAP2C transcription factor AP-2 gamma 2 2
MIRT085401 ETS2 ETS proto-oncogene 2, transcription factor 2 2
MIRT109790 KLHL15 kelch like family member 15 2 2
MIRT114046 AKAP11 A-kinase anchoring protein 11 2 10
MIRT130165 TXNIP thioredoxin interacting protein 2 6
MIRT150013 MIDN midnolin 2 2
MIRT181258 ASH1L ASH1 like histone lysine methyltransferase 2 2
MIRT205594 NCL nucleolin 2 2
MIRT222253 ACTB actin beta 2 4
MIRT245653 EIF5AL1 eukaryotic translation initiation factor 5A-like 1 2 4
MIRT250947 CDK5R1 cyclin dependent kinase 5 regulatory subunit 1 2 4
MIRT252497 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT271990 ARF1 ADP ribosylation factor 1 2 4
MIRT280804 RNF11 ring finger protein 11 2 2
MIRT293803 FEM1A fem-1 homolog A 2 2
MIRT318231 RREB1 ras responsive element binding protein 1 2 2
MIRT341455 ATP6V0B ATPase H+ transporting V0 subunit b 2 2
MIRT347413 CEBPG CCAAT/enhancer binding protein gamma 2 4
MIRT351860 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT357983 GRPEL2 GrpE like 2, mitochondrial 2 2
MIRT377094 PPP1CB protein phosphatase 1 catalytic subunit beta 2 2
MIRT407303 IGFBP5 insulin like growth factor binding protein 5 2 2
MIRT441564 LMOD3 leiomodin 3 2 2
MIRT442364 ZC3H12C zinc finger CCCH-type containing 12C 2 2
MIRT443228 ARL5B ADP ribosylation factor like GTPase 5B 2 2
MIRT443404 HMX3 H6 family homeobox 3 2 2
MIRT446055 NR5A2 nuclear receptor subfamily 5 group A member 2 2 2
MIRT448277 ZNF652 zinc finger protein 652 2 2
MIRT450822 KCNB1 potassium voltage-gated channel subfamily B member 1 2 2
MIRT453016 CCDC115 coiled-coil domain containing 115 2 17
MIRT454463 PPP2R2B protein phosphatase 2 regulatory subunit Bbeta 2 2
MIRT456360 CITED2 Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 2 2 2
MIRT460007 DNALI1 dynein axonemal light intermediate chain 1 2 2
MIRT463154 ZNF385A zinc finger protein 385A 2 6
MIRT463766 YPEL2 yippee like 2 2 2
MIRT468310 SFT2D2 SFT2 domain containing 2 2 2
MIRT470668 POLR2D RNA polymerase II subunit D 2 4
MIRT478517 CTTN cortactin 2 2
MIRT480507 C11orf57 chromosome 11 open reading frame 57 2 2
MIRT484718 INHBA inhibin beta A subunit 2 12
MIRT485494 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT487302 SLC38A9 solute carrier family 38 member 9 2 2
MIRT487771 ANKEF1 ankyrin repeat and EF-hand domain containing 1 2 16
MIRT491876 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT494304 CEP120 centrosomal protein 120 2 2
MIRT495396 TRIM24 tripartite motif containing 24 2 2
MIRT495646 CDK1 cyclin dependent kinase 1 2 2
MIRT496665 TMEM237 transmembrane protein 237 2 2
MIRT496837 ZNF460 zinc finger protein 460 2 2
MIRT498638 CHD4 chromodomain helicase DNA binding protein 4 2 10
MIRT503928 FBXL13 F-box and leucine rich repeat protein 13 2 4
MIRT506063 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 2 2
MIRT506582 MIER3 MIER family member 3 2 4
MIRT506606 MAT2A methionine adenosyltransferase 2A 2 4
MIRT506844 KIF23 kinesin family member 23 2 6
MIRT508536 RPP14 ribonuclease P/MRP subunit p14 2 4
MIRT509669 ZNF354B zinc finger protein 354B 2 10
MIRT511170 MBNL3 muscleblind like splicing regulator 3 2 6
MIRT512147 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT512831 ID4 inhibitor of DNA binding 4, HLH protein 2 6
MIRT514558 XRCC3 X-ray repair cross complementing 3 2 4
MIRT515856 AJAP1 adherens junctions associated protein 1 2 4
MIRT521848 PNISR PNN interacting serine and arginine rich protein 2 4
MIRT525364 SYNM synemin 2 2
MIRT527120 ARHGAP15 Rho GTPase activating protein 15 2 2
MIRT527271 FBLN2 fibulin 2 2 2
MIRT527439 COL4A3 collagen type IV alpha 3 chain 2 2
MIRT527658 CD300E CD300e molecule 2 2
MIRT528334 TBC1D22B TBC1 domain family member 22B 2 2
MIRT529033 EXOC8 exocyst complex component 8 2 2
MIRT529321 PDE5A phosphodiesterase 5A 2 2
MIRT529677 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT529846 SMTN smoothelin 2 2
MIRT530385 ZNF431 zinc finger protein 431 2 2
MIRT530913 GPR85 G protein-coupled receptor 85 2 2
MIRT531794 KDR kinase insert domain receptor 2 2
MIRT532246 KLF2 Kruppel like factor 2 2 4
MIRT532658 CBX7 chromobox 7 2 2
MIRT533630 TMX3 thioredoxin related transmembrane protein 3 2 2
MIRT534811 RAB33B RAB33B, member RAS oncogene family 2 2
MIRT534975 PSD3 pleckstrin and Sec7 domain containing 3 2 2
MIRT536588 ITPKB inositol-trisphosphate 3-kinase B 2 2
MIRT536779 HNRNPD heterogeneous nuclear ribonucleoprotein D 2 2
MIRT538764 CABLES1 Cdk5 and Abl enzyme substrate 1 2 2
MIRT539294 ANGEL2 angel homolog 2 2 2
MIRT539621 SHISA9 shisa family member 9 2 2
MIRT539651 BUB1 BUB1 mitotic checkpoint serine/threonine kinase 2 2
MIRT540347 OPHN1 oligophrenin 1 2 2
MIRT540413 PITPNC1 phosphatidylinositol transfer protein, cytoplasmic 1 2 2
MIRT541396 CDC27 cell division cycle 27 2 2
MIRT542916 HSBP1 heat shock factor binding protein 1 2 2
MIRT544710 EIF5A eukaryotic translation initiation factor 5A 2 4
MIRT544998 MFF mitochondrial fission factor 2 4
MIRT553289 TSPAN3 tetraspanin 3 2 2
MIRT553455 TNRC6C trinucleotide repeat containing 6C 2 2
MIRT553782 TAF13 TATA-box binding protein associated factor 13 2 2
MIRT554656 ROBO1 roundabout guidance receptor 1 2 2
MIRT555104 PURB purine rich element binding protein B 2 2
MIRT557235 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT560861 GAL3ST3 galactose-3-O-sulfotransferase 3 2 2
MIRT561545 SON SON DNA binding protein 2 2
MIRT561554 SLMO2 PRELI domain containing 3B 2 2
MIRT563764 ZNF678 zinc finger protein 678 2 2
MIRT565653 SIX4 SIX homeobox 4 2 2
MIRT568080 CELF2 CUGBP Elav-like family member 2 2 2
MIRT568759 MYBL1 MYB proto-oncogene like 1 2 2
MIRT569078 CADM2 cell adhesion molecule 2 2 2
MIRT569509 THYN1 thymocyte nuclear protein 1 2 2
MIRT571268 CDKN2AIP CDKN2A interacting protein 2 2
MIRT571809 PHF19 PHD finger protein 19 2 2
MIRT572554 DKK3 dickkopf WNT signaling pathway inhibitor 3 2 2
MIRT573782 SLC24A4 solute carrier family 24 member 4 2 4
MIRT576441 Ccdc115 coiled-coil domain containing 115 2 10
MIRT576712 Slc30a3 solute carrier family 30 (zinc transporter), member 3 2 3
MIRT608377 PIWIL2 piwi like RNA-mediated gene silencing 2 2 2
MIRT608484 NKTR natural killer cell triggering receptor 2 6
MIRT610186 FAM49A family with sequence similarity 49 member A 2 2
MIRT611631 EDIL3 EGF like repeats and discoidin domains 3 2 2
MIRT613534 TRA2B transformer 2 beta homolog 2 2
MIRT616221 PTPN11 protein tyrosine phosphatase, non-receptor type 11 2 2
MIRT622370 SALL1 spalt like transcription factor 1 2 2
MIRT624371 CDK12 cyclin dependent kinase 12 2 2
MIRT624995 ZNF665 zinc finger protein 665 2 4
MIRT626875 AP3B1 adaptor related protein complex 3 beta 1 subunit 2 2
MIRT627737 RAP2B RAP2B, member of RAS oncogene family 2 4
MIRT628490 ADAT2 adenosine deaminase, tRNA specific 2 2 2
MIRT633647 PLEKHG7 pleckstrin homology and RhoGEF domain containing G7 2 4
MIRT634028 SLC30A3 solute carrier family 30 member 3 2 3
MIRT635923 GLTSCR2 NOP53 ribosome biogenesis factor 2 2
MIRT638287 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT641959 RNF115 ring finger protein 115 2 2
MIRT643573 CTNNA3 catenin alpha 3 2 2
MIRT645180 NOL9 nucleolar protein 9 2 4
MIRT647497 ZNF639 zinc finger protein 639 2 2
MIRT647682 PCK1 phosphoenolpyruvate carboxykinase 1 2 2
MIRT648422 MYOZ3 myozenin 3 2 2
MIRT650113 ZCCHC9 zinc finger CCHC-type containing 9 2 2
MIRT651076 ZNF518B zinc finger protein 518B 2 4
MIRT651415 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 2 2
MIRT651456 XKR4 XK related 4 2 2
MIRT653619 SLC30A4 solute carrier family 30 member 4 2 2
MIRT653637 SLC30A1 solute carrier family 30 member 1 2 2
MIRT654896 POU2F1 POU class 2 homeobox 1 2 2
MIRT656483 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 2
MIRT658016 GABRA4 gamma-aminobutyric acid type A receptor alpha4 subunit 2 2
MIRT658041 FZD10 frizzled class receptor 10 2 2
MIRT660093 BTBD3 BTB domain containing 3 2 2
MIRT663923 MAGEF1 MAGE family member F1 2 2
MIRT665882 TGIF2 TGFB induced factor homeobox 2 2 2
MIRT669051 CEP128 centrosomal protein 128 2 2
MIRT669711 AAGAB alpha and gamma adaptin binding protein 2 2
MIRT686812 SNX2 sorting nexin 2 2 4
MIRT689883 SOD2 superoxide dismutase 2 2 2
MIRT693274 GLRX2 glutaredoxin 2 2 4
MIRT697056 BCAR1 BCAR1, Cas family scaffolding protein 2 2
MIRT703297 GID4 GID complex subunit 4 homolog 2 2
MIRT704087 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT707719 CDC6 cell division cycle 6 2 2
MIRT708136 GK5 glycerol kinase 5 (putative) 2 2
MIRT709212 KLHL30 kelch like family member 30 2 2
MIRT710062 RWDD2A RWD domain containing 2A 2 2
MIRT712770 POU6F2 POU class 6 homeobox 2 2 2
MIRT715073 TMTC1 transmembrane and tetratricopeptide repeat containing 1 2 2
MIRT715387 TADA3 transcriptional adaptor 3 2 2
MIRT717712 NCKAP1 NCK associated protein 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-548t Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-548t Cisplatin 5460033 NSC119875 approved sensitive cell line (W1)
hsa-mir-548t Doxorubicin 31703 NSC123127 approved sensitive cell line (W1)
hsa-mir-548t Topotecan 60699 NSC609699 approved sensitive cell line (W1)
hsa-mir-548t Vincristine 5978 approved sensitive cell line (W1)
hsa-miR-548t-3p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (SW480, HCT-116)
hsa-miR-548t-3p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-548t-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)

Error report submission