>MED16|NM_005481|3'UTR
   1 CGGCCGGGGGTCCAGGCGGACCTTGTGGTGACCCGGCTCGGGCGTCTCCTCGGTTTCCTTGCCTCACCCGCGGAGAGCGC
  81 TGAACCTGGACAAGCAGCGGCTGGGAAGGACAGGTCCAATAAACGCCCTCTGCGCCCAGAAAAAAAAAAAAAAAAAAAAA
 161 AAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ucUUGGAGC-CGAC---CCC--GCCCGa 5' :||||:| | || || ||||| Target 5' cgGACCTTGTGGTGACCCGGCTCGGGCg 3'	17 - 44	116.00	-26.10
2	miRNA 3' ucUUGGAGC----CGACCCCGCCCga 5' ||||| | || | ||| || Target 5' tgAACCTGGACAAGCAGCGGCTGGga 3'	81 - 106	110.00	-20.86
3	miRNA 3' ucuuggaGCCGACC-------CCGCCcga 5' |||| || ||||| Target 5' -------CGGCCGGGGGTCCAGGCGGacc 3'	1 - 22	107.00	-16.82

Mutant ID	Mutant Position	Mutant Source
COSN32064238	2	COSMIC
COSN30489953	12	COSMIC
COSN30502778	39	COSMIC
COSN30133371	43	COSMIC
COSN26984118	53	COSMIC
COSN26984119	69	COSMIC
COSN20065882	70	COSMIC
COSN26984117	71	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs144537136	1	dbSNP
rs777124816	2	dbSNP
rs771376202	3	dbSNP
rs747648738	4	dbSNP
rs200186933	5	dbSNP
rs368502301	6	dbSNP
rs779812234	8	dbSNP
rs553582024	10	dbSNP
rs1252241565	11	dbSNP
rs375750252	12	dbSNP
rs372778012	13	dbSNP
rs369568636	17	dbSNP
rs143517669	18	dbSNP
rs764334049	21	dbSNP
rs556075367	22	dbSNP
rs765556744	24	dbSNP
rs1482178074	26	dbSNP
rs1279157336	27	dbSNP
rs762618349	31	dbSNP
rs1349343410	32	dbSNP
rs538557263	33	dbSNP
rs776886424	34	dbSNP
rs571122682	35	dbSNP
rs1330191738	36	dbSNP
rs761128908	37	dbSNP
rs1374084631	38	dbSNP
rs754462464	39	dbSNP
rs200916270	40	dbSNP
rs769457900	41	dbSNP
rs542394626	43	dbSNP
rs186193269	44	dbSNP
rs757212982	45	dbSNP
rs1183988946	46	dbSNP
rs929163824	48	dbSNP
rs548404885	51	dbSNP
rs1010652861	52	dbSNP
rs111620646	52	dbSNP
rs973750054	68	dbSNP
rs770359585	69	dbSNP
rs113862234	70	dbSNP
rs562763547	71	dbSNP
rs902109331	72	dbSNP
rs1424859374	73	dbSNP
rs1040996859	77	dbSNP
rs943357134	78	dbSNP
rs910513576	79	dbSNP
rs971458931	81	dbSNP
rs1302968581	82	dbSNP
rs758773354	85	dbSNP
rs1380853040	89	dbSNP
rs550526504	98	dbSNP
rs117801197	99	dbSNP
rs891990204	100	dbSNP
rs866866549	101	dbSNP
rs1220242809	102	dbSNP
rs1033164215	108	dbSNP
rs1306871356	111	dbSNP
rs117346489	113	dbSNP
rs900724167	118	dbSNP
rs1038727574	119	dbSNP
rs960794390	124	dbSNP
rs927912288	125	dbSNP
rs182667690	126	dbSNP
rs572136187	127	dbSNP
rs890117832	128	dbSNP
rs560253253	133	dbSNP
rs929051712	134	dbSNP
rs920440536	135	dbSNP
rs370470379	136	dbSNP
rs1360804901	137	dbSNP

- Genes & development, 2013

When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.