pre-miRNA Information
pre-miRNA hsa-mir-2115   
Genomic Coordinates chr3: 48316360 - 48316459
Description Homo sapiens miR-2115 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-2115-5p
Sequence 21| AGCUUCCAUGACUCCUGAUGGA |42
Evidence Experimental
Experiments 454
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs372327506 9 dbSNP
rs1259362191 10 dbSNP
rs1215292065 12 dbSNP
rs1197671843 16 dbSNP
rs1468768022 20 dbSNP
rs1273755407 21 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol UNC93A   
Synonyms Unc-93A, dJ366N23.1, dJ366N23.2
Description unc-93 homolog A
Transcript NM_001143947   
Other Transcripts NM_018974   
Expression
Putative miRNA Targets on UNC93A
3'UTR of UNC93A
(miRNA target sites are highlighted)
>UNC93A|NM_001143947|3'UTR
   1 GAGCAGTGAGGTCCGAGGAGGATGAACTCAGAAAGCACCAGCCAGAGAATTTTCTTAGAAGATGCCTCAGGACATAGAGC
  81 GGCTCCTCATCACCATCTCAGCACAATTTGGCCATTCTGAAGAGATCATGTTATTTCACTCTTCATGTATTTTTTTTCTA
 161 TTCTAACAAATTTTTCGTCCACCATCTTAACAGAGATCAAGTGTATACATGAAGGTATCAGTTCATTTAATTTTAGATGC
 241 AAAAGAAAAAGGTCTAACGTACAATCAGCCAATTAGAATTTGCCTGAAATCATAGACTCACCCTAGTTTTATTGCTGTAG
 321 TTGTTTTTAAGAATTGGAAGCCTGCTTAAAAAATGTAGTTGAGCCCCATAATTTTACAAATGGGCGAACTTTTAAACTTC
 401 TAACTCTACTTGGATCAAAACCTCATACATTTTACAAAGGGGTCCTGACAAGTCAGCTGACTCAACCTCACAGAGTCAGG
 481 GGGTGACAAAGCCAGACTGGGGCTCAGGATTCCTGAAACGTGTGGGGTCTGCGTTTCTAAATAAAGACGGTTATTTAATG
 561 GAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' agguAGUCCUCAGUACCUUCGa 5'
              |:| || |  ||||||| 
Target 5' gtttTTAAGAAT--TGGAAGCc 3'
323 - 342 150.00 -9.20
2
miRNA  3' aggUAGUCCU--CAG-----UACCUUcga 5'
             || | ||  ||:     ||||||   
Target 5' taaATAAAGACGGTTATTTAATGGAAaaa 3'
538 - 566 109.00 -5.82
3
miRNA  3' agGUAGUC---CUC-----AGUACCUUCga 5'
            || |||   |||     || | ||||  
Target 5' agCACCAGCCAGAGAATTTTCTTAGAAGat 3'
34 - 63 104.00 -8.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30489136 4 COSMIC
COSN31582142 4 COSMIC
COSN31498140 9 COSMIC
COSN8892434 15 COSMIC
COSN31531272 18 COSMIC
COSN30149425 30 COSMIC
COSN28767005 40 COSMIC
COSN22103533 47 COSMIC
COSN30109448 48 COSMIC
COSN30109440 49 COSMIC
COSN27001241 54 COSMIC
COSN31601336 66 COSMIC
COSN30134049 69 COSMIC
COSN30515117 74 COSMIC
COSN28509760 76 COSMIC
COSN30171704 81 COSMIC
COSN27001243 84 COSMIC
COSN31505204 112 COSMIC
COSN19356242 131 COSMIC
COSN31525973 164 COSMIC
COSN14208736 176 COSMIC
COSN20884673 178 COSMIC
COSN6313475 560 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1201889479 2 dbSNP
rs1258690069 3 dbSNP
rs781435532 11 dbSNP
rs1183487972 12 dbSNP
rs528728931 14 dbSNP
rs664452 15 dbSNP
rs766667263 15 dbSNP
rs756678900 16 dbSNP
rs780091496 21 dbSNP
rs968974108 22 dbSNP
rs1363362326 24 dbSNP
rs1466729526 28 dbSNP
rs1304857898 36 dbSNP
rs1399752465 39 dbSNP
rs749303981 40 dbSNP
rs768622742 48 dbSNP
rs779155488 50 dbSNP
rs558689248 58 dbSNP
rs1450479371 65 dbSNP
rs577857186 71 dbSNP
rs1392816011 76 dbSNP
rs931716542 77 dbSNP
rs1436049961 78 dbSNP
rs1352370938 82 dbSNP
rs113737602 84 dbSNP
rs1344559610 87 dbSNP
rs1428608661 90 dbSNP
rs1385616842 96 dbSNP
rs1332675615 106 dbSNP
rs1290525968 107 dbSNP
rs545019093 108 dbSNP
rs1395812227 110 dbSNP
rs760673811 118 dbSNP
rs1290877509 120 dbSNP
rs1439874094 121 dbSNP
rs1379802688 125 dbSNP
rs1302964981 127 dbSNP
rs1051944252 130 dbSNP
rs1345908443 131 dbSNP
rs540717037 143 dbSNP
rs442368 145 dbSNP
rs1316383932 147 dbSNP
rs1487740228 150 dbSNP
rs67843022 150 dbSNP
rs28373754 177 dbSNP
rs940332885 178 dbSNP
rs1244635336 185 dbSNP
rs544307840 189 dbSNP
rs1193323432 209 dbSNP
rs1280456206 210 dbSNP
rs186595829 216 dbSNP
rs560920126 221 dbSNP
rs1191391525 222 dbSNP
rs1406659342 224 dbSNP
rs796743740 225 dbSNP
rs1162615552 227 dbSNP
rs371335503 230 dbSNP
rs994731759 239 dbSNP
rs796943787 240 dbSNP
rs1191232169 249 dbSNP
rs1323596305 251 dbSNP
rs796117560 251 dbSNP
rs1477325691 255 dbSNP
rs984126788 256 dbSNP
rs1369072717 257 dbSNP
rs1044837504 259 dbSNP
rs974931576 260 dbSNP
rs1443437830 263 dbSNP
rs549744291 266 dbSNP
rs905039498 267 dbSNP
rs1003410444 271 dbSNP
rs1036179218 273 dbSNP
rs1284204411 283 dbSNP
rs1329471933 292 dbSNP
rs1222091007 302 dbSNP
rs1322942039 307 dbSNP
rs1309795232 311 dbSNP
rs960180884 315 dbSNP
rs1398528666 318 dbSNP
rs564776386 320 dbSNP
rs1213484296 325 dbSNP
rs1010627060 346 dbSNP
rs1464913346 347 dbSNP
rs1020317947 349 dbSNP
rs1429670795 353 dbSNP
rs1201193364 354 dbSNP
rs1476819079 360 dbSNP
rs1470081095 364 dbSNP
rs1245690938 366 dbSNP
rs1181884971 381 dbSNP
rs968921975 386 dbSNP
rs979017131 387 dbSNP
rs1260552225 392 dbSNP
rs1197257023 404 dbSNP
rs922214136 412 dbSNP
rs201539330 417 dbSNP
rs953669228 427 dbSNP
rs987681610 429 dbSNP
rs1221197817 437 dbSNP
rs1343136293 447 dbSNP
rs1274398381 453 dbSNP
rs1443039068 462 dbSNP
rs1468166898 478 dbSNP
rs1329253611 479 dbSNP
rs1445925981 479 dbSNP
rs1178360742 481 dbSNP
rs1412656209 483 dbSNP
rs911616851 485 dbSNP
rs1177962045 488 dbSNP
rs1412456545 498 dbSNP
rs940464392 501 dbSNP
rs1424041152 512 dbSNP
rs1158717047 517 dbSNP
rs1162669660 520 dbSNP
rs1235777094 521 dbSNP
rs1035962960 524 dbSNP
rs920263224 533 dbSNP
rs879039451 534 dbSNP
rs1324474896 546 dbSNP
rs930525436 549 dbSNP
rs1044952313 550 dbSNP
rs387155 560 dbSNP
rs1239419983 561 dbSNP
rs939162124 562 dbSNP
rs1383422760 563 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb HITS-CLIP data was present in GSM1084066. RNA binding protein: AGO2. Condition:CLIP_noemetine_SantaCruzAb HITS-CLIP data was present in GSM1084067. RNA binding protein: AGO2. Condition:CLIP_emetine_SantaCruzAb HITS-CLIP data was present in GSM1084068. RNA binding protein: AGO2. Condition:CLIP_noemetine_SigmaAb HITS-CLIP data was present in GSM1084074. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep1_SantaCruzAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000230256.3 | 3UTR | UUAAGAAUUGGAAGCCUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084066
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_SantaCruzAb
Location of target site ENST00000230256.3 | 3UTR | UUAAGAAUUGGAAGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1084067
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_SantaCruzAb
Location of target site ENST00000230256.3 | 3UTR | UUAAGAAUUGGAAGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1084068
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_SigmaAb
Location of target site ENST00000230256.3 | 3UTR | UUAAGAAUUGGAAGCCUGCUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1084074
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep1_SantaCruzAb
Location of target site ENST00000230256.3 | 3UTR | UUAAGAAUUGGAAGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BLCA 0.99 0.05 0.875 0.16 3 Click to see details
BRCA -0.453 0.07 -0.486 0.05 12 Click to see details
HNSC -0.378 0.23 -0.200 0.35 6 Click to see details
LUSC -0.2 0.32 -0.310 0.23 8 Click to see details
LUSC -0.2 0.32 -0.310 0.23 8 Click to see details
LUSC -0.2 0.32 -0.310 0.23 8 Click to see details
LUSC -0.2 0.32 -0.310 0.23 8 Click to see details
84 hsa-miR-2115-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT155281 IFNAR2 interferon alpha and beta receptor subunit 2 2 6
MIRT257301 MYLIP myosin regulatory light chain interacting protein 2 8
MIRT441907 SEPN1 selenoprotein N 2 2
MIRT442300 ZNF496 zinc finger protein 496 2 2
MIRT468235 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT469331 RGP1 RGP1 homolog, RAB6A GEF complex partner 1 2 2
MIRT470203 PSAT1 phosphoserine aminotransferase 1 2 6
MIRT475945 GXYLT1 glucoside xylosyltransferase 1 2 4
MIRT481449 ARRB2 arrestin beta 2 2 2
MIRT497440 SLC16A10 solute carrier family 16 member 10 2 2
MIRT498270 KIAA1644 KIAA1644 2 2
MIRT499225 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT501742 NSD1 nuclear receptor binding SET domain protein 1 2 2
MIRT501762 NRF1 nuclear respiratory factor 1 2 6
MIRT527902 B3GALT5 beta-1,3-galactosyltransferase 5 2 4
MIRT528559 DNAAF3 dynein axonemal assembly factor 3 2 2
MIRT531252 PDF peptide deformylase, mitochondrial 2 2
MIRT539490 ACTN4 actinin alpha 4 2 2
MIRT550683 YARS tyrosyl-tRNA synthetase 2 2
MIRT573441 APOPT1 apoptogenic 1, mitochondrial 2 2
MIRT616740 DCTN5 dynactin subunit 5 2 2
MIRT617626 RAB3IP RAB3A interacting protein 2 2
MIRT620780 MT1A metallothionein 1A 2 2
MIRT623174 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT624880 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 2 2
MIRT625799 MDC1 mediator of DNA damage checkpoint 1 2 2
MIRT629790 CHRFAM7A CHRNA7 (exons 5-10) and FAM7A (exons A-E) fusion 2 2
MIRT630535 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT630762 ZNF445 zinc finger protein 445 2 2
MIRT630921 UNC93A unc-93 homolog A 2 2
MIRT630949 PANK1 pantothenate kinase 1 2 2
MIRT631688 NQO2 N-ribosyldihydronicotinamide:quinone reductase 2 2 2
MIRT633898 FGF10 fibroblast growth factor 10 2 2
MIRT635935 PLA2G12A phospholipase A2 group XIIA 2 2
MIRT636177 THBD thrombomodulin 2 2
MIRT636730 AFAP1 actin filament associated protein 1 2 2
MIRT638038 SHPK sedoheptulokinase 2 2
MIRT639164 LAMTOR3 late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 2 2
MIRT639260 MANEAL mannosidase endo-alpha like 2 2
MIRT639327 C9orf41 carnosine N-methyltransferase 1 2 2
MIRT639849 YY1 YY1 transcription factor 2 2
MIRT641474 B4GALNT3 beta-1,4-N-acetyl-galactosaminyltransferase 3 2 2
MIRT642783 CHCHD3 coiled-coil-helix-coiled-coil-helix domain containing 3 2 2
MIRT643653 MYOCD myocardin 2 2
MIRT645717 PTPRF protein tyrosine phosphatase, receptor type F 2 2
MIRT648018 SLCO4C1 solute carrier organic anion transporter family member 4C1 2 2
MIRT648236 C15orf40 chromosome 15 open reading frame 40 2 2
MIRT648563 MEMO1 mediator of cell motility 1 2 2
MIRT648731 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT650179 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT650721 TNFSF8 TNF superfamily member 8 2 2
MIRT652179 TRIM44 tripartite motif containing 44 2 2
MIRT654272 RFFL ring finger and FYVE like domain containing E3 ubiquitin protein ligase 2 2
MIRT654493 RAD51L3-RFFL RAD51L3-RFFL readthrough 2 2
MIRT654861 PPM1F protein phosphatase, Mg2+/Mn2+ dependent 1F 2 2
MIRT656392 MCU mitochondrial calcium uniporter 2 2
MIRT656623 LRRC15 leucine rich repeat containing 15 2 2
MIRT657085 JMY junction mediating and regulatory protein, p53 cofactor 2 2
MIRT659793 CBLB Cbl proto-oncogene B 2 2
MIRT660155 BRCC3 BRCA1/BRCA2-containing complex subunit 3 2 2
MIRT662444 SERPINB5 serpin family B member 5 2 2
MIRT663116 SPTA1 spectrin alpha, erythrocytic 1 2 2
MIRT665759 TMEM43 transmembrane protein 43 2 2
MIRT666357 SIKE1 suppressor of IKBKE 1 2 2
MIRT668521 ESRRG estrogen related receptor gamma 2 2
MIRT677776 FKTN fukutin 2 2
MIRT678900 TTLL12 tubulin tyrosine ligase like 12 2 2
MIRT702825 HOOK3 hook microtubule tethering protein 3 2 2
MIRT704424 CTNNBIP1 catenin beta interacting protein 1 2 2
MIRT709470 KRTAP19-1 keratin associated protein 19-1 2 2
MIRT710939 MRPL45 mitochondrial ribosomal protein L45 2 2
MIRT713306 TYRP1 tyrosinase related protein 1 2 2
MIRT716932 FAM13A family with sequence similarity 13 member A 2 2
MIRT717539 PYGO2 pygopus family PHD finger 2 2 2
MIRT718060 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 2
MIRT718934 TRIM66 tripartite motif containing 66 2 2
MIRT719770 ZNF236 zinc finger protein 236 2 2
MIRT720164 PNPO pyridoxamine 5'-phosphate oxidase 2 2
MIRT721280 RAD54L2 RAD54 like 2 2 2
MIRT721359 ENTHD1 ENTH domain containing 1 2 2
MIRT721506 CARHSP1 calcium regulated heat stable protein 1 2 2
MIRT721920 LINGO2 leucine rich repeat and Ig domain containing 2 2 2
MIRT722791 FUT4 fucosyltransferase 4 2 2
MIRT723933 SVOP SV2 related protein 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-2115 Docetaxel+Cisplatin+5-Fluorouracil sensitive tissue (hypopharyngeal squamous cell carcinoma)
hsa-mir-2115 Decitabine 451668 approved sensitive tissue (esopheageal cancer)
hsa-miR-2115-5p Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-2115-5p Tamoxifen 2733525 NSC180973 approved sensitive cell line (LCC2)
hsa-miR-2115-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-2115-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission