pre-miRNA Information
pre-miRNA hsa-mir-4640   
Genomic Coordinates chr6: 30890883 - 30890972
Description Homo sapiens miR-4640 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4640-5p
Sequence 9| UGGGCCAGGGAGCAGCUGGUGGG |31
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1392105945 7 dbSNP
rs939712790 9 dbSNP
rs762825841 15 dbSNP
rs71552023 20 dbSNP
rs1305909531 21 dbSNP
rs750017220 21 dbSNP
rs1375436057 23 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B32FZJ miR-4640 Safety Biomarker (SAF) Clinical/Experimental Data Expression lower Urine Quantitative polymerase chain reaction
Gene Information
Gene Symbol ZNF878
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084042. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep2 HITS-CLIP data was present in GSM1084043. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep2 HITS-CLIP data was present in GSM1084044. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep3 HITS-CLIP data was present in GSM1084046. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep4 HITS-CLIP data was present in GSM1084073. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084042
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep2
Location of target site ENST00000547628.1 | 3UTR | AGAAGGCUGGGAUUACAGGCGUGAGCCACCGCGCCUGGCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084043
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep2
Location of target site ENST00000547628.1 | 3UTR | AGAAGGCUGGGAUUACAGGCGUGAGCCACCGCGCCUGGCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1084044
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep3
Location of target site ENST00000547628.1 | 3UTR | AGAAGGCUGGGAUUACAGGCGUGAGCCACCGCGCCUGGCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1084046
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep4
Location of target site ENST00000547628.1 | 3UTR | AGAAGGCUGGGAUUACAGGCGUGAGCCACCGCGCCUGGCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1084073
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep1_AbnovaAb
Location of target site ENST00000547628.1 | 3UTR | AGAAGGCUGGGAUUACAGGCGUGAGCCACCGCGCCUGGCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
87 hsa-miR-4640-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT100106 ABT1 activator of basal transcription 1 2 8
MIRT248144 LMBR1L limb development membrane protein 1 like 2 2
MIRT327062 KLHL15 kelch like family member 15 2 2
MIRT347231 GATAD2A GATA zinc finger domain containing 2A 2 2
MIRT450221 CENPN centromere protein N 2 2
MIRT451264 NDUFA11 NADH:ubiquinone oxidoreductase subunit A11 2 2
MIRT452701 C1orf226 chromosome 1 open reading frame 226 2 2
MIRT453212 CERS1 ceramide synthase 1 2 2
MIRT454822 POLR2J3 RNA polymerase II subunit J3 2 2
MIRT454883 RAD50 RAD50 double strand break repair protein 2 2
MIRT455783 TAF8 TATA-box binding protein associated factor 8 2 2
MIRT455858 TMEM254 transmembrane protein 254 2 2
MIRT457615 UPK3BL uroplakin 3B like 1 2 2
MIRT457822 ITPRIP inositol 1,4,5-trisphosphate receptor interacting protein 2 4
MIRT458344 NOC2L NOC2 like nucleolar associated transcriptional repressor 2 2
MIRT458376 ITM2C integral membrane protein 2C 2 2
MIRT458928 SAMD4B sterile alpha motif domain containing 4B 2 2
MIRT459066 WFIKKN2 WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2 2 2
MIRT460138 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT460818 FSTL4 follistatin like 4 2 2
MIRT461285 COX10 COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor 2 2
MIRT462738 EFNB1 ephrin B1 2 2
MIRT464556 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT477910 DUSP2 dual specificity phosphatase 2 2 2
MIRT479073 CNNM4 cyclin and CBS domain divalent metal cation transport mediator 4 2 4
MIRT479534 CDC5L cell division cycle 5 like 2 4
MIRT485628 EEPD1 endonuclease/exonuclease/phosphatase family domain containing 1 2 2
MIRT489896 PPIC peptidylprolyl isomerase C 2 4
MIRT490737 SRCIN1 SRC kinase signaling inhibitor 1 2 2
MIRT491201 MLLT1 MLLT1, super elongation complex subunit 2 4
MIRT492681 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 2 2
MIRT494593 ATG7 autophagy related 7 2 2
MIRT495061 PADI3 peptidyl arginine deiminase 3 2 4
MIRT496623 TMEM67 transmembrane protein 67 2 2
MIRT497177 ZBTB40 zinc finger and BTB domain containing 40 2 2
MIRT498217 TLN2 talin 2 2 2
MIRT498306 BCL11B B-cell CLL/lymphoma 11B 2 2
MIRT499668 NPHP3 nephrocystin 3 2 2
MIRT508080 ANKRD52 ankyrin repeat domain 52 2 2
MIRT509707 ANKRD23 ankyrin repeat domain 23 2 2
MIRT509841 FOS Fos proto-oncogene, AP-1 transcription factor subunit 2 2
MIRT512814 ARRDC2 arrestin domain containing 2 2 2
MIRT513353 SLIT1 slit guidance ligand 1 2 2
MIRT514293 FXYD5 FXYD domain containing ion transport regulator 5 2 2
MIRT516598 FAM89A family with sequence similarity 89 member A 2 4
MIRT516616 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 2 2
MIRT518348 CCL5 C-C motif chemokine ligand 5 2 2
MIRT520130 WSB1 WD repeat and SOCS box containing 1 2 2
MIRT522072 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT526461 OSBPL5 oxysterol binding protein like 5 2 2
MIRT528278 MBL2 mannose binding lectin 2 2 2
MIRT534844 RAB15 RAB15, member RAS oncogene family 2 4
MIRT542245 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT543299 ZNF585B zinc finger protein 585B 2 2
MIRT552456 ZNF410 zinc finger protein 410 2 2
MIRT553641 TJAP1 tight junction associated protein 1 2 2
MIRT557103 HOXA3 homeobox A3 2 2
MIRT570782 FANCA Fanconi anemia complementation group A 2 2
MIRT630912 ZMAT2 zinc finger matrin-type 2 2 2
MIRT631034 ZNF878 zinc finger protein 878 2 2
MIRT639017 AAK1 AP2 associated kinase 1 2 2
MIRT648596 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT648939 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 2 2
MIRT652834 TACO1 translational activator of cytochrome c oxidase I 2 2
MIRT659347 CSRP1 cysteine and glycine rich protein 1 2 2
MIRT664163 APOBEC3F apolipoprotein B mRNA editing enzyme catalytic subunit 3F 2 2
MIRT670511 ZSCAN22 zinc finger and SCAN domain containing 22 2 2
MIRT671246 TMEM41B transmembrane protein 41B 2 2
MIRT672120 ATP6V0A2 ATPase H+ transporting V0 subunit a2 2 2
MIRT672313 CD3D CD3d molecule 2 2
MIRT672543 BRMS1L breast cancer metastasis-suppressor 1 like 2 2
MIRT673036 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT673814 DARS aspartyl-tRNA synthetase 2 2
MIRT674858 GINM1 glycoprotein integral membrane 1 2 2
MIRT674970 SH3BP2 SH3 domain binding protein 2 2 2
MIRT675185 KIF1C kinesin family member 1C 2 2
MIRT675219 UGDH UDP-glucose 6-dehydrogenase 2 2
MIRT675558 MED16 mediator complex subunit 16 2 2
MIRT682566 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 2 2
MIRT684640 PDE4C phosphodiesterase 4C 2 2
MIRT689722 ATXN2 ataxin 2 2 2
MIRT693594 SLC39A1 solute carrier family 39 member 1 2 2
MIRT704745 CDKN2B cyclin dependent kinase inhibitor 2B 2 2
MIRT712779 ZNF154 zinc finger protein 154 2 2
MIRT718118 OTOF otoferlin 2 2
MIRT720115 SAMD4A sterile alpha motif domain containing 4A 2 2
MIRT720275 EIF1AD eukaryotic translation initiation factor 1A domain containing 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4640 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-mir-4640 Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-mir-4640 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-4640-5p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-4640-5p Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-4640-5p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-4640-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-4640-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-4640-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-4640-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-4640-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-4640-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-4640-5p Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-4640-5p Docetaxel+Cisplatin+5-Fluorouracil resistant tissue (hypopharyngeal squamous cell carcinoma)

Error report submission