>NQO2|NM_000904|3'UTR
   1 CTCTGTGGCACGTGGGCATCACGTAAGCAGCACACTAGGAGGCCCAGGCGCAGGCAAAGAGAAGATGGTGCTGTCATGAA
  81 ATAAAATTACAACATAGCTACCTGGGGATACTTTTTTCTTTCTGTTTTTTGTTTGTTTTTAATTTTAGCTTTAAGGAGCA
 161 CATGGCCAGTACTGTTTCAGGGGAATATTGGGTGGCGCTGGGGTTTGGGCTTCTATTGATC

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ugggagacuuUCCUUCGu 5' ||||:|| Target 5' gcagcacactAGGAGGCc 3'	27 - 44	124.00	-8.10
2	miRNA 3' uggGAGACUUUCCUUCGu 5' ||:| |||| ||| Target 5' tagCTTT--AAGG-AGCa 3'	146 - 160	99.00	-9.60
3	miRNA 3' ugggAGACUUUCCUUcgu 5' |:| |::|||| Target 5' actgTTTCAGGGGAAtat 3'	171 - 188	98.00	-6.82

Mutant ID	Mutant Position	Mutant Source
COSN30140620	8	COSMIC
COSN30192979	13	COSMIC
COSN30543660	46	COSMIC
COSN30119096	51	COSMIC
COSN28743046	93	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs776729124	2	dbSNP
rs1361755390	4	dbSNP
rs201164276	6	dbSNP
rs1174249711	9	dbSNP
rs1454489685	10	dbSNP
rs765148956	12	dbSNP
rs112677559	13	dbSNP
rs762611939	14	dbSNP
rs576937534	15	dbSNP
rs751029943	23	dbSNP
rs745598139	24	dbSNP
rs1328081187	25	dbSNP
rs778229610	26	dbSNP
rs758199393	33	dbSNP
rs757614582	34	dbSNP
rs779392331	36	dbSNP
rs746229049	37	dbSNP
rs6955	39	dbSNP
rs748559661	47	dbSNP
rs747033207	48	dbSNP
rs768901014	50	dbSNP
rs761904146	51	dbSNP
rs1266742688	55	dbSNP
rs1407010375	65	dbSNP
rs184948026	66	dbSNP
rs115952408	72	dbSNP
rs1028962666	78	dbSNP
rs1310068725	88	dbSNP
rs1220877285	95	dbSNP

- Genes & development, 2013

When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.