pre-miRNA Information
pre-miRNA hsa-mir-2115   
Genomic Coordinates chr3: 48316360 - 48316459
Description Homo sapiens miR-2115 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-2115-5p
Sequence 21| AGCUUCCAUGACUCCUGAUGGA |42
Evidence Experimental
Experiments 454
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs372327506 9 dbSNP
rs1259362191 10 dbSNP
rs1215292065 12 dbSNP
rs1197671843 16 dbSNP
rs1468768022 20 dbSNP
rs1273755407 21 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NQO2   
Synonyms DHQV, DIA6, NMOR2, QR2
Description N-ribosyldihydronicotinamide:quinone reductase 2
Transcript NM_000904   
Expression
Putative miRNA Targets on NQO2
3'UTR of NQO2
(miRNA target sites are highlighted)
>NQO2|NM_000904|3'UTR
   1 CTCTGTGGCACGTGGGCATCACGTAAGCAGCACACTAGGAGGCCCAGGCGCAGGCAAAGAGAAGATGGTGCTGTCATGAA
  81 ATAAAATTACAACATAGCTACCTGGGGATACTTTTTTCTTTCTGTTTTTTGTTTGTTTTTAATTTTAGCTTTAAGGAGCA
 161 CATGGCCAGTACTGTTTCAGGGGAATATTGGGTGGCGCTGGGGTTTGGGCTTCTATTGATC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' agGUAGUCCUC-AGU-A-CCUUCGa 5'
            |:| || ||  || | |||:|| 
Target 5' caCGTAAGCAGCACACTAGGAGGCc 3'
20 - 44 108.00 -9.50
2
miRNA  3' agguAGUCCUC--AGUACCU-UCGa 5'
              |||||:|  |  |||: :|| 
Target 5' tgttTCAGGGGAATATTGGGTGGCg 3'
173 - 197 96.00 -13.20
3
miRNA  3' agguaguccuCAGUACCUUcga 5'
                    |||||| ||   
Target 5' agatggtgctGTCATGAAAtaa 3'
63 - 84 88.00 -5.81
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30140620 8 COSMIC
COSN30192979 13 COSMIC
COSN30543660 46 COSMIC
COSN30119096 51 COSMIC
COSN28743046 93 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs776729124 2 dbSNP
rs1361755390 4 dbSNP
rs201164276 6 dbSNP
rs1174249711 9 dbSNP
rs1454489685 10 dbSNP
rs765148956 12 dbSNP
rs112677559 13 dbSNP
rs762611939 14 dbSNP
rs576937534 15 dbSNP
rs751029943 23 dbSNP
rs745598139 24 dbSNP
rs1328081187 25 dbSNP
rs778229610 26 dbSNP
rs758199393 33 dbSNP
rs757614582 34 dbSNP
rs779392331 36 dbSNP
rs746229049 37 dbSNP
rs6955 39 dbSNP
rs748559661 47 dbSNP
rs747033207 48 dbSNP
rs768901014 50 dbSNP
rs761904146 51 dbSNP
rs1266742688 55 dbSNP
rs1407010375 65 dbSNP
rs184948026 66 dbSNP
rs115952408 72 dbSNP
rs1028962666 78 dbSNP
rs1310068725 88 dbSNP
rs1220877285 95 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb HITS-CLIP data was present in GSM1084073. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000338130.2 | 3UTR | AGCAGAGCUUGCAGUGAGCCGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000338130.2 | 3UTR | AGCAGAGCUUGCAGUGAGCCGAGAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1084073
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep1_AbnovaAb
Location of target site ENST00000338130.2 | 3UTR | AGCAGAGCUUGCAGUGAGCCGAGAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC 0.547 0.13 0.657 0.08 6 Click to see details
BLCA -0.871 0.16 -1.000 0.5 3 Click to see details
LUSC 0.239 0.28 0.048 0.46 8 Click to see details
BRCA -0.043 0.45 -0.070 0.41 12 Click to see details
BRCA -0.043 0.45 -0.070 0.41 12 Click to see details
BRCA -0.043 0.45 -0.070 0.41 12 Click to see details
BRCA -0.043 0.45 -0.070 0.41 12 Click to see details
84 hsa-miR-2115-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT155281 IFNAR2 interferon alpha and beta receptor subunit 2 2 6
MIRT257301 MYLIP myosin regulatory light chain interacting protein 2 8
MIRT441907 SEPN1 selenoprotein N 2 2
MIRT442300 ZNF496 zinc finger protein 496 2 2
MIRT468235 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT469331 RGP1 RGP1 homolog, RAB6A GEF complex partner 1 2 2
MIRT470203 PSAT1 phosphoserine aminotransferase 1 2 6
MIRT475945 GXYLT1 glucoside xylosyltransferase 1 2 4
MIRT481449 ARRB2 arrestin beta 2 2 2
MIRT497440 SLC16A10 solute carrier family 16 member 10 2 2
MIRT498270 KIAA1644 KIAA1644 2 2
MIRT499225 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT501742 NSD1 nuclear receptor binding SET domain protein 1 2 2
MIRT501762 NRF1 nuclear respiratory factor 1 2 6
MIRT527902 B3GALT5 beta-1,3-galactosyltransferase 5 2 4
MIRT528559 DNAAF3 dynein axonemal assembly factor 3 2 2
MIRT531252 PDF peptide deformylase, mitochondrial 2 2
MIRT539490 ACTN4 actinin alpha 4 2 2
MIRT550683 YARS tyrosyl-tRNA synthetase 2 2
MIRT573441 APOPT1 apoptogenic 1, mitochondrial 2 2
MIRT616740 DCTN5 dynactin subunit 5 2 2
MIRT617626 RAB3IP RAB3A interacting protein 2 2
MIRT620780 MT1A metallothionein 1A 2 2
MIRT623174 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT624880 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 2 2
MIRT625799 MDC1 mediator of DNA damage checkpoint 1 2 2
MIRT629790 CHRFAM7A CHRNA7 (exons 5-10) and FAM7A (exons A-E) fusion 2 2
MIRT630535 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT630762 ZNF445 zinc finger protein 445 2 2
MIRT630921 UNC93A unc-93 homolog A 2 2
MIRT630949 PANK1 pantothenate kinase 1 2 2
MIRT631688 NQO2 N-ribosyldihydronicotinamide:quinone reductase 2 2 2
MIRT633898 FGF10 fibroblast growth factor 10 2 2
MIRT635935 PLA2G12A phospholipase A2 group XIIA 2 2
MIRT636177 THBD thrombomodulin 2 2
MIRT636730 AFAP1 actin filament associated protein 1 2 2
MIRT638038 SHPK sedoheptulokinase 2 2
MIRT639164 LAMTOR3 late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 2 2
MIRT639260 MANEAL mannosidase endo-alpha like 2 2
MIRT639327 C9orf41 carnosine N-methyltransferase 1 2 2
MIRT639849 YY1 YY1 transcription factor 2 2
MIRT641474 B4GALNT3 beta-1,4-N-acetyl-galactosaminyltransferase 3 2 2
MIRT642783 CHCHD3 coiled-coil-helix-coiled-coil-helix domain containing 3 2 2
MIRT643653 MYOCD myocardin 2 2
MIRT645717 PTPRF protein tyrosine phosphatase, receptor type F 2 2
MIRT648018 SLCO4C1 solute carrier organic anion transporter family member 4C1 2 2
MIRT648236 C15orf40 chromosome 15 open reading frame 40 2 2
MIRT648563 MEMO1 mediator of cell motility 1 2 2
MIRT648731 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT650179 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT650721 TNFSF8 TNF superfamily member 8 2 2
MIRT652179 TRIM44 tripartite motif containing 44 2 2
MIRT654272 RFFL ring finger and FYVE like domain containing E3 ubiquitin protein ligase 2 2
MIRT654493 RAD51L3-RFFL RAD51L3-RFFL readthrough 2 2
MIRT654861 PPM1F protein phosphatase, Mg2+/Mn2+ dependent 1F 2 2
MIRT656392 MCU mitochondrial calcium uniporter 2 2
MIRT656623 LRRC15 leucine rich repeat containing 15 2 2
MIRT657085 JMY junction mediating and regulatory protein, p53 cofactor 2 2
MIRT659793 CBLB Cbl proto-oncogene B 2 2
MIRT660155 BRCC3 BRCA1/BRCA2-containing complex subunit 3 2 2
MIRT662444 SERPINB5 serpin family B member 5 2 2
MIRT663116 SPTA1 spectrin alpha, erythrocytic 1 2 2
MIRT665759 TMEM43 transmembrane protein 43 2 2
MIRT666357 SIKE1 suppressor of IKBKE 1 2 2
MIRT668521 ESRRG estrogen related receptor gamma 2 2
MIRT677776 FKTN fukutin 2 2
MIRT678900 TTLL12 tubulin tyrosine ligase like 12 2 2
MIRT702825 HOOK3 hook microtubule tethering protein 3 2 2
MIRT704424 CTNNBIP1 catenin beta interacting protein 1 2 2
MIRT709470 KRTAP19-1 keratin associated protein 19-1 2 2
MIRT710939 MRPL45 mitochondrial ribosomal protein L45 2 2
MIRT713306 TYRP1 tyrosinase related protein 1 2 2
MIRT716932 FAM13A family with sequence similarity 13 member A 2 2
MIRT717539 PYGO2 pygopus family PHD finger 2 2 2
MIRT718060 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 2
MIRT718934 TRIM66 tripartite motif containing 66 2 2
MIRT719770 ZNF236 zinc finger protein 236 2 2
MIRT720164 PNPO pyridoxamine 5'-phosphate oxidase 2 2
MIRT721280 RAD54L2 RAD54 like 2 2 2
MIRT721359 ENTHD1 ENTH domain containing 1 2 2
MIRT721506 CARHSP1 calcium regulated heat stable protein 1 2 2
MIRT721920 LINGO2 leucine rich repeat and Ig domain containing 2 2 2
MIRT722791 FUT4 fucosyltransferase 4 2 2
MIRT723933 SVOP SV2 related protein 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-2115 Docetaxel+Cisplatin+5-Fluorouracil sensitive tissue (hypopharyngeal squamous cell carcinoma)
hsa-mir-2115 Decitabine 451668 approved sensitive tissue (esopheageal cancer)
hsa-miR-2115-5p Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-2115-5p Tamoxifen 2733525 NSC180973 approved sensitive cell line (LCC2)
hsa-miR-2115-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-2115-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission