pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-1273h |
Genomic Coordinates | chr16: 24203116 - 24203231 |
Description | Homo sapiens miR-1273h stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-1273h-5p | |||||||||
Sequence | 33| CUGGGAGGUCAAGGCUGCAGU |53 | |||||||||
Evidence | Experimental | |||||||||
Experiments | Illumina | |||||||||
SNPs in miRNA |
|
|||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | LRIG2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | LIG-2, LIG2, UFS2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | leucine rich repeats and immunoglobulin like domains 2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_014813 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on LRIG2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of LRIG2 (miRNA target sites are highlighted) |
>LRIG2|NM_014813|3'UTR 1 AACTCACTTCAGGATGAAATCTGGGCAGAGACTTATTAATTAATTTTGCATTTACTACCTCAGAGCTCAGAAGAAACTCC 81 GAAGTCAGCATTTGCTTTACTCTTTCTTTATGATTGCATCTGACCGCACCAAGGTGGGCCATGCGTTGTTTGGTCTTATA 161 CCTGATGAAGAAATGGCAACAGCTGACAGAAATGGGTACAGCTCATCAAAAATGTGCAGCACCGGCAGAGGGAAGATACG 241 GGGCAAATGTGCTTCCTGATGCTTCCATGGGGATGTGCCCTGGTGTGCATCTGCTTGTCAGGAAGAGTCACATTGCTGCT 321 TAACATGCTGGATTGCCCTAGTCTTCAGAATGGTCCTGAGAAAACATCACTACTTCGATGTTCTACTTTGCTTTCCAAGG 401 AGCAAAAATAACTTTGGAGCCTTCTGGGAAGTGTGCCTGGGATTCTTCAGTGGTTTCAGGCAGATAGTTGAGACTGGGGC 481 TTTGATATTCAAGGTCTTTGGCAAGAATCCCAGGCTTGACCAACTGGTACCAGGTCAAAGATTTTTGTATTCTTGTGAAT 561 TTTTTTTTTTGTCCCTATTGCCCAGGGATGTCATTGTAAATATATGTGCATTTATAAATAATTTTTGTATTCATTGACCA 641 TATGTGTTGGCTGCAATGTAAATATTTTTGATATGCCAAAATTATATGTAATATCCAGTTATAATATTGACAAGTAGCTT 721 CTCAGATCACAGATTTTAAATAACTCAATTTAGTGAGATCTAAAAATTTTATTTAAAGTATAAAAACTGTGGCTCACACC 801 TGTAATCCCAGCATTTTGAGAGGCTAAGGTGGGAGGATTGCTTGAGGCCAGGAATTTGAGACCAGGCTGGGCAACATGGT 881 GAGACCCTGTGTCTGCAAAAAAATAAATTAAAAAAATAGGTGGACATTGTGGCATGCTGCTGTAGTCCTAGCTACTTGGG 961 AGGCTGAGGTGGGAGGGTCACTTGAGCCCGGGAAATCAAGGCTGCAGTGAGCTGTGTGAAGCCACTGCATCCCAGCCTGG 1041 GTGACAGAGTGAGGCCCTGGCTCAAAAGTAAAATAAATAAATAAAAAGTTTTAAAAACTTAAAAAAAAAAAAAAAAAAAA 1121 AAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293S | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb
HITS-CLIP data was present in GSM1084072. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep1_AbnovaAb
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
CLIP-seq Support 1 for dataset GSM1084064 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noemetine_AbnovaAb |
Location of target site | ENST00000361127.5 | 3UTR | GCUUGCCUUGGCCUCCCAAAGUGCUGGGAUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM1084072 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_nohippuristanol_rep1_AbnovaAb |
Location of target site | ENST00000361127.5 | 3UTR | UUGCCUUGGCCUCCCAAAGUGCUGGGAUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
494 hsa-miR-1273h-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT074355 | TNRC6A | trinucleotide repeat containing 6A | ![]() |
![]() |
2 | 2 | ||||||
MIRT100721 | TJAP1 | tight junction associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT115545 | MAZ | MYC associated zinc finger protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT124982 | XIAP | X-linked inhibitor of apoptosis | ![]() |
![]() |
2 | 4 | ||||||
MIRT139911 | BTF3L4 | basic transcription factor 3 like 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT177183 | ARL5B | ADP ribosylation factor like GTPase 5B | ![]() |
![]() |
2 | 4 | ||||||
MIRT187994 | MBD6 | methyl-CpG binding domain protein 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT207410 | MAT2A | methionine adenosyltransferase 2A | ![]() |
![]() |
2 | 6 | ||||||
MIRT241928 | DYRK2 | dual specificity tyrosine phosphorylation regulated kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT260110 | KLHL21 | kelch like family member 21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT260358 | XRCC6 | X-ray repair cross complementing 6 | ![]() |
![]() |
2 | 6 | ||||||
MIRT266428 | RPRD2 | regulation of nuclear pre-mRNA domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT294663 | ZNF548 | zinc finger protein 548 | ![]() |
![]() |
2 | 2 | ||||||
MIRT351039 | PLEKHB2 | pleckstrin homology domain containing B2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT379943 | PRRG4 | proline rich and Gla domain 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT398983 | KAT7 | lysine acetyltransferase 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT441465 | BEST3 | bestrophin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446750 | ZNF491 | zinc finger protein 491 | ![]() |
![]() |
2 | 2 | ||||||
MIRT449224 | RAD51B | RAD51 paralog B | ![]() |
![]() |
2 | 2 | ||||||
MIRT450623 | AQR | aquarius intron-binding spliceosomal factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT451090 | ZNF584 | zinc finger protein 584 | ![]() |
![]() |
2 | 2 | ||||||
MIRT451558 | CIAPIN1 | cytokine induced apoptosis inhibitor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT451736 | CES3 | carboxylesterase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452411 | QDPR | quinoid dihydropteridine reductase | ![]() |
![]() |
2 | 2 | ||||||
MIRT452559 | ZFP69B | ZFP69 zinc finger protein B | ![]() |
![]() |
2 | 2 | ||||||
MIRT452851 | LAX1 | lymphocyte transmembrane adaptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452922 | DISC1 | disrupted in schizophrenia 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453043 | TANGO2 | transport and golgi organization 2 homolog | ![]() |
![]() |
2 | 4 | ||||||
MIRT453097 | HOXC4 | homeobox C4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453297 | ZNF394 | zinc finger protein 394 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453593 | ZNF557 | zinc finger protein 557 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453787 | KBTBD12 | kelch repeat and BTB domain containing 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453987 | CECR1 | adenosine deaminase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454083 | TMEM209 | transmembrane protein 209 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454652 | FBXL18 | F-box and leucine rich repeat protein 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454753 | PFKFB3 | 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455311 | TTLL9 | tubulin tyrosine ligase like 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT456468 | SERAC1 | serine active site containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT456554 | TOMM20 | translocase of outer mitochondrial membrane 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT456716 | TMEM239 | transmembrane protein 239 | ![]() |
![]() |
2 | 4 | ||||||
MIRT456796 | SIGLEC14 | sialic acid binding Ig like lectin 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457487 | SLC35F6 | solute carrier family 35 member F6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457999 | MRPL12 | mitochondrial ribosomal protein L12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT458130 | TLCD2 | TLC domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459027 | ZNF490 | zinc finger protein 490 | ![]() |
![]() |
2 | 4 | ||||||
MIRT459119 | FADS6 | fatty acid desaturase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459315 | HAVCR2 | hepatitis A virus cellular receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459385 | MPLKIP | M-phase specific PLK1 interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT459412 | FAM83B | family with sequence similarity 83 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT459974 | RFT1 | RFT1 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT460480 | FAM105A | family with sequence similarity 105 member A | ![]() |
![]() |
2 | 6 | ||||||
MIRT460586 | FEM1A | fem-1 homolog A | ![]() |
![]() |
2 | 2 | ||||||
MIRT460920 | NOA1 | nitric oxide associated 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT461072 | OPA3 | OPA3, outer mitochondrial membrane lipid metabolism regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT461590 | DPH2 | DPH2 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT461854 | ZNF317 | zinc finger protein 317 | ![]() |
![]() |
2 | 2 | ||||||
MIRT462176 | ACADL | acyl-CoA dehydrogenase, long chain | ![]() |
![]() |
2 | 2 | ||||||
MIRT462446 | GCDH | glutaryl-CoA dehydrogenase | ![]() |
![]() |
2 | 2 | ||||||
MIRT463854 | WNT7B | Wnt family member 7B | ![]() |
![]() |
2 | 2 | ||||||
MIRT464310 | UST | uronyl 2-sulfotransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT464815 | UBE2B | ubiquitin conjugating enzyme E2 B | ![]() |
![]() |
2 | 2 | ||||||
MIRT465453 | TOR2A | torsin family 2 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT466073 | TMEM184C | transmembrane protein 184C | ![]() |
![]() |
2 | 2 | ||||||
MIRT466514 | TBXA2R | thromboxane A2 receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT467072 | SRRD | SRR1 domain containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT469551 | RARA | retinoic acid receptor alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT469741 | RAB2B | RAB2B, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT470759 | PNPLA6 | patatin like phospholipase domain containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470875 | PLXND1 | plexin D1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470976 | PITPNA | phosphatidylinositol transfer protein alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT471048 | PIM3 | Pim-3 proto-oncogene, serine/threonine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT471215 | PHAX | phosphorylated adaptor for RNA export | ![]() |
![]() |
2 | 2 | ||||||
MIRT471246 | PGM2L1 | phosphoglucomutase 2 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471286 | PGAM4 | phosphoglycerate mutase family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471467 | PDE7B | phosphodiesterase 7B | ![]() |
![]() |
2 | 2 | ||||||
MIRT473069 | MORN4 | MORN repeat containing 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT473989 | LRRC20 | leucine rich repeat containing 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT474518 | KLHDC8A | kelch domain containing 8A | ![]() |
![]() |
2 | 2 | ||||||
MIRT474990 | KANSL1 | KAT8 regulatory NSL complex subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT475547 | HNRNPUL1 | heterogeneous nuclear ribonucleoprotein U like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT476350 | GIGYF1 | GRB10 interacting GYF protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT477298 | EPHB2 | EPH receptor B2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT477933 | DPM2 | dolichyl-phosphate mannosyltransferase subunit 2, regulatory | ![]() |
![]() |
2 | 2 | ||||||
MIRT478282 | DDX19A | DEAD-box helicase 19A | ![]() |
![]() |
2 | 4 | ||||||
MIRT478472 | CYP20A1 | cytochrome P450 family 20 subfamily A member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT478559 | CTNND1 | catenin delta 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT478618 | CTDNEP1 | CTD nuclear envelope phosphatase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT478834 | CRISPLD2 | cysteine rich secretory protein LCCL domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479007 | COL5A1 | collagen type V alpha 1 chain | ![]() |
![]() |
2 | 2 | ||||||
MIRT479166 | CLSPN | claspin | ![]() |
![]() |
2 | 2 | ||||||
MIRT482454 | ADAR | adenosine deaminase, RNA specific | ![]() |
![]() |
2 | 4 | ||||||
MIRT483019 | KHSRP | KH-type splicing regulatory protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT483798 | CYP2W1 | cytochrome P450 family 2 subfamily W member 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT486087 | SLC7A5 | solute carrier family 7 member 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT486304 | SIPA1 | signal-induced proliferation-associated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT486490 | MYH11 | myosin heavy chain 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT486881 | TSPYL4 | TSPY like 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487125 | NCOR2 | nuclear receptor corepressor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487542 | TM6SF2 | transmembrane 6 superfamily member 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT487676 | B3GALT5 | beta-1,3-galactosyltransferase 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT489251 | TTLL1 | tubulin tyrosine ligase like 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT489276 | RBM8A | RNA binding motif protein 8A | ![]() |
![]() |
2 | 8 | ||||||
MIRT489496 | CRLF3 | cytokine receptor like factor 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT489571 | SSBP2 | single stranded DNA binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489694 | SCAMP4 | secretory carrier membrane protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490166 | TMEM63C | transmembrane protein 63C | ![]() |
![]() |
2 | 2 | ||||||
MIRT491199 | MLLT1 | MLLT1, super elongation complex subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT491260 | DHX40 | DEAH-box helicase 40 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491385 | HAUS3 | HAUS augmin like complex subunit 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491548 | YAE1D1 | Yae1 domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492722 | PHF12 | PHD finger protein 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493866 | FAM73B | mitoguardin 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT494549 | BAK1 | BCL2 antagonist/killer 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498586 | KRT8 | keratin 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498722 | SNTN | sentan, cilia apical structure protein | ![]() |
![]() |
2 | 6 | ||||||
MIRT499982 | HIST1H2BD | histone cluster 1 H2B family member d | ![]() |
![]() |
2 | 4 | ||||||
MIRT503414 | SLC25A45 | solute carrier family 25 member 45 | ![]() |
![]() |
2 | 6 | ||||||
MIRT508491 | FTO | FTO, alpha-ketoglutarate dependent dioxygenase | ![]() |
![]() |
2 | 2 | ||||||
MIRT508877 | METTL14 | methyltransferase like 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT509622 | RRP7A | ribosomal RNA processing 7 homolog A | ![]() |
![]() |
2 | 4 | ||||||
MIRT510104 | IRAK3 | interleukin 1 receptor associated kinase 3 | ![]() |
![]() |
2 | 8 | ||||||
MIRT510139 | PDGFRA | platelet derived growth factor receptor alpha | ![]() |
![]() |
2 | 4 | ||||||
MIRT510353 | ZNF703 | zinc finger protein 703 | ![]() |
![]() |
2 | 6 | ||||||
MIRT510620 | TMEM167A | transmembrane protein 167A | ![]() |
![]() |
2 | 4 | ||||||
MIRT510786 | SF3B3 | splicing factor 3b subunit 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT511021 | NRF1 | nuclear respiratory factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT513925 | GHITM | growth hormone inducible transmembrane protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT514342 | DNAH17 | dynein axonemal heavy chain 17 | ![]() |
![]() |
2 | 4 | ||||||
MIRT515015 | SUMF2 | sulfatase modifying factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT515246 | DUSP28 | dual specificity phosphatase 28 | ![]() |
![]() |
2 | 2 | ||||||
MIRT516202 | RPP30 | ribonuclease P/MRP subunit p30 | ![]() |
![]() |
2 | 2 | ||||||
MIRT516435 | ADAMTS4 | ADAM metallopeptidase with thrombospondin type 1 motif 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT516666 | ZNF860 | zinc finger protein 860 | ![]() |
![]() |
2 | 4 | ||||||
MIRT518373 | ZNF250 | zinc finger protein 250 | ![]() |
![]() |
2 | 2 | ||||||
MIRT518930 | LSG1 | large 60S subunit nuclear export GTPase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT519676 | ZNF70 | zinc finger protein 70 | ![]() |
![]() |
2 | 2 | ||||||
MIRT519902 | ZFAND4 | zinc finger AN1-type containing 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT519945 | ZCCHC8 | zinc finger CCHC-type containing 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT520321 | UBXN2A | UBX domain protein 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT520606 | TMEM41B | transmembrane protein 41B | ![]() |
![]() |
2 | 2 | ||||||
MIRT520663 | TMEM11 | transmembrane protein 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT520852 | SUGT1 | SGT1 homolog, MIS12 kinetochore complex assembly cochaperone | ![]() |
![]() |
2 | 2 | ||||||
MIRT521443 | RAD51 | RAD51 recombinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT521671 | PRKAR2A | protein kinase cAMP-dependent type II regulatory subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT522281 | NKAP | NFKB activating protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT522333 | NCKIPSD | NCK interacting protein with SH3 domain | ![]() |
![]() |
2 | 8 | ||||||
MIRT522535 | MED28 | mediator complex subunit 28 | ![]() |
![]() |
2 | 6 | ||||||
MIRT523478 | GNG4 | G protein subunit gamma 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT523672 | FOPNL | FGFR1OP N-terminal like | ![]() |
![]() |
2 | 2 | ||||||
MIRT523715 | FBXW2 | F-box and WD repeat domain containing 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT523867 | ESCO2 | establishment of sister chromatid cohesion N-acetyltransferase 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT524043 | DNAJC8 | DnaJ heat shock protein family (Hsp40) member C8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT524167 | DFFA | DNA fragmentation factor subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT524928 | ALG10B | ALG10B, alpha-1,2-glucosyltransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT526825 | PHC1 | polyhomeotic homolog 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531017 | TDGF1P3 | teratocarcinoma-derived growth factor 1 pseudogene 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT536085 | MBOAT2 | membrane bound O-acyltransferase domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540681 | BMP3 | bone morphogenetic protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541708 | TMEM33 | transmembrane protein 33 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541755 | KLF8 | Kruppel like factor 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541888 | LY6G5B | lymphocyte antigen 6 family member G5B | ![]() |
![]() |
2 | 2 | ||||||
MIRT545714 | SPTLC2 | serine palmitoyltransferase long chain base subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT559054 | C19orf47 | chromosome 19 open reading frame 47 | ![]() |
![]() |
2 | 4 | ||||||
MIRT561748 | PLAGL2 | PLAG1 like zinc finger 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT562365 | ETV3 | ETS variant 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT562821 | GCFC2 | GC-rich sequence DNA-binding factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT562900 | DNAH10OS | dynein axonemal heavy chain 10 opposite strand | ![]() |
![]() |
2 | 2 | ||||||
MIRT564452 | SLC35E2 | solute carrier family 35 member E2 | ![]() |
![]() |
2 | 5 | ||||||
MIRT569111 | ONECUT3 | one cut homeobox 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569224 | SUSD1 | sushi domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570271 | ARPC3 | actin related protein 2/3 complex subunit 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570498 | TFIP11 | tuftelin interacting protein 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570844 | GPRC5C | G protein-coupled receptor class C group 5 member C | ![]() |
![]() |
2 | 2 | ||||||
MIRT571311 | TPCN2 | two pore segment channel 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572077 | EXOC8 | exocyst complex component 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572116 | DNAJC24 | DnaJ heat shock protein family (Hsp40) member C24 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573054 | TRIB1 | tribbles pseudokinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573483 | IQSEC3 | IQ motif and Sec7 domain 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573656 | HES6 | hes family bHLH transcription factor 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT574343 | ZBTB37 | zinc finger and BTB domain containing 37 | ![]() |
![]() |
2 | 2 | ||||||
MIRT576494 | Slc35e2 | solute carrier family 35, member E2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT608033 | UBLCP1 | ubiquitin like domain containing CTD phosphatase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT611326 | NANOS1 | nanos C2HC-type zinc finger 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT613660 | KIAA1210 | KIAA1210 | ![]() |
![]() |
2 | 2 | ||||||
MIRT615638 | ATF6 | activating transcription factor 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT618573 | RRAD | RRAD, Ras related glycolysis inhibitor and calcium channel regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT618865 | MBL2 | mannose binding lectin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT618962 | MRPS16 | mitochondrial ribosomal protein S16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT619172 | SLC16A4 | solute carrier family 16 member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT620298 | AQP6 | aquaporin 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT620683 | RFTN2 | raftlin family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT621637 | UBXN2B | UBX domain protein 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT621993 | STK4 | serine/threonine kinase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622421 | NUDT19 | nudix hydrolase 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622804 | PGAM5 | PGAM family member 5, mitochondrial serine/threonine protein phosphatase | ![]() |
![]() |
2 | 4 | ||||||
MIRT624786 | AGAP9 | ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT624968 | ZNF665 | zinc finger protein 665 | ![]() |
![]() |
2 | 4 | ||||||
MIRT625479 | SMAD9 | SMAD family member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT626594 | ACAA2 | acetyl-CoA acyltransferase 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT626708 | TRIM65 | tripartite motif containing 65 | ![]() |
![]() |
2 | 2 | ||||||
MIRT626975 | LINC00598 | long intergenic non-protein coding RNA 598 | ![]() |
![]() |
2 | 2 | ||||||
MIRT627489 | STRIP2 | striatin interacting protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628505 | ZNF878 | zinc finger protein 878 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628533 | ZNF701 | zinc finger protein 701 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628591 | TMEM251 | transmembrane protein 251 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628818 | SLC25A34 | solute carrier family 25 member 34 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628896 | IGSF6 | immunoglobulin superfamily member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628958 | UBE2D4 | ubiquitin conjugating enzyme E2 D4 (putative) | ![]() |
![]() |
2 | 2 | ||||||
MIRT629005 | OSBPL10 | oxysterol binding protein like 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT629059 | KIF1C | kinesin family member 1C | ![]() |
![]() |
2 | 2 | ||||||
MIRT629192 | PAPOLA | poly(A) polymerase alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT629346 | TMPRSS11BNL | TMPRSS11B N-terminal like, pseudogene | ![]() |
![]() |
2 | 2 | ||||||
MIRT629447 | WIZ | widely interspaced zinc finger motifs | ![]() |
![]() |
2 | 2 | ||||||
MIRT629696 | XKR4 | XK related 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT629737 | SCD5 | stearoyl-CoA desaturase 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT629896 | SPATA5 | spermatogenesis associated 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT629953 | GLP2R | glucagon like peptide 2 receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT630023 | MTL5 | testis expressed metallothionein like protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT630181 | TLN1 | talin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT630325 | PAQR5 | progestin and adipoQ receptor family member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT630389 | MYH9 |