pre-miRNA Information
pre-miRNA hsa-mir-3123   
Genomic Coordinates chr1: 241132272 - 241132346
Description Homo sapiens miR-3123 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3123
Sequence 49| CAGAGAAUUGUUUAAUC |65
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 1 + 241132323 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1453759221 1 dbSNP
rs968575171 5 dbSNP
rs979407933 9 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZWILCH   
Synonyms KNTC1AP, hZwilch
Description zwilch kinetochore protein
Transcript NM_017975   
Expression
Putative miRNA Targets on ZWILCH
3'UTR of ZWILCH
(miRNA target sites are highlighted)
>ZWILCH|NM_017975|3'UTR
   1 AGTGTGCTGATGAAGTCCTCTATAAGCACAAGCCAAAAAGAGAAAGAGAAAAAAAGGTAATTATTGTAGAACCTGAAAAC
  81 AGCAATGTATGGAAACCCTCAAAGCAGAAAAGGGAGGAAGATCCTGAAGATTCTCTTATGAAGCTCCAAAATTGATAATC
 161 CTGTCTCAGCTCTGCCTCCTCAGGAGGAGCATTAGTAGAACAGCAGTGATGAGGACACAGAGGGAGCAGACAGTGGGTAC
 241 CACGATCTCCGTAACCATTTGCATGTGACTTAGCAAGGGCTCTGAAATGACAAAGAGAACGAGCACCACAAATGAGAACA
 321 GGATCATTTTAGTAAATACAGCTTTATCCCAAAAGCTTTAACTGTATTGGGAAAACTTAAAAAATAGCATCCTCAAATTT
 401 TCTGATTCTTATTTGCCATGAAATAGAACTTAGTAAATTAAATGTTATTTGAAAATGTTATAAGAGCTTTGTAAATATTT
 481 CAGAAAATATGGGATAAATGCCTGAATTTGGTTCTTCTACAGGTGCTATAATAAAGTCCATCTCTCAATACTTATACTTT
 561 CTAAATTCATCTCAGAATATTAGCAGCCATATTCCACAGTTCCTATAATTTTTACTGGGGGGGATTTGTGATAGGAAAGT
 641 CCTTGGGAAACATTTCCAATCTTTCAAAATATTATTGTGTATCTTAAGAAGTATAGGAACTTGTATGTTGAAATGTTGTA
 721 TGGTAGTTCTTGTATAGTTAAATAATAATCTTTTTAAGAGTTAATGATAAGCATATGTTATGTGCATTATTAATAAAATA
 801 GTGGCCACTTAGGTAATACCCACTTTTATCTTGTGTGCTGGGTACTCTGGTTACTGAGATAAATAAGGCACTGGACATCC
 881 TCACGTGGAGTTCACAGGCTCATCAGTGAATTCTGTACCACATTTCAACCTTGTTTATTTTAGTTTAATGGAATATACAT
 961 TCTTAGTATTGCCTGATTATTTAAATTTGTTGAGGGGGATTGCATGTTGCTTTATTGGCCTGTAAAAATAGCTAGTTTGG
1041 TAAGATTTGGTCTCGCACCTTCCATCTTTGCTACCACATTAAAGATGAGCTTGTTAAAAAGGAAAGCATATTTCTCTGAT
1121 TGCCCTTATGGAGAAATAAAGATAAAATTCAAAGAAACAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' cuaAUUUGUUAAGAGAc 5'
             |:|| :||||||| 
Target 5' tccTGAA-GATTCTCTt 3'
122 - 137 149.00 -6.10
2
miRNA  3' cuaauuugUUAAGAGAc 5'
                  ||||:||| 
Target 5' catcctcaAATTTTCTg 3'
388 - 404 129.00 -7.90
3
miRNA  3' cuaaUUUGU-U-AAGAGAc 5'
              ||:|| | |||||| 
Target 5' aggaAAGCATATTTCTCTg 3'
1100 - 1118 121.00 -11.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31511787 29 COSMIC
COSN26104090 201 COSMIC
COSN20299753 538 COSMIC
COSN32073533 563 COSMIC
COSN14539604 606 COSMIC
COSN17717887 1191 COSMIC
COSN16354912 1401 COSMIC
COSN28419355 1453 COSMIC
COSN24297080 1632 COSMIC
COSN30137262 1632 COSMIC
COSN30469508 1669 COSMIC
COSN30475813 1670 COSMIC
COSN30133935 1694 COSMIC
COSN30746492 1701 COSMIC
COSN31779057 1736 COSMIC
COSN30447270 1743 COSMIC
COSN30155551 1800 COSMIC
COSN30457838 1806 COSMIC
COSM299298 1816 COSMIC
COSM4530390 1822 COSMIC
COSM1629654 1834 COSMIC
COSM9924717 1847 COSMIC
COSM7177511 1854 COSMIC
COSM6700151 1879 COSMIC
COSM3356768 1883 COSMIC
COSM7869980 1887 COSMIC
COSM6700149 1889 COSMIC
COSM4697629 1890 COSMIC
COSM1374196 1896 COSMIC
COSM6700154 1897 COSMIC
COSM3887344 1923 COSMIC
COSM8704044 1924 COSMIC
COSN28769530 1969 COSMIC
COSN1081489 1983 COSMIC
COSN8749720 2048 COSMIC
COSN24245793 2329 COSMIC
COSN6278375 2633 COSMIC
COSN17459028 2974 COSMIC
COSN1682631 3132 COSMIC
COSN20046872 3290 COSMIC
COSM964248 3382 COSMIC
COSM8532434 3391 COSMIC
COSM3370233 3409 COSMIC
COSM7165567 3409 COSMIC
rs76428668 266 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs376922445 4 dbSNP
rs753711698 5 dbSNP
rs769613386 8 dbSNP
rs761351607 9 dbSNP
rs772942259 10 dbSNP
rs369385904 12 dbSNP
rs372058487 18 dbSNP
rs757986085 25 dbSNP
rs1346050998 27 dbSNP
rs1483551708 28 dbSNP
rs189651551 34 dbSNP
rs774849358 34 dbSNP
rs376347010 39 dbSNP
rs749247450 46 dbSNP
rs756634248 50 dbSNP
rs770709775 52 dbSNP
rs1003168015 55 dbSNP
rs539273027 62 dbSNP
rs897934962 64 dbSNP
rs1443635872 66 dbSNP
rs751939463 69 dbSNP
rs1179592961 79 dbSNP
rs993623437 83 dbSNP
rs1302572586 84 dbSNP
rs1036257685 95 dbSNP
rs1446357300 102 dbSNP
rs552780770 107 dbSNP
rs1180324157 109 dbSNP
rs751969788 111 dbSNP
rs963793606 113 dbSNP
rs972293460 118 dbSNP
rs560320155 122 dbSNP
rs569443771 126 dbSNP
rs1416183441 133 dbSNP
rs537156864 142 dbSNP
rs968343269 160 dbSNP
rs1207656502 174 dbSNP
rs1376755903 175 dbSNP
rs28711721 179 dbSNP
rs1448128420 192 dbSNP
rs1274433328 198 dbSNP
rs1311983793 201 dbSNP
rs1031365005 206 dbSNP
rs1244902960 210 dbSNP
rs987660948 213 dbSNP
rs557052243 214 dbSNP
rs1369218370 224 dbSNP
rs61411192 226 dbSNP
rs796804823 226 dbSNP
rs942397547 226 dbSNP
rs1275018063 232 dbSNP
rs1386740718 242 dbSNP
rs1346536235 249 dbSNP
rs1295345937 250 dbSNP
rs1193531820 251 dbSNP
rs1162655868 255 dbSNP
rs1367789053 255 dbSNP
rs1256836410 263 dbSNP
rs76428668 266 dbSNP
rs1390512835 267 dbSNP
rs1187703842 269 dbSNP
rs1463225539 274 dbSNP
rs781355615 285 dbSNP
rs543124561 287 dbSNP
rs535868166 289 dbSNP
rs142316381 293 dbSNP
rs1209908974 303 dbSNP
rs748954202 305 dbSNP
rs553271836 309 dbSNP
rs953906975 310 dbSNP
rs573037031 319 dbSNP
rs1298716508 321 dbSNP
rs1228201836 323 dbSNP
rs1363276528 324 dbSNP
rs1198436434 328 dbSNP
rs924398927 330 dbSNP
rs909817367 336 dbSNP
rs770667746 337 dbSNP
rs1037649894 339 dbSNP
rs77641300 344 dbSNP
rs778615223 348 dbSNP
rs1167716449 351 dbSNP
rs894380579 354 dbSNP
rs1378972654 359 dbSNP
rs1479064029 377 dbSNP
rs35414043 378 dbSNP
rs1057218862 386 dbSNP
rs575054562 387 dbSNP
rs993951089 391 dbSNP
rs1333946865 393 dbSNP
rs1276057278 396 dbSNP
rs1013097525 418 dbSNP
rs1392742475 419 dbSNP
rs1386516852 424 dbSNP
rs1044644755 425 dbSNP
rs1026502618 427 dbSNP
rs1234183826 428 dbSNP
rs71455516 430 dbSNP
rs1330744113 442 dbSNP
rs904758581 460 dbSNP
rs1000478294 470 dbSNP
rs1031334194 474 dbSNP
rs71455517 475 dbSNP
rs71455518 484 dbSNP
rs1010179319 491 dbSNP
rs955772051 495 dbSNP
rs1224768487 500 dbSNP
rs1172978479 507 dbSNP
rs1427560927 507 dbSNP
rs1277088050 510 dbSNP
rs1465176645 510 dbSNP
rs377493728 511 dbSNP
rs998306281 511 dbSNP
rs1160984622 512 dbSNP
rs1201403268 512 dbSNP
rs1229597193 512 dbSNP
rs1230271059 512 dbSNP
rs1254555077 512 dbSNP
rs1287836947 512 dbSNP
rs1329983391 512 dbSNP
rs1334502989 512 dbSNP
rs1342204641 512 dbSNP
rs1344563628 512 dbSNP
rs1395304904 512 dbSNP
rs1399565278 512 dbSNP
rs1407880921 512 dbSNP
rs1470867857 512 dbSNP
rs1482378533 512 dbSNP
rs796397381 512 dbSNP
rs1457459510 514 dbSNP
rs1017835054 517 dbSNP
rs964928490 519 dbSNP
rs1029422785 520 dbSNP
rs1271128614 522 dbSNP
rs544303478 522 dbSNP
rs1469002067 523 dbSNP
rs1370761757 524 dbSNP
rs1188674935 525 dbSNP
rs1442249132 531 dbSNP
rs1488046529 534 dbSNP
rs953985268 536 dbSNP
rs1465541801 537 dbSNP
rs71142309 537 dbSNP
rs1380253612 538 dbSNP
rs1451853576 539 dbSNP
rs1453589921 540 dbSNP
rs1284746128 542 dbSNP
rs1191762190 548 dbSNP
rs985280403 550 dbSNP
rs1338429839 551 dbSNP
rs1322333847 559 dbSNP
rs183446587 565 dbSNP
rs1478149463 569 dbSNP
rs909745146 573 dbSNP
rs528078119 580 dbSNP
rs972661997 581 dbSNP
rs1416551569 584 dbSNP
rs919210749 588 dbSNP
rs1173485413 589 dbSNP
rs1472771544 590 dbSNP
rs1383732475 591 dbSNP
rs546663398 594 dbSNP
rs531760836 595 dbSNP
rs1450266670 598 dbSNP
rs929329679 605 dbSNP
rs1057455315 606 dbSNP
rs914187665 611 dbSNP
rs1290705341 620 dbSNP
rs1457816851 625 dbSNP
rs1209121324 639 dbSNP
rs1354169623 640 dbSNP
rs968498094 642 dbSNP
rs1228943870 644 dbSNP
rs1294537087 647 dbSNP
rs917357936 665 dbSNP
rs948806363 666 dbSNP
rs1349907258 667 dbSNP
rs977550776 670 dbSNP
rs1044569656 677 dbSNP
rs904727513 678 dbSNP
rs551482374 679 dbSNP
rs1430840689 703 dbSNP
rs1389752507 705 dbSNP
rs1184950508 712 dbSNP
rs1401246767 716 dbSNP
rs1198265798 718 dbSNP
rs1247294812 718 dbSNP
rs1270446939 723 dbSNP
rs938538624 757 dbSNP
rs1205574330 768 dbSNP
rs1341259261 773 dbSNP
rs1270652988 780 dbSNP
rs1291395203 782 dbSNP
rs1056987409 787 dbSNP
rs1273674668 798 dbSNP
rs1433755276 799 dbSNP
rs1344172930 802 dbSNP
rs1310434816 821 dbSNP
rs373932143 831 dbSNP
rs1430973226 832 dbSNP
rs1321085236 835 dbSNP
rs1053369555 842 dbSNP
rs771403868 851 dbSNP
rs377696136 868 dbSNP
rs564413729 878 dbSNP
rs1426208634 883 dbSNP
rs1029804354 888 dbSNP
rs1214727946 889 dbSNP
rs889527094 894 dbSNP
rs1230900893 895 dbSNP
rs560898622 901 dbSNP
rs1488677737 908 dbSNP
rs1277564377 909 dbSNP
rs1006626066 918 dbSNP
rs1221125745 920 dbSNP
rs1330538774 920 dbSNP
rs1288460549 924 dbSNP
rs1410905350 925 dbSNP
rs1195987828 928 dbSNP
rs1373262435 929 dbSNP
rs993610506 935 dbSNP
rs186221303 945 dbSNP
rs1359931040 946 dbSNP
rs1333816229 956 dbSNP
rs1468453885 962 dbSNP
rs1414227245 973 dbSNP
rs962518887 975 dbSNP
rs1472192071 984 dbSNP
rs1009058700 990 dbSNP
rs1183379267 998 dbSNP
rs776245771 999 dbSNP
rs1236698833 1008 dbSNP
rs762041594 1019 dbSNP
rs552868555 1022 dbSNP
rs576335311 1023 dbSNP
rs1166109428 1031 dbSNP
rs1227305084 1034 dbSNP
rs750545829 1035 dbSNP
rs1370571122 1036 dbSNP
rs763018686 1037 dbSNP
rs569479821 1048 dbSNP
rs138846880 1069 dbSNP
rs948775310 1076 dbSNP
rs1380288802 1087 dbSNP
rs1021307092 1090 dbSNP
rs1360719199 1091 dbSNP
rs968759472 1097 dbSNP
rs550696700 1098 dbSNP
rs1310592737 1106 dbSNP
rs1343336900 1108 dbSNP
rs926071807 1109 dbSNP
rs73474172 1110 dbSNP
rs1053752763 1115 dbSNP
rs1412714835 1120 dbSNP
rs1181536665 1131 dbSNP
rs1333779594 1132 dbSNP
rs1239113186 1139 dbSNP
rs1248329921 1141 dbSNP
rs1286430356 1145 dbSNP
rs1266722199 1146 dbSNP
rs1224377847 1155 dbSNP
rs1322857341 1160 dbSNP
rs1354750346 1162 dbSNP
rs1244312570 1163 dbSNP
rs190542321 1167 dbSNP
rs1298664319 1168 dbSNP
rs934261970 1175 dbSNP
rs755375616 1192 dbSNP
rs915709169 1201 dbSNP
rs200695864 1208 dbSNP
rs889487054 1211 dbSNP
rs781644308 1212 dbSNP
rs1364944712 1216 dbSNP
rs1016645928 1223 dbSNP
rs973700954 1233 dbSNP
rs183243062 1244 dbSNP
rs188356002 1251 dbSNP
rs192594177 1257 dbSNP
rs1268756491 1258 dbSNP
rs1191283181 1264 dbSNP
rs993979217 1268 dbSNP
rs1421197496 1275 dbSNP
rs558384104 1281 dbSNP
rs144941212 1283 dbSNP
rs373177788 1283 dbSNP
rs386383322 1283 dbSNP
rs575145300 1283 dbSNP
rs992518898 1296 dbSNP
rs1226882798 1300 dbSNP
rs1011124242 1305 dbSNP
rs1358076038 1315 dbSNP
rs1024307652 1324 dbSNP
rs543996107 1349 dbSNP
rs757008930 1353 dbSNP
rs1411609527 1356 dbSNP
rs926040852 1361 dbSNP
rs778703308 1376 dbSNP
rs1394299601 1379 dbSNP
rs998963990 1397 dbSNP
rs1309785096 1415 dbSNP
rs1031303560 1421 dbSNP
rs1176153758 1424 dbSNP
rs1268776121 1427 dbSNP
rs1432136426 1427 dbSNP
rs1378835918 1434 dbSNP
rs959780334 1435 dbSNP
rs936132636 1441 dbSNP
rs1252913657 1442 dbSNP
rs1459428023 1457 dbSNP
rs988977738 1462 dbSNP
rs1337689571 1474 dbSNP
rs1258026256 1479 dbSNP
rs1299395492 1484 dbSNP
rs1022819296 1493 dbSNP
rs1322850967 1499 dbSNP
rs772332368 1499 dbSNP
rs969909924 1501 dbSNP
rs1210853933 1502 dbSNP
rs1351050293 1505 dbSNP
rs913421058 1509 dbSNP
rs973242057 1519 dbSNP
rs1389530038 1528 dbSNP
rs375651291 1530 dbSNP
rs929231533 1532 dbSNP
rs1198551543 1536 dbSNP
rs983865227 1537 dbSNP
rs911851729 1543 dbSNP
rs1473848700 1544 dbSNP
rs555081103 1547 dbSNP
rs1181533954 1554 dbSNP
rs1436491932 1555 dbSNP
rs1051783315 1571 dbSNP
rs1189110745 1579 dbSNP
rs889413159 1601 dbSNP
rs1461063004 1608 dbSNP
rs1034717699 1615 dbSNP
rs900580757 1620 dbSNP
rs1243129935 1621 dbSNP
rs566686893 1621 dbSNP
rs942381134 1622 dbSNP
rs1341978710 1632 dbSNP
rs902775017 1632 dbSNP
rs377591060 1633 dbSNP
rs1331879902 1634 dbSNP
rs894302274 1634 dbSNP
rs114255519 1638 dbSNP
rs745427708 1672 dbSNP
rs73474173 1675 dbSNP
rs1292037430 1677 dbSNP
rs565500481 1691 dbSNP
rs1220008959 1692 dbSNP
rs116701340 1694 dbSNP
rs1184615700 1709 dbSNP
rs994350998 1710 dbSNP
rs1241574827 1713 dbSNP
rs1210664995 1719 dbSNP
rs149376245 1726 dbSNP
rs896349523 1728 dbSNP
rs1013464403 1730 dbSNP
rs1259201945 1745 dbSNP
rs532577086 1746 dbSNP
rs969791910 1753 dbSNP
rs546519703 1755 dbSNP
rs1023981588 1761 dbSNP
rs1380122378 1763 dbSNP
rs973678118 1764 dbSNP
rs1435381379 1766 dbSNP
rs1325285370 1774 dbSNP
rs1346206515 1775 dbSNP
rs778088311 1778 dbSNP
rs183222637 1782 dbSNP
rs771051137 1794 dbSNP
rs779249345 1796 dbSNP
rs531983026 1797 dbSNP
rs1239870685 1798 dbSNP
rs772215186 1799 dbSNP
rs1194204290 1806 dbSNP
rs1396766089 1807 dbSNP
rs1033036181 1808 dbSNP
rs1452464768 1811 dbSNP
rs548477812 1813 dbSNP
rs1408424549 1816 dbSNP
rs1261868152 1833 dbSNP
rs1424500892 1838 dbSNP
rs1402727445 1849 dbSNP
rs1316407806 1852 dbSNP
rs1344709948 1855 dbSNP
rs983361785 1856 dbSNP
rs760644275 1861 dbSNP
rs768766361 1865 dbSNP
rs1441884277 1867 dbSNP
rs1369493544 1876 dbSNP
rs989337564 1881 dbSNP
rs1234187833 1886 dbSNP
rs776260249 1889 dbSNP
rs761737376 1890 dbSNP
rs1225133092 1895 dbSNP
rs764784200 1896 dbSNP
rs567382942 1897 dbSNP
rs146782022 1898 dbSNP
rs765826907 1902 dbSNP
rs751117718 1907 dbSNP
rs1198071053 1909 dbSNP
rs1233247348 1911 dbSNP
rs756581079 1919 dbSNP
rs1276518296 1921 dbSNP
rs778315569 1923 dbSNP
rs143150424 1925 dbSNP
rs1462144701 1926 dbSNP
rs779146379 1928 dbSNP
rs1392374555 1933 dbSNP
rs1338370172 1934 dbSNP
rs1267873438 1937 dbSNP
rs1386713401 1937 dbSNP
rs768424509 1938 dbSNP
rs546635278 1939 dbSNP
rs780262646 1941 dbSNP
rs747127021 1946 dbSNP
rs566134777 1947 dbSNP
rs1233507810 1951 dbSNP
rs776688821 1954 dbSNP
rs1331939187 1955 dbSNP
rs919626868 1957 dbSNP
rs1209179777 1958 dbSNP
rs1251105458 1960 dbSNP
rs896722513 1963 dbSNP
rs11858742 1969 dbSNP
rs1410728701 1976 dbSNP
rs1047254515 1984 dbSNP
rs1044075509 1994 dbSNP
rs1419130849 1996 dbSNP
rs896286394 2005 dbSNP
rs1479082708 2014 dbSNP
rs11071898 2017 dbSNP
rs1198519083 2024 dbSNP
rs568798688 2025 dbSNP
rs1044980073 2032 dbSNP
rs1437535724 2036 dbSNP
rs1253643158 2037 dbSNP
rs1205018503 2038 dbSNP
rs994554670 2040 dbSNP
rs1270528417 2045 dbSNP
rs1305115725 2050 dbSNP
rs1220438244 2053 dbSNP
rs533554939 2053 dbSNP
rs1338536641 2056 dbSNP
rs538073487 2058 dbSNP
rs1399426533 2061 dbSNP
rs1027920046 2063 dbSNP
rs950550364 2070 dbSNP
rs1310210475 2071 dbSNP
rs554492070 2076 dbSNP
rs1018839558 2085 dbSNP
rs965927599 2093 dbSNP
rs974723284 2094 dbSNP
rs1000815299 2106 dbSNP
rs1175827807 2133 dbSNP
rs921898276 2137 dbSNP
rs1414144444 2147 dbSNP
rs1342147730 2152 dbSNP
rs1177566123 2157 dbSNP
rs138643829 2161 dbSNP
rs979514807 2164 dbSNP
rs1322632560 2165 dbSNP
rs773411956 2170 dbSNP
rs957399690 2174 dbSNP
rs1487695780 2183 dbSNP
rs1010284601 2193 dbSNP
rs1020799301 2201 dbSNP
rs935538583 2203 dbSNP
rs1264676831 2210 dbSNP
rs955542310 2211 dbSNP
rs987354345 2213 dbSNP
rs911418165 2214 dbSNP
rs918205380 2215 dbSNP
rs1450409393 2216 dbSNP
rs370693763 2223 dbSNP
rs1407177505 2235 dbSNP
rs1044085332 2240 dbSNP
rs763106973 2251 dbSNP
rs995007634 2261 dbSNP
rs1165725300 2262 dbSNP
rs1418433014 2262 dbSNP
rs1405469317 2264 dbSNP
rs1358811255 2268 dbSNP
rs1183396837 2269 dbSNP
rs1048832365 2270 dbSNP
rs1242226889 2272 dbSNP
rs546622281 2288 dbSNP
rs1298945316 2299 dbSNP
rs1465816152 2314 dbSNP
rs1260809215 2322 dbSNP
rs1217082723 2323 dbSNP
rs1328272098 2331 dbSNP
rs974335638 2337 dbSNP
rs919554280 2339 dbSNP
rs929639540 2346 dbSNP
rs1248679418 2348 dbSNP
rs1383792310 2349 dbSNP
rs886168572 2357 dbSNP
rs1046782416 2375 dbSNP
rs1314699524 2378 dbSNP
rs1450737636 2381 dbSNP
rs917678513 2382 dbSNP
rs1289552237 2384 dbSNP
rs1452901759 2386 dbSNP
rs1343409760 2397 dbSNP
rs759317773 2399 dbSNP
rs1284065035 2402 dbSNP
rs554188699 2427 dbSNP
rs557338386 2428 dbSNP
rs577357177 2430 dbSNP
rs1261757102 2450 dbSNP
rs79898187 2453 dbSNP
rs905062806 2464 dbSNP
rs774255225 2465 dbSNP
rs760112373 2474 dbSNP
rs563209354 2479 dbSNP
rs1053708165 2482 dbSNP
rs1216865048 2490 dbSNP
rs1287618188 2493 dbSNP
rs186893165 2495 dbSNP
rs1010669716 2496 dbSNP
rs901771422 2499 dbSNP
rs1243999220 2502 dbSNP
rs1309506210 2505 dbSNP
rs1296354819 2511 dbSNP
rs1381759129 2512 dbSNP
rs1359770553 2513 dbSNP
rs1304822668 2528 dbSNP
rs1440127964 2530 dbSNP
rs549003026 2531 dbSNP
rs1161469213 2539 dbSNP
rs1463181888 2552 dbSNP
rs891190933 2556 dbSNP
rs1237936002 2561 dbSNP
rs141876546 2570 dbSNP
rs1426682235 2595 dbSNP
rs1202138835 2596 dbSNP
rs995327211 2610 dbSNP
rs1018395236 2611 dbSNP
rs1220780890 2616 dbSNP
rs964183867 2630 dbSNP
rs1379440171 2635 dbSNP
rs111550266 2637 dbSNP
rs1305775162 2638 dbSNP
rs1285313337 2640 dbSNP
rs1223990516 2642 dbSNP
rs956996317 2643 dbSNP
rs992333727 2650 dbSNP
rs918048786 2652 dbSNP
rs1396752455 2655 dbSNP
rs1297187425 2675 dbSNP
rs1460153857 2686 dbSNP
rs1159406665 2687 dbSNP
rs974262189 2689 dbSNP
rs1387251812 2692 dbSNP
rs562153125 2700 dbSNP
rs948301110 2701 dbSNP
rs980991073 2704 dbSNP
rs1027207176 2708 dbSNP
rs1334125484 2710 dbSNP
rs1429245231 2713 dbSNP
rs527841785 2714 dbSNP
rs753179666 2719 dbSNP
rs1421195660 2729 dbSNP
rs1455035276 2730 dbSNP
rs146259471 2749 dbSNP
rs1251699371 2751 dbSNP
rs917602565 2753 dbSNP
rs1307601243 2760 dbSNP
rs1265059671 2765 dbSNP
rs1204433291 2771 dbSNP
rs949119502 2775 dbSNP
rs930349290 2783 dbSNP
rs1376619854 2786 dbSNP
rs1240424797 2787 dbSNP
rs1049200873 2806 dbSNP
rs12901894 2809 dbSNP
rs1342286533 2812 dbSNP
rs764493545 2815 dbSNP
rs926438867 2818 dbSNP
rs1403287548 2827 dbSNP
rs1171272746 2828 dbSNP
rs1199346549 2834 dbSNP
rs58815033 2837 dbSNP
rs1455839407 2844 dbSNP
rs1364694024 2845 dbSNP
rs936520188 2854 dbSNP
rs1053686823 2855 dbSNP
rs892356112 2868 dbSNP
rs1196670202 2869 dbSNP
rs1184274348 2882 dbSNP
rs945327595 2885 dbSNP
rs750101230 2895 dbSNP
rs995954805 2896 dbSNP
rs1351338401 2899 dbSNP
rs1259903744 2904 dbSNP
rs1179522512 2908 dbSNP
rs1530195 2911 dbSNP
rs903767786 2915 dbSNP
rs532015073 2917 dbSNP
rs757945079 2918 dbSNP
rs1008264067 2926 dbSNP
rs1379893864 2933 dbSNP
rs1319747195 2936 dbSNP
rs1384400638 2937 dbSNP
rs1386363935 2943 dbSNP
rs1158348487 2960 dbSNP
rs1418320196 2965 dbSNP
rs1387487552 2969 dbSNP
rs1018347665 2971 dbSNP
rs1444267781 2972 dbSNP
rs1235758482 2980 dbSNP
rs1195478767 2986 dbSNP
rs899996978 2992 dbSNP
rs7164579 2993 dbSNP
rs1027172041 2999 dbSNP
rs746476292 3004 dbSNP
rs1361257824 3006 dbSNP
rs1292270610 3009 dbSNP
rs754986383 3017 dbSNP
rs1471278734 3037 dbSNP
rs781108333 3040 dbSNP
rs1360787411 3041 dbSNP
rs747996972 3045 dbSNP
rs1327519739 3049 dbSNP
rs1400042442 3050 dbSNP
rs753335209 3065 dbSNP
rs769593674 3068 dbSNP
rs1398698961 3074 dbSNP
rs1367802107 3084 dbSNP
rs1025020013 3096 dbSNP
rs1304155570 3098 dbSNP
rs970418806 3100 dbSNP
rs1411944649 3108 dbSNP
rs1330508801 3110 dbSNP
rs980506400 3118 dbSNP
rs367710321 3119 dbSNP
rs1372589452 3122 dbSNP
rs7164928 3130 dbSNP
rs936426636 3135 dbSNP
rs1490827416 3138 dbSNP
rs574211911 3141 dbSNP
rs989285609 3144 dbSNP
rs1320427497 3147 dbSNP
rs1216738645 3158 dbSNP
rs1257292849 3163 dbSNP
rs913743783 3174 dbSNP
rs931523805 3175 dbSNP
rs1214812822 3179 dbSNP
rs749557379 3182 dbSNP
rs1202245481 3200 dbSNP
rs1267929377 3201 dbSNP
rs1217283809 3210 dbSNP
rs1264980784 3242 dbSNP
rs537763249 3246 dbSNP
rs1284291710 3253 dbSNP
rs1530196 3254 dbSNP
rs1348342282 3268 dbSNP
rs1331067690 3273 dbSNP
rs940457501 3303 dbSNP
rs1040131084 3304 dbSNP
rs1168686061 3314 dbSNP
rs774282122 3317 dbSNP
rs1429986256 3318 dbSNP
rs1198404807 3320 dbSNP
rs1476886776 3322 dbSNP
rs769590955 3325 dbSNP
rs901584961 3326 dbSNP
rs1190249341 3330 dbSNP
rs760694545 3333 dbSNP
rs772904672 3333 dbSNP
rs556525787 3343 dbSNP
rs766058565 3344 dbSNP
rs1169027105 3354 dbSNP
rs773843306 3359 dbSNP
rs1255579031 3360 dbSNP
rs759102305 3361 dbSNP
rs200340415 3362 dbSNP
rs767024190 3363 dbSNP
rs1219170138 3366 dbSNP
rs111724689 3367 dbSNP
rs1365845888 3371 dbSNP
rs376424809 3372 dbSNP
rs1443180394 3373 dbSNP
rs370075081 3381 dbSNP
rs1039744390 3382 dbSNP
rs765592456 3394 dbSNP
rs1335443882 3400 dbSNP
rs899903558 3410 dbSNP
rs1243484257 3418 dbSNP
rs750805492 3419 dbSNP
rs1329395580 3422 dbSNP
rs1342932802 3424 dbSNP
rs1341459817 3443 dbSNP
rs771010108 3452 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb HITS-CLIP data was present in GSM1084068. RNA binding protein: AGO2. Condition:CLIP_noemetine_SigmaAb HITS-CLIP data was present in GSM1084069. RNA binding protein: AGO2. Condition:CLIP_emetine_SigmaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM4903829
Method / RBP HITS-CLIP / AGO
Cell line / Condition Human neurons / CTLTD_shCTL_a
Location of target site NM_017975 | 3UTR | ACCCUCAAAGCAGAAAAGGGAGGAAGAUCCUGAAGAUUCUCUUAUGAAGCUCCAAAAUUGAUAAUCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161238
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903831
Method / RBP HITS-CLIP / AGO
Cell line / Condition Human neurons / 124TD_shELAVL3_a
Location of target site NM_017975 | 3UTR | CAGAAAAGGGAGGAAGAUCCUGAAGAUUCUCUUAUGAAGCUCCAAAAUUGAUAAUCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161238
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_017975 | 3UTR | AAUUAUUGUAGAACCUGAAAACAGCAAUGUAUGGAAACCCUCAAAGCAGAAAAGGGAGGAAGAUCCUGAAGAUUCUCUUAUGAAGCUCCAAAAUUGAUAAUCCUGUCuca
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_017975 | 3UTR | UAAUUAUUGUAGAACCUGAAAACAGCAAUGUAUGGAAACCCUCAAAGCAGAAAAGGGAGGAAGAUCCUGAAGAUUCUCUUAUGAAGCUCCAAAAUUGAUAAUCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_017975 | 3UTR | UCUUAUGAAGCUCCAAAAUUGAUAAUCCUGUCuca
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_017975 | 3UTR | UCUCUUAUGAAGCUCCAAAAUUGAUAAUCCUGUCuc
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000307897.5 | 3UTR | AGCAGAAAAGGGAGGAAGAUCCUGAAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1084068
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_SigmaAb
Location of target site ENST00000307897.5 | 3UTR | AGAAAAGGGAGGAAGAUCCUGAAGAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1084069
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_SigmaAb
Location of target site ENST00000307897.5 | 3UTR | GAAAAGGGAGGAAGAUCCUGAAGAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
113 hsa-miR-3123 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT058369 TBCEL tubulin folding cofactor E like 2 4
MIRT059816 EFNA1 ephrin A1 2 2
MIRT066850 TMEM19 transmembrane protein 19 2 2
MIRT071503 CALM1 calmodulin 1 2 6
MIRT073758 NUBP1 nucleotide binding protein 1 2 2
MIRT074324 TNRC6A trinucleotide repeat containing 6A 2 10
MIRT094805 LMNB1 lamin B1 2 2
MIRT099173 MAP3K4 mitogen-activated protein kinase kinase kinase 4 2 2
MIRT099545 ID4 inhibitor of DNA binding 4, HLH protein 2 2
MIRT122643 E2F3 E2F transcription factor 3 2 2
MIRT180918 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 8
MIRT192844 BLOC1S6 biogenesis of lysosomal organelles complex 1 subunit 6 2 2
MIRT224984 BAG4 BCL2 associated athanogene 4 2 2
MIRT246065 NRAS NRAS proto-oncogene, GTPase 2 2
MIRT357085 PRRC1 proline rich coiled-coil 1 2 2
MIRT378170 C5ORF51 chromosome 5 open reading frame 51 2 2
MIRT441636 KDM5A lysine demethylase 5A 2 2
MIRT441802 BCAS1 breast carcinoma amplified sequence 1 2 2
MIRT443019 C21orf91 chromosome 21 open reading frame 91 2 2
MIRT443445 SERPINB4 serpin family B member 4 2 2
MIRT443661 SERPINB3 serpin family B member 3 2 2
MIRT443776 STS steroid sulfatase 2 2
MIRT444663 TSPAN14 tetraspanin 14 2 2
MIRT444924 KIAA1522 KIAA1522 2 2
MIRT445378 FOXO1 forkhead box O1 2 2
MIRT447920 PAIP2B poly(A) binding protein interacting protein 2B 2 2
MIRT449202 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT449713 TSPYL1 TSPY like 1 2 2
MIRT450403 TMEM47 transmembrane protein 47 2 2
MIRT450787 PAPOLG poly(A) polymerase gamma 2 2
MIRT451381 C19orf43 telomerase RNA component interacting RNase 2 2
MIRT452507 WDR1 WD repeat domain 1 2 2
MIRT453264 PARP11 poly(ADP-ribose) polymerase family member 11 2 2
MIRT454642 FAM83H family with sequence similarity 83 member H 2 2
MIRT455513 C6orf106 chromosome 6 open reading frame 106 2 2
MIRT456709 LDB1 LIM domain binding 1 2 2
MIRT457231 AP3D1 adaptor related protein complex 3 delta 1 subunit 2 2
MIRT459235 MRPS21 mitochondrial ribosomal protein S21 2 2
MIRT460553 IFNAR1 interferon alpha and beta receptor subunit 1 2 4
MIRT461424 CTSL2 cathepsin V 2 3
MIRT462869 CYP51A1 cytochrome P450 family 51 subfamily A member 1 2 2
MIRT467178 SPTY2D1 SPT2 chromatin protein domain containing 1 2 2
MIRT469233 RHOBTB3 Rho related BTB domain containing 3 2 2
MIRT474125 LIPC lipase C, hepatic type 2 2
MIRT475509 HSP90B1 heat shock protein 90 beta family member 1 2 4
MIRT478134 DHX36 DEAH-box helicase 36 2 2
MIRT481326 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 2 2
MIRT482003 AMOTL2 angiomotin like 2 2 2
MIRT482230 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT483436 RHOXF2B Rhox homeobox family member 2B 2 2
MIRT483824 ZC3H12B zinc finger CCCH-type containing 12B 2 2
MIRT492051 TNFSF9 TNF superfamily member 9 2 2
MIRT494114 DLX6 distal-less homeobox 6 2 2
MIRT498882 ZNF12 zinc finger protein 12 2 10
MIRT499674 NPHP3 nephrocystin 3 2 2
MIRT506932 IGDCC4 immunoglobulin superfamily DCC subclass member 4 2 6
MIRT509461 ZNF587 zinc finger protein 587 2 6
MIRT510048 AKR1B10 aldo-keto reductase family 1 member B10 2 4
MIRT514807 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT515217 CRCP CGRP receptor component 2 2
MIRT515486 INCENP inner centromere protein 2 4
MIRT517765 ZNF366 zinc finger protein 366 2 4
MIRT518216 TRMT10B tRNA methyltransferase 10B 2 2
MIRT519602 ZNF805 zinc finger protein 805 2 2
MIRT523570 GGCX gamma-glutamyl carboxylase 2 4
MIRT525795 SOD2 superoxide dismutase 2 2 2
MIRT533055 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT534218 SLC37A3 solute carrier family 37 member 3 2 4
MIRT535633 NR2E1 nuclear receptor subfamily 2 group E member 1 2 2
MIRT535863 MRPL17 mitochondrial ribosomal protein L17 2 2
MIRT536344 LEFTY1 left-right determination factor 1 2 2
MIRT537923 DSTYK dual serine/threonine and tyrosine protein kinase 2 2
MIRT543114 SKA2 spindle and kinetochore associated complex subunit 2 2 2
MIRT544717 ZNF529 zinc finger protein 529 2 2
MIRT544847 BASP1 brain abundant membrane attached signal protein 1 2 4
MIRT545536 ARF3 ADP ribosylation factor 3 2 2
MIRT547124 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT548070 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT548446 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 2
MIRT548626 DAZAP1 DAZ associated protein 1 2 4
MIRT550259 FAM120AOS family with sequence similarity 120A opposite strand 2 2
MIRT551940 AKAP8 A-kinase anchoring protein 8 2 4
MIRT552511 ZIK1 zinc finger protein interacting with K protein 1 2 4
MIRT554015 SPIRE1 spire type actin nucleation factor 1 2 2
MIRT556647 KPNA2 karyopherin subunit alpha 2 2 4
MIRT559744 ACOX1 acyl-CoA oxidase 1 2 2
MIRT560393 TMEM254 transmembrane protein 254 2 2
MIRT562234 HMGB2 high mobility group box 2 2 2
MIRT563325 ORC4 origin recognition complex subunit 4 2 2
MIRT563697 RPS26 ribosomal protein S26 2 2
MIRT565066 USP25 ubiquitin specific peptidase 25 2 2
MIRT565349 TMED2 transmembrane p24 trafficking protein 2 2 2
MIRT565624 SLC31A1 solute carrier family 31 member 1 2 2
MIRT566379 PNISR PNN interacting serine and arginine rich protein 2 2
MIRT567575 FEM1C fem-1 homolog C 2 2
MIRT569383 DDX20 DEAD-box helicase 20 2 2
MIRT570037 FAM228A family with sequence similarity 228 member A 2 2
MIRT573269 DCAF10 DDB1 and CUL4 associated factor 10 2 2
MIRT573912 PARP1 poly(ADP-ribose) polymerase 1 2 2
MIRT620034 ST6GALNAC3 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 2 2
MIRT635606 ZWILCH zwilch kinetochore protein 2 2
MIRT644413 FRMD6 FERM domain containing 6 2 2
MIRT652528 TM9SF4 transmembrane 9 superfamily member 4 2 2
MIRT656238 MFSD6 major facilitator superfamily domain containing 6 2 2
MIRT661373 DYRK4 dual specificity tyrosine phosphorylation regulated kinase 4 2 2
MIRT662530 PNPLA4 patatin like phospholipase domain containing 4 2 2
MIRT675551 MALL mal, T-cell differentiation protein like 2 2
MIRT693650 ACBD7 acyl-CoA binding domain containing 7 2 2
MIRT696348 SLC35D2 solute carrier family 35 member D2 2 2
MIRT705815 AKNA AT-hook transcription factor 2 2
MIRT707632 TARDBP TAR DNA binding protein 2 2
MIRT717902 COPS8 COP9 signalosome subunit 8 2 2
MIRT723626 SOBP sine oculis binding protein homolog 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3123 Doxorubicin 31703 NSC123127 approved sensitive High Triple-Negative Breast Cancer cell line (MDA-MB-231, MDA-MB-468)
hsa-mir-3123 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-miR-3123 Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-3123 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3123 Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)

Error report submission