pre-miRNA Information
pre-miRNA hsa-mir-4457   
Genomic Coordinates chr5: 1309310 - 1309377
Description Homo sapiens miR-4457 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4457
Sequence 43| UCACAAGGUAUUGACUGGCGUA |64
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1031676297 8 dbSNP
rs1249861366 14 dbSNP
rs115769169 17 dbSNP
rs968846507 19 dbSNP
rs540870271 20 dbSNP
rs993130937 22 dbSNP
Putative Targets

Gene Information
Gene Symbol GLTSCR2
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084069. RNA binding protein: AGO2. Condition:CLIP_emetine_SigmaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084069
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_SigmaAb
Location of target site ENST00000246802.5 | 3UTR | UGAGGAUAGAAUUGGUUUUUUUUUUUUUUGGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
83 hsa-miR-4457 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT098032 SOBP sine oculis binding protein homolog 2 2
MIRT202580 PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 2 6
MIRT247137 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT349266 PTBP1 polypyrimidine tract binding protein 1 2 2
MIRT363756 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 2 2
MIRT443586 FAM84B family with sequence similarity 84 member B 2 2
MIRT452333 EIF5AL1 eukaryotic translation initiation factor 5A-like 1 2 2
MIRT453864 ZBTB40 zinc finger and BTB domain containing 40 2 4
MIRT471486 PDE4D phosphodiesterase 4D 2 4
MIRT476290 GMFB glia maturation factor beta 2 8
MIRT479897 CCDC117 coiled-coil domain containing 117 2 4
MIRT484251 ANK1 ankyrin 1 2 2
MIRT491473 TMEM214 transmembrane protein 214 2 2
MIRT493804 GAN gigaxonin 2 6
MIRT499252 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT502271 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 4
MIRT504651 RPL9 ribosomal protein L9 2 6
MIRT505211 UBN2 ubinuclein 2 2 8
MIRT508952 SNRPB small nuclear ribonucleoprotein polypeptides B and B1 2 4
MIRT512691 POP1 POP1 homolog, ribonuclease P/MRP subunit 2 2
MIRT513320 SCUBE3 signal peptide, CUB domain and EGF like domain containing 3 2 2
MIRT513870 HOXA5 homeobox A5 2 2
MIRT517342 ZNF529 zinc finger protein 529 2 4
MIRT518947 LSG1 large 60S subunit nuclear export GTPase 1 2 2
MIRT520867 SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone 2 2
MIRT528325 GIGYF2 GRB10 interacting GYF protein 2 2 2
MIRT531990 SLCO1B3 solute carrier organic anion transporter family member 1B3 2 2
MIRT533298 USP46 ubiquitin specific peptidase 46 2 2
MIRT545257 TRIM36 tripartite motif containing 36 2 4
MIRT547038 POGZ pogo transposable element derived with ZNF domain 2 2
MIRT556103 MOAP1 modulator of apoptosis 1 2 2
MIRT558321 DR1 down-regulator of transcription 1 2 2
MIRT558521 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT560906 TMED10 transmembrane p24 trafficking protein 10 2 2
MIRT568448 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT570586 OTUD7B OTU deubiquitinase 7B 2 2
MIRT572799 SIGLEC14 sialic acid binding Ig like lectin 14 2 2
MIRT573863 C9orf78 chromosome 9 open reading frame 78 2 2
MIRT575058 P2ry1 purinergic receptor P2Y, G-protein coupled 1 2 5
MIRT609931 SLC38A1 solute carrier family 38 member 1 2 4
MIRT610836 ZNF585A zinc finger protein 585A 2 4
MIRT611474 P2RY1 purinergic receptor P2Y1 2 7
MIRT613569 YY2 YY2 transcription factor 2 2
MIRT618626 GREB1 growth regulation by estrogen in breast cancer 1 2 2
MIRT620606 SAP30 Sin3A associated protein 30 2 2
MIRT621017 CLSTN3 calsyntenin 3 2 4
MIRT635314 FAM179A TOG array regulator of axonemal microtubules 2 2 2
MIRT635919 GLTSCR2 NOP53 ribosome biogenesis factor 2 2
MIRT640598 TM9SF4 transmembrane 9 superfamily member 4 2 2
MIRT641784 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 4
MIRT644067 IQCE IQ motif containing E 2 2
MIRT648288 TRAPPC2L trafficking protein particle complex 2 like 2 2
MIRT658085 FOXR2 forkhead box R2 2 2
MIRT659077 DEPTOR DEP domain containing MTOR interacting protein 2 2
MIRT665307 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT665975 SYTL4 synaptotagmin like 4 2 2
MIRT666302 SLC25A25 solute carrier family 25 member 25 2 2
MIRT674906 RASSF9 Ras association domain family member 9 2 2
MIRT680086 THAP1 THAP domain containing 1 2 2
MIRT681488 DIP2A disco interacting protein 2 homolog A 2 2
MIRT691244 DFNB59 pejvakin 2 2
MIRT692362 AGTRAP angiotensin II receptor associated protein 2 2
MIRT693035 MB21D1 Mab-21 domain containing 1 2 2
MIRT693837 STAT5A signal transducer and activator of transcription 5A 2 2
MIRT694479 LRTOMT leucine rich transmembrane and O-methyltransferase domain containing 2 2
MIRT696070 ZNF264 zinc finger protein 264 2 2
MIRT696578 TTC21B tetratricopeptide repeat domain 21B 2 2
MIRT696760 MTFMT mitochondrial methionyl-tRNA formyltransferase 2 2
MIRT697307 ZNF652 zinc finger protein 652 2 2
MIRT700152 RNF115 ring finger protein 115 2 2
MIRT701056 PARP2 poly(ADP-ribose) polymerase 2 2 2
MIRT701198 OTUD3 OTU deubiquitinase 3 2 2
MIRT701335 NSD1 nuclear receptor binding SET domain protein 1 2 2
MIRT702656 ITGA3 integrin subunit alpha 3 2 2
MIRT703618 FBXO45 F-box protein 45 2 2
MIRT704673 CHTOP chromatin target of PRMT1 2 2
MIRT708894 ZNF780A zinc finger protein 780A 2 2
MIRT711620 DGKH diacylglycerol kinase eta 2 2
MIRT713745 TMEM81 transmembrane protein 81 2 2
MIRT719712 CD101 CD101 molecule 2 2
MIRT720294 DLGAP3 DLG associated protein 3 2 2
MIRT722606 CCDC152 coiled-coil domain containing 152 2 2
MIRT724566 ACSBG1 acyl-CoA synthetase bubblegum family member 1 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4457 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-miR-4457 Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-4457 Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-4457 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)

Error report submission