pre-miRNA Information
pre-miRNA hsa-mir-23a   
Genomic Coordinates chr19: 13836587 - 13836659
Synonyms MIRN23A, hsa-mir-23a, miRNA23A, MIR23A
Description Homo sapiens miR-23a stem-loop
Comment This miRNA was previously named miR-23 . This finding was later retracted after the discovery that the regulated gene was human homolog of ES1 (HES1), whose function is unknown.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-23a-5p
Sequence 9| GGGGUUCCUGGGGAUGGGAUUU |30
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs748509260 12 dbSNP
rs1205403719 17 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol APTX   
Synonyms AOA, AOA1, AXA1, EAOH, EOAHA, FHA-HIT
Description aprataxin
Transcript NM_175069   
Other Transcripts NM_175073   
Expression
Putative miRNA Targets on APTX
3'UTR of APTX
(miRNA target sites are highlighted)
>APTX|NM_175069|3'UTR
   1 CTGGGATTTGACTTTTCTTCCTTGCCTGCAGCTGTGATCGAGATGGTACAAGAGGCTGGTAGAGTAACTGTCCGAGATGG
  81 GATGCCTGAGCTCTTGAAGCTGCCCCTTCGTTGTCATGAGTGCCAGCAGCTGCTGCCTTCCATTCCTCAGCTGAAAGAAC
 161 ATCTCAGGAAGCACTGGACACAGTGATTCTGCAGAGCCTGAGCTGCTGCTGTGGTGTGGCCCACTGGAGCAAACTGCTGG
 241 CACCTATTCTGGGTTGCTTGTGAACTTCTACTCATTTCCTAAATTAAAACATGCAGCTTTTTCACAAATTTATTCTATTA
 321 TTGAGTGGCCACAATGTAGAGTGGCTCAAAGTACTTCAGGATTAGGAATTTGGGTTTGTCATAGATGTATTCTCTGGTGA
 401 GGGTGGCTGGGATATACCTGACCCACCATCTTCAGAAGGACCCATGTCAGGTCTGACCATTGGGAGCAAAGCCATGTTCA
 481 CACTGACCTAATGCAGAGTATGGAAGCATTGGGCTGGTTATACATTTCTGTTTCTTAGATTTATCCTCCGCCTCTGTAGG
 561 CATGGACAACCTTTAATCAGAGCATCTAGAGTGGCCTCTTGTTTATCCTGAAGATACTGATGGGTCTTGTTTTCTGTTAG
 641 TCTGTTTTGTAATATTCTTTTCCCTTCCTTCATGGGGAGGCTTAGTTTGTCCAGTCCTTCCATGCCCTTCTATCCCAGAT
 721 TACCTAAATGTTCCCTTCTCAGGAATTCTGTCTCATCAGTTCTTCACAGTGAGAAAAGAGGCTAGATGATGGTGTGGGGG
 801 GTTGGAGTTTTCTTCTAATACCGAGGGTTCCTGGCTGTGAGGAAACAGCCACATGTTCGTCATGATTGAGCTGTGAAGTC
 881 TTCTTGGACCTGTTGTCTGAAAATAAAGTTAATTTGTTTGAGGCATCTCTCTTAAGTAGGTGGAAACTATTGAAGTTCAG
 961 CTAACAATCACAGCATAGGTTCTGATGCATGGAAAGGTGGTTGGTGAATGAAAAAGTTGCGTAGAGCCACTACTTTCTTT
1041 TTCCCTGAGAATAAATTTGGATAAAACAGTTGTATTCAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' uuUAGGGUAGGGGUCCUUGGGg 5'
            :|:|| |:|:||||||::| 
Target 5' atGTTCCCTTCTCAGGAATTCt 3'
728 - 749 144.00 -23.80
2
miRNA  3' uuuagGGUAGGGGUC--CUUGGGg 5'
               |||||::|||  |:|||| 
Target 5' acccaCCATCTTCAGAAGGACCCa 3'
421 - 444 121.00 -23.90
3
miRNA  3' uuuaggGUAGGGGUCCUUGGgg 5'
                ||| |:|||||| |  
Target 5' aaagaaCAT-CTCAGGAAGCac 3'
154 - 174 111.00 -14.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
810365 29 ClinVar
434253 30 ClinVar
4430 31 ClinVar
286950 110 ClinVar
870836 114 ClinVar
136416 128 ClinVar
290957 146 ClinVar
994778 160 ClinVar
915132 327 ClinVar
366588 373 ClinVar
915131 401 ClinVar
913884 479 ClinVar
913883 496 ClinVar
366587 549 ClinVar
366586 640 ClinVar
913882 662 ClinVar
366585 791 ClinVar
366584 792 ClinVar
913881 796 ClinVar
913504 822 ClinVar
913503 942 ClinVar
366583 992 ClinVar
366582 1020 ClinVar
366581 1039 ClinVar
366580 1044 ClinVar
COSN30155107 10 COSMIC
COSN20076761 12 COSMIC
COSN20076941 17 COSMIC
COSN30496596 21 COSMIC
COSN4894256 21 COSMIC
COSM7689445 40 COSMIC
COSM8360981 48 COSMIC
COSM6115509 58 COSMIC
COSM5777778 60 COSMIC
COSM8820748 60 COSMIC
COSM4373579 61 COSMIC
COSM5410988 72 COSMIC
COSM3906861 73 COSMIC
COSM1598249 74 COSMIC
COSM6602525 80 COSMIC
COSM8082477 104 COSMIC
COSM1598250 110 COSMIC
COSM6842549 110 COSMIC
COSM6495727 118 COSMIC
COSM2772354 125 COSMIC
COSM9094039 131 COSMIC
COSM4832933 148 COSMIC
COSM1183292 157 COSMIC
COSM9018438 157 COSMIC
COSM9318865 166 COSMIC
COSM404972 171 COSMIC
COSM9905695 177 COSMIC
COSN30481483 189 COSMIC
COSN31500356 195 COSMIC
COSN31514854 221 COSMIC
COSN30724899 228 COSMIC
COSN26966463 229 COSMIC
COSN9710692 292 COSMIC
COSN30461556 303 COSMIC
COSN31492113 325 COSMIC
COSN31553077 438 COSMIC
COSN24365537 524 COSMIC
COSN22561996 984 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1424688171 7 dbSNP
rs1360072550 10 dbSNP
rs754738237 11 dbSNP
rs1007288114 17 dbSNP
rs1175781460 19 dbSNP
rs1293354141 22 dbSNP
rs753823355 23 dbSNP
rs1362438513 24 dbSNP
rs1386746388 28 dbSNP
rs759989689 29 dbSNP
rs904293109 30 dbSNP
rs1266643644 39 dbSNP
rs149867156 40 dbSNP
rs750406680 43 dbSNP
rs1163745774 46 dbSNP
rs1461051478 50 dbSNP
rs574404091 55 dbSNP
rs1018257998 56 dbSNP
rs376003639 57 dbSNP
rs774598658 58 dbSNP
rs764599592 60 dbSNP
rs763358461 62 dbSNP
rs776170265 64 dbSNP
rs1284870793 67 dbSNP
rs1353920862 70 dbSNP
rs770357057 72 dbSNP
rs746541090 73 dbSNP
rs772656348 74 dbSNP
rs771607486 78 dbSNP
rs747796522 82 dbSNP
rs770727980 84 dbSNP
rs1269363354 85 dbSNP
rs12001066 86 dbSNP
rs1005572979 92 dbSNP
rs1282468265 95 dbSNP
rs746837337 96 dbSNP
rs1402872218 100 dbSNP
rs754791634 103 dbSNP
rs1420487465 104 dbSNP
rs1303395150 105 dbSNP
rs1047315004 106 dbSNP
rs1390409626 108 dbSNP
rs373961930 109 dbSNP
rs371292546 110 dbSNP
rs1057490043 113 dbSNP
rs376734304 115 dbSNP
rs1370271444 116 dbSNP
rs1424953679 116 dbSNP
rs374053126 117 dbSNP
rs938970569 118 dbSNP
rs141493373 128 dbSNP
rs757349121 131 dbSNP
rs1437432600 135 dbSNP
rs751746847 137 dbSNP
rs759723787 137 dbSNP
rs779001961 142 dbSNP
rs1458214337 143 dbSNP
rs886044599 146 dbSNP
rs1267152361 147 dbSNP
rs763444563 153 dbSNP
rs1234547134 156 dbSNP
rs1221553213 163 dbSNP
rs1456355533 167 dbSNP
rs775949465 168 dbSNP
rs200782765 173 dbSNP
rs1196855899 174 dbSNP
rs1335702493 177 dbSNP
rs755113127 178 dbSNP
rs760001144 183 dbSNP
rs369930661 200 dbSNP
rs1330370886 206 dbSNP
rs1446879003 207 dbSNP
rs1404633347 208 dbSNP
rs776979710 209 dbSNP
rs771539420 211 dbSNP
rs986586873 212 dbSNP
rs556417499 213 dbSNP
rs773994022 215 dbSNP
rs539914259 219 dbSNP
rs953862107 220 dbSNP
rs1173502832 221 dbSNP
rs1336367191 223 dbSNP
rs1469870542 227 dbSNP
rs377690852 235 dbSNP
rs779869260 241 dbSNP
rs921136179 243 dbSNP
rs769631784 245 dbSNP
rs570803022 246 dbSNP
rs1462569947 252 dbSNP
rs781130275 253 dbSNP
rs757291328 257 dbSNP
rs976571586 268 dbSNP
rs946388509 269 dbSNP
rs751619829 270 dbSNP
rs1377910222 271 dbSNP
rs1280930228 274 dbSNP
rs1240346870 277 dbSNP
rs778165481 281 dbSNP
rs758743193 294 dbSNP
rs1451162063 298 dbSNP
rs752936558 303 dbSNP
rs765763992 307 dbSNP
rs915125737 310 dbSNP
rs1400499085 312 dbSNP
rs759930657 315 dbSNP
rs770903946 316 dbSNP
rs1440513794 317 dbSNP
rs1315812307 321 dbSNP
rs148292963 327 dbSNP
rs1031986589 328 dbSNP
rs1181803464 329 dbSNP
rs1446428629 334 dbSNP
rs998547589 338 dbSNP
rs1206629915 341 dbSNP
rs1237977508 344 dbSNP
rs1483019016 349 dbSNP
rs1182639002 350 dbSNP
rs1478275170 354 dbSNP
rs766841162 360 dbSNP
rs1445079164 362 dbSNP
rs761257788 365 dbSNP
rs760824792 372 dbSNP
rs113638548 373 dbSNP
rs1289032022 378 dbSNP
rs1247527334 381 dbSNP
rs977003268 388 dbSNP
rs1285321467 392 dbSNP
rs568783017 401 dbSNP
rs1012662246 402 dbSNP
rs1325083466 406 dbSNP
rs894220671 407 dbSNP
rs1304191439 408 dbSNP
rs1338220454 412 dbSNP
rs1057260827 414 dbSNP
rs1300399912 418 dbSNP
rs1278766089 420 dbSNP
rs1420592729 425 dbSNP
rs1365171166 426 dbSNP
rs1161819366 427 dbSNP
rs762629781 428 dbSNP
rs964100401 431 dbSNP
rs898096564 433 dbSNP
rs548870588 434 dbSNP
rs1259863758 437 dbSNP
rs1487522826 438 dbSNP
rs1018372403 449 dbSNP
rs1474362056 451 dbSNP
rs1193315952 454 dbSNP
rs1243684044 457 dbSNP
rs1264572031 459 dbSNP
rs1325329186 460 dbSNP
rs866139662 464 dbSNP
rs1490103719 468 dbSNP
rs1266337355 474 dbSNP
rs532688347 479 dbSNP
rs745612904 480 dbSNP
rs1026107483 482 dbSNP
rs1459719791 492 dbSNP
rs563055303 496 dbSNP
rs756510915 498 dbSNP
rs994414292 499 dbSNP
rs1400983385 500 dbSNP
rs1298527367 505 dbSNP
rs1345194159 509 dbSNP
rs1301538770 513 dbSNP
rs896086786 520 dbSNP
rs1200539983 524 dbSNP
rs1438816740 527 dbSNP
rs1350570472 529 dbSNP
rs781025624 531 dbSNP
rs770855079 533 dbSNP
rs1425684350 537 dbSNP
rs886063857 549 dbSNP
rs750884035 550 dbSNP
rs1351736579 560 dbSNP
rs746922480 569 dbSNP
rs1192601306 570 dbSNP
rs1287254054 582 dbSNP
rs1378052286 591 dbSNP
rs923335458 592 dbSNP
rs1231857883 598 dbSNP
rs1314816895 605 dbSNP
rs778040753 608 dbSNP
rs1194916551 610 dbSNP
rs758547802 614 dbSNP
rs143023388 623 dbSNP
rs1219720670 624 dbSNP
rs946507857 629 dbSNP
rs1323300103 630 dbSNP
rs779137120 631 dbSNP
rs1403374603 635 dbSNP
rs924560935 636 dbSNP
rs138490250 640 dbSNP
rs559954042 642 dbSNP
rs1374736180 643 dbSNP
rs1440119031 644 dbSNP
rs1402480453 649 dbSNP
rs991102979 654 dbSNP
rs1208364301 660 dbSNP
rs1469196492 661 dbSNP
rs754188583 662 dbSNP
rs922527511 664 dbSNP
rs1035380211 667 dbSNP
rs1235869762 671 dbSNP
rs1177945540 672 dbSNP
rs1433465895 673 dbSNP
rs191436643 676 dbSNP
rs1175046683 681 dbSNP
rs761289876 682 dbSNP
rs574067595 688 dbSNP
rs1238202219 691 dbSNP
rs1199857904 694 dbSNP
rs1471692372 695 dbSNP
rs897953806 696 dbSNP
rs1461236151 700 dbSNP
rs563932179 702 dbSNP
rs1462995127 704 dbSNP
rs1006923029 707 dbSNP
rs911089390 714 dbSNP
rs1212681184 716 dbSNP
rs1238901648 721 dbSNP
rs1398287593 723 dbSNP
rs762743887 724 dbSNP
rs984204614 726 dbSNP
rs780379330 729 dbSNP
rs1337712971 737 dbSNP
rs1025632277 740 dbSNP
rs1281561909 741 dbSNP
rs1379254423 747 dbSNP
rs1235744690 752 dbSNP
rs1256698539 753 dbSNP
rs1310040146 753 dbSNP
rs931949925 754 dbSNP
rs973159126 755 dbSNP
rs1252271546 756 dbSNP
rs901945278 758 dbSNP
rs1304438592 762 dbSNP
rs1186379253 763 dbSNP
rs960296817 768 dbSNP
rs367715736 771 dbSNP
rs1168521851 778 dbSNP
rs1344321400 780 dbSNP
rs1040449763 782 dbSNP
rs1421098548 787 dbSNP
rs545625482 791 dbSNP
rs111430445 792 dbSNP
rs775131687 796 dbSNP
rs1394546104 800 dbSNP
rs1254691908 801 dbSNP
rs1333745482 816 dbSNP
rs530692252 822 dbSNP
rs759273556 823 dbSNP
rs1260466492 827 dbSNP
rs1324725744 837 dbSNP
rs1317805330 839 dbSNP
rs1214776023 849 dbSNP
rs1010598831 854 dbSNP
rs750414984 858 dbSNP
rs1286909118 859 dbSNP
rs768175241 859 dbSNP
rs914473152 866 dbSNP
rs1245327363 867 dbSNP
rs991134270 871 dbSNP
rs1191186618 878 dbSNP
rs1314785164 889 dbSNP
rs1262411911 895 dbSNP
rs774091679 898 dbSNP
rs1172405538 902 dbSNP
rs1361049980 903 dbSNP
rs1286867166 912 dbSNP
rs1401515625 921 dbSNP
rs1360752149 929 dbSNP
rs563262838 931 dbSNP
rs1376217669 934 dbSNP
rs1422228459 934 dbSNP
rs1369643726 935 dbSNP
rs1422565778 938 dbSNP
rs115295647 942 dbSNP
rs1424876914 946 dbSNP
rs1261537891 949 dbSNP
rs1191944347 950 dbSNP
rs1489430315 951 dbSNP
rs1264169594 952 dbSNP
rs1221948947 971 dbSNP
rs759110975 975 dbSNP
rs1163435899 976 dbSNP
rs775949021 984 dbSNP
rs1052082393 985 dbSNP
rs113556331 992 dbSNP
rs1306825348 995 dbSNP
rs1276133674 1001 dbSNP
rs1220242623 1005 dbSNP
rs981116705 1013 dbSNP
rs1328910140 1017 dbSNP
rs770908697 1020 dbSNP
rs760606522 1021 dbSNP
rs773269197 1022 dbSNP
rs143074773 1027 dbSNP
rs942631201 1029 dbSNP
rs888047903 1037 dbSNP
rs377365362 1039 dbSNP
rs1458921144 1041 dbSNP
rs772290850 1044 dbSNP
rs1395947843 1045 dbSNP
rs1169076206 1047 dbSNP
rs1436875415 1053 dbSNP
rs375901956 1055 dbSNP
rs1214154782 1059 dbSNP
rs1479012703 1062 dbSNP
rs983985113 1066 dbSNP
rs1424723823 1068 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084068. RNA binding protein: AGO2. Condition:CLIP_noemetine_SigmaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' uuuaggguaggggucCUUGGGg 5'
                         |||||| 
Target 5' -caggagaaugguguGAACCCa 3'
1 - 21
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084068
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_SigmaAb
Location of target site ENST00000436040.2 | 3UTR | CAGGAGAAUGGUGUGAACCCAGGAGGCGGAGCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.6 9.7e-4 0.629 5.0e-4 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.559 5.2e-3 0.624 1.6e-3 20 Click to see details
GSE19783 ER+ ER+ breast cancer -0.499 1.3e-2 -0.442 2.6e-2 20 Click to see details
GSE19536 Breast cancer -0.218 1.5e-2 -0.242 7.6e-3 100 Click to see details
GSE32688 Pancreatic cancer -0.38 1.6e-2 -0.378 1.6e-2 32 Click to see details
GSE38226 Liver fibrosis -0.469 1.6e-2 -0.566 3.7e-3 21 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.683 2.1e-2 -0.517 7.7e-2 9 Click to see details
GSE19350 CNS germ cell tumors 0.453 7.0e-2 0.278 1.9e-1 12 Click to see details
GSE21687 Ependynoma primary tumors -0.177 8.1e-2 -0.031 4.0e-1 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.272 9.4e-2 -0.263 1.0e-1 25 Click to see details
GSE19783 ER- ER- breast cancer -0.121 1.4e-1 -0.172 6.5e-2 79 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.156 2.3e-1 0.260 1.0e-1 25 Click to see details
GSE21032 Prostate cancer -0.076 2.5e-1 -0.087 2.2e-1 83 Click to see details
GSE26953 Aortic valvular endothelial cells -0.134 2.7e-1 -0.133 2.7e-1 24 Click to see details
GSE42095 Differentiated embryonic stem cells -0.137 2.7e-1 -0.316 7.1e-2 23 Click to see details
GSE17498 Multiple myeloma 0.078 3.2e-1 -0.084 3.0e-1 40 Click to see details
GSE28260 Renal cortex and medulla 0.062 4.2e-1 0.071 4.1e-1 13 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
THCA -0.292 0.01 -0.389 0 59 Click to see details
LUAD -0.689 0.02 -0.683 0.02 9 Click to see details
LUSC -0.33 0.02 -0.319 0.03 38 Click to see details
HNSC 0.307 0.03 0.193 0.12 40 Click to see details
KICH -0.348 0.07 -0.472 0.02 20 Click to see details
PCPG -0.957 0.09 -1.000 0.5 3 Click to see details
STAD 0.225 0.12 0.251 0.1 28 Click to see details
COAD 0.457 0.13 0.381 0.18 8 Click to see details
KIRC 0.119 0.18 0.156 0.11 62 Click to see details
LIHC -0.136 0.21 -0.143 0.2 38 Click to see details
CHOL -0.298 0.24 -0.333 0.21 8 Click to see details
KIRP -0.108 0.28 -0.154 0.2 32 Click to see details
BRCA 0.063 0.29 -0.008 0.47 78 Click to see details
CESC 0.256 0.42 0.500 0.33 3 Click to see details
PAAD 0.137 0.43 0.800 0.1 4 Click to see details
UCEC 0.037 0.44 -0.067 0.39 19 Click to see details
PRAD 0.031 0.45 -0.079 0.37 19 Click to see details
BLCA 0.025 0.46 0.121 0.33 16 Click to see details
ESCA 0.015 0.48 0.055 0.44 11 Click to see details
ESCA 0.015 0.48 0.055 0.44 11 Click to see details
ESCA 0.015 0.48 0.055 0.44 11 Click to see details
131 hsa-miR-23a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT038958 ATF1 activating transcription factor 1 1 1
MIRT057661 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT395438 NFKBID NFKB inhibitor delta 2 2
MIRT463884 WNT7B Wnt family member 7B 2 4
MIRT475804 HDGF heparin binding growth factor 2 2
MIRT478528 CTNS cystinosin, lysosomal cystine transporter 2 2
MIRT479278 CHD4 chromodomain helicase DNA binding protein 4 2 6
MIRT492564 PPM1L protein phosphatase, Mg2+/Mn2+ dependent 1L 2 2
MIRT500353 ZNF385A zinc finger protein 385A 2 2
MIRT509788 CHAF1B chromatin assembly factor 1 subunit B 2 4
MIRT511566 HIST3H2BB histone cluster 3 H2B family member b 2 4
MIRT525450 GPATCH2L G-patch domain containing 2 like 2 2
MIRT539558 CNKSR3 CNKSR family member 3 2 4
MIRT540034 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 4
MIRT540225 SAMD5 sterile alpha motif domain containing 5 2 2
MIRT540242 RGS17 regulator of G protein signaling 17 2 2
MIRT540871 ZBTB24 zinc finger and BTB domain containing 24 2 2
MIRT559065 C19orf47 chromosome 19 open reading frame 47 2 4
MIRT560685 HIST1H1T histone cluster 1 H1 family member t 2 2
MIRT565593 SLC35G1 solute carrier family 35 member G1 2 2
MIRT565642 SKI SKI proto-oncogene 2 2
MIRT576747 Tmem127 transmembrane protein 127 2 2
MIRT607712 LIMS1 LIM zinc finger domain containing 1 2 2
MIRT615682 NAV2 neuron navigator 2 2 2
MIRT617337 ZSCAN2 zinc finger and SCAN domain containing 2 2 2
MIRT617378 FAM227A family with sequence similarity 227 member A 2 2
MIRT620855 SERPING1 serpin family G member 1 2 2
MIRT625112 SLC1A5 solute carrier family 1 member 5 2 2
MIRT625124 NUP93 nucleoporin 93 2 2
MIRT625898 LINC00632 long intergenic non-protein coding RNA 632 2 2
MIRT626016 XRCC2 X-ray repair cross complementing 2 2 2
MIRT626481 ADAT1 adenosine deaminase, tRNA specific 1 2 2
MIRT626573 MED7 mediator complex subunit 7 2 2
MIRT626814 PRR11 proline rich 11 2 2
MIRT628136 HM13 histocompatibility minor 13 2 2
MIRT630771 MSANTD3 Myb/SANT DNA binding domain containing 3 2 2
MIRT633133 C6orf132 chromosome 6 open reading frame 132 2 2
MIRT636950 APTX aprataxin 2 2
MIRT637802 GGPS1 geranylgeranyl diphosphate synthase 1 2 2
MIRT638622 GSR glutathione-disulfide reductase 2 4
MIRT642196 SMAGP small cell adhesion glycoprotein 2 2
MIRT645121 HES2 hes family bHLH transcription factor 2 2 2
MIRT645344 AGTPBP1 ATP/GTP binding protein 1 2 2
MIRT646564 ALDH5A1 aldehyde dehydrogenase 5 family member A1 2 2
MIRT649243 TRIM65 tripartite motif containing 65 2 2
MIRT651810 USP49 ubiquitin specific peptidase 49 2 2
MIRT652137 TRPM7 transient receptor potential cation channel subfamily M member 7 2 2
MIRT652668 TIMELESS timeless circadian clock 2 2
MIRT655894 NEK9 NIMA related kinase 9 2 2
MIRT656564 LYRM7 LYR motif containing 7 2 2
MIRT657194 IKZF3 IKAROS family zinc finger 3 2 2
MIRT657907 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT660207 BMPR1A bone morphogenetic protein receptor type 1A 2 2
MIRT660619 ANKS4B ankyrin repeat and sterile alpha motif domain containing 4B 2 2
MIRT660826 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT660986 ABHD2 abhydrolase domain containing 2 2 2
MIRT662232 PGBD4 piggyBac transposable element derived 4 2 2
MIRT663691 ZNF347 zinc finger protein 347 2 2
MIRT665577 TUBD1 tubulin delta 1 2 2
MIRT666149 SP2 Sp2 transcription factor 2 2
MIRT666310 SLC22A3 solute carrier family 22 member 3 2 2
MIRT666457 SCRG1 stimulator of chondrogenesis 1 2 2
MIRT667716 KIAA1468 KIAA1468 2 2
MIRT668329 FKBP5 FK506 binding protein 5 2 2
MIRT668370 FBXO47 F-box protein 47 2 2
MIRT669304 C17orf75 chromosome 17 open reading frame 75 2 2
MIRT669538 ALG9 ALG9, alpha-1,2-mannosyltransferase 2 2
MIRT671681 ADK adenosine kinase 2 2
MIRT672177 MRE11A MRE11 homolog, double strand break repair nuclease 2 2
MIRT673604 HPSE heparanase 2 2
MIRT673749 ZNF333 zinc finger protein 333 2 2
MIRT674807 FAM229B family with sequence similarity 229 member B 2 2
MIRT675286 ARL10 ADP ribosylation factor like GTPase 10 2 2
MIRT675391 SVOP SV2 related protein 2 2
MIRT675788 MED28 mediator complex subunit 28 2 2
MIRT676151 OGFOD1 2-oxoglutarate and iron dependent oxygenase domain containing 1 2 2
MIRT676499 GJD3 gap junction protein delta 3 2 2
MIRT676621 CSNK1E casein kinase 1 epsilon 2 2
MIRT676644 GTDC1 glycosyltransferase like domain containing 1 2 2
MIRT676711 METTL14 methyltransferase like 14 2 2
MIRT676809 SHROOM4 shroom family member 4 2 2
MIRT677036 FOXO3 forkhead box O3 2 2
MIRT677062 NT5C2 5'-nucleotidase, cytosolic II 2 2
MIRT677086 SMIM15 small integral membrane protein 15 2 2
MIRT677193 MURC caveolae associated protein 4 2 2
MIRT677273 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 2 2
MIRT677345 POC1A POC1 centriolar protein A 2 2
MIRT677504 SLC10A6 solute carrier family 10 member 6 2 2
MIRT677526 OCIAD2 OCIA domain containing 2 2 2
MIRT677661 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 2 2
MIRT677727 SSR1 signal sequence receptor subunit 1 2 2
MIRT677803 PNPLA3 patatin like phospholipase domain containing 3 2 2
MIRT678144 SLC4A4 solute carrier family 4 member 4 2 2
MIRT678376 VTA1 vesicle trafficking 1 2 2
MIRT678708 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 2 2
MIRT678868 FAM118A family with sequence similarity 118 member A 2 2
MIRT679039 LACTB lactamase beta 2 2
MIRT679081 PURB purine rich element binding protein B 2 2
MIRT679137 SYK spleen associated tyrosine kinase 2 2
MIRT679299 SSBP2 single stranded DNA binding protein 2 2 2
MIRT679741 CABP4 calcium binding protein 4 2 2
MIRT679946 AS3MT arsenite methyltransferase 2 2
MIRT679976 E2F2 E2F transcription factor 2 2 2
MIRT683628 MTO1 mitochondrial tRNA translation optimization 1 2 2
MIRT683901 PSMB9 proteasome subunit beta 9 2 2
MIRT684172 MOG myelin oligodendrocyte glycoprotein 2 2
MIRT684231 C20orf144 chromosome 20 open reading frame 144 2 2
MIRT685403 C1orf158 chromosome 1 open reading frame 158 2 2
MIRT686253 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT687513 NCKAP1 NCK associated protein 1 2 2
MIRT688243 FITM2 fat storage inducing transmembrane protein 2 2 2
MIRT688315 FAM151B family with sequence similarity 151 member B 2 2
MIRT688733 CNDP1 carnosine dipeptidase 1 2 2
MIRT689031 ANGPTL3 angiopoietin like 3 2 2
MIRT698207 TMEM248 transmembrane protein 248 2 2
MIRT699859 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT709954 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT711541 MSH3 mutS homolog 3 2 2
MIRT712077 WDR37 WD repeat domain 37 2 2
MIRT715312 POLR2E RNA polymerase II subunit E 2 2
MIRT715725 PIAS2 protein inhibitor of activated STAT 2 2 2
MIRT715748 HSD11B1L hydroxysteroid 11-beta dehydrogenase 1 like 2 2
MIRT717604 DSTYK dual serine/threonine and tyrosine protein kinase 2 2
MIRT717875 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT718042 NIPAL2 NIPA like domain containing 2 2 2
MIRT718829 CDT1 chromatin licensing and DNA replication factor 1 2 2
MIRT724037 CAMK2N2 calcium/calmodulin dependent protein kinase II inhibitor 2 2 2
MIRT733305 TNF tumor necrosis factor 1 0
MIRT734941 HSPA1B heat shock protein family A (Hsp70) member 1B 3 0
MIRT737343 IGF2 insulin like growth factor 2 3 0
MIRT737546 PTEN phosphatase and tensin homolog 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-23a 1'-Acetoxychavicol acetate (ACA) NULL 119104 Microarray HN4 cell line 24317043 2014 down-regulated
miR-23a 5-Fluorouracil approved 3385 Quantitative real-time PCR colon cancer cells 17702597 2007 up-regulated
miR-23a Curcumin NULL 969516 Microarray BxPC-3 human pancreatic carcinoma cell line 18347134 2008 up-regulated
miR-23a Enoxacin approved 3229 Quantitative real-time PCR HEK293 cells 18641635 2008 up-regulated
miR-23a 17beta-estradiol (E2) approved 5757 Quantitative real-time PCR endometrial stromal 19088369 2008 down-regulated
miR-23a 17beta-estradiol (E2) approved 5757 Quantitative real-time PCR glandular epithelial cells 19088369 2008 down-regulated
miR-23a Medroxyprogesterone acetate approved 6279 Quantitative real-time PCR endometrial stromal 19088369 2008 down-regulated
miR-23a Medroxyprogesterone acetate approved 6279 Quantitative real-time PCR glandular epithelial cells 19088369 2008 up-regulated
miR-23a 17beta-estradiol (E2) approved 5757 Microarray MCF-7 breast cancer cells 19528081 2009 up-regulated
miR-23a Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 down-regulated
miR-23a Essential amino acids (EAA) NULL NULL Quantitative real-time PCR skeletal muscle of young adults 19828686 2009 up-regulated
miR-23a Bio-Oss NULL NULL Microarray osteoblast-like cell line (MG63) 20224834 2010 up-regulated
miR-23a Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-23a 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 up-regulated
miR-23a Trastuzumab approved NULL Microarray BT474 cells 22384020 2012 up-regulated
miR-23a Trastuzumab approved NULL Microarray SKBR3 cells. 22384020 2012 up-regulated
miR-23a 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Quantitative real-time PCR thymus 23024791 2012 down-regulated
miR-23a Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-23a Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 up-regulated
miR-23a Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 up-regualted
miR-23a Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 down-regulated
miR-23a Comfrey NULL 6440495 Microarray rat liver 21370286 2011 up-regulated
miR-23a Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-23a Ethanol NULL 702 Quantitative real-time PCR zebrafish embryos 22298809 2012 down-regulated
miR-23a 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Microarray embryos 22921993 2012 up-regulated
miR-23a 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Microarray embryos 22921993 2012 up-regulated
miR-23a Morphine approved 5288826 Microarray human monocyte-derived macrophages (h-mdms) infection with HIV-1 20564181 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-23a Cisplatin 5460033 NSC119875 approved sensitive Low Breast Cancer cell line (MDA-MB-231)
hsa-mir-23a Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (BGC823)
hsa-mir-23a Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC-7901)
hsa-mir-23a Topotecan 60699 NSC609699 approved sensitive cell line (W1)
hsa-mir-23a Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-mir-23a Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-23a Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-23a Cisplatin 5460033 NSC119875 approved sensitive cell line (OE19)
hsa-mir-23a Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-23a Docetaxel+Cisplatin+5-Fluorouracil sensitive tissue (hypopharyngeal squamous cell carcinoma)
hsa-mir-23a Cisplatin 5460033 NSC119875 approved sensitive cell line (SGC-7901)
hsa-miR-23a-5p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-23a-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-23a-5p Palbociclib 5330286 NSC758247 approved resistant High Breast Cancer cell line (T47D)
hsa-miR-23a-5p Arsenic trioxide 261004 NSC759274 approved sensitive Low Acute Myeloid Leukemia cell line (U937, Kasumi-1, THP-1, Jurkat E6.1, SUP B15)
hsa-miR-23a-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-23a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-23a-5p Tripterygium wilfordii Hook F resistant tissue
hsa-miR-23a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (total RNA)
hsa-miR-23a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (cytosolic RNA)
hsa-miR-23a-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-23a-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-23a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-23a-5p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-23a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-23a-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-23a-5p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-23a-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-23a-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-23a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-23a-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (MDA-231)
hsa-miR-23a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-23a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-23a-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-23a-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission