>PIGP|NM_153681|3'UTR
   1 ACTGTGTGTAACCATAGTAACACCAAGCACGTATTTATTTATAAGTTTTTGCCATTATAATTTTGACCATAAATTAATTT
  81 GACCATCTCTCTTATTAATAGAGAAGTAAAAAATGTAAGTTGACCTTCTCTTAGATTATGTTCAATGAATATTGTAAATG
 161 TTCAAGTATTGTTAATGAATAGAATAAATACAATATTGCATTCCCATATAGCAGACTT

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' cgguucccUUACCGUCCCUUUa 5' ||| || |||: Target 5' ctcttattAAT---AGAGAAGt 3'	89 - 107	95.00	-6.20

Mutant ID	Mutant Position	Mutant Source
COSN30191694	24	COSMIC
COSN30532840	26	COSMIC
COSN26989010	30	COSMIC
COSN31610924	32	COSMIC
COSN30119240	43	COSMIC
COSN31609968	49	COSMIC
COSN32053132	101	COSMIC
COSN30706782	125	COSMIC
COSN20698352	214	COSMIC
COSN1256425	219	COSMIC
COSN28846904	219	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs754976015	9	dbSNP
rs751402808	13	dbSNP
rs1196789439	16	dbSNP
rs1460547463	28	dbSNP
rs780194373	30	dbSNP
rs758484559	31	dbSNP
rs1181589808	39	dbSNP
rs369988960	41	dbSNP
rs1239753543	45	dbSNP
rs750526209	45	dbSNP
rs1158333536	51	dbSNP
rs765608898	51	dbSNP
rs1467664268	55	dbSNP
rs900193463	84	dbSNP
rs528593592	85	dbSNP
rs1053435898	87	dbSNP
rs998652092	89	dbSNP
rs866762626	91	dbSNP
rs1378065286	93	dbSNP
rs1446451174	93	dbSNP
rs907003543	95	dbSNP
rs1039128516	101	dbSNP
rs1362813966	103	dbSNP
rs575673520	105	dbSNP
rs1256061463	106	dbSNP
rs555849772	113	dbSNP
rs7337	119	dbSNP
rs1053039572	126	dbSNP
rs375385268	128	dbSNP
rs915967307	130	dbSNP
rs1458067096	131	dbSNP
rs111793194	132	dbSNP
rs151312187	132	dbSNP
rs934527187	133	dbSNP
rs1248336129	146	dbSNP
rs566702525	147	dbSNP
rs546477188	148	dbSNP
rs928456304	153	dbSNP
rs1428654620	154	dbSNP
rs79383403	165	dbSNP
rs190308801	166	dbSNP
rs1401239393	167	dbSNP
rs1461809030	171	dbSNP
rs1296741112	175	dbSNP
rs916644126	179	dbSNP
rs1410984468	194	dbSNP
rs765359785	207	dbSNP
rs963372735	208	dbSNP
rs1301412870	215	dbSNP

- Genes & development, 2013

When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.