pre-miRNA Information
pre-miRNA hsa-mir-3160-1   
Genomic Coordinates chr11: 46451805 - 46451889
Description Homo sapiens miR-3160-1 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-3160-2   
Genomic Coordinates chr11: 46451807 - 46451887
Description Homo sapiens miR-3160-2 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3160-3p
Sequence 54| AGAGCUGAGACUAGAAAGCCCA |75
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30582333 1 COSMIC
COSN1535547 3 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1396368683 1 dbSNP
rs1162409303 2 dbSNP
rs1404378453 12 dbSNP
rs1171960732 14 dbSNP
rs1324633375 16 dbSNP
rs1187765019 16 dbSNP
rs1300058326 19 dbSNP
rs1432898407 21 dbSNP
rs1011279103 22 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PDCL3   
Synonyms HTPHLP, PHLP2A, PHLP3, VIAF, VIAF1
Description phosducin like 3
Transcript NM_024065   
Expression
Putative miRNA Targets on PDCL3
3'UTR of PDCL3
(miRNA target sites are highlighted)
>PDCL3|NM_024065|3'UTR
   1 GGCTACAGCTTCTATCACATGCCGAACTTTCTTGTGACAAATTGTCTGGATTTTTTAAAAAAGGAAAAAGCAAGAATGAA
  81 TCCTTGTGGTTTTTAGTTTTGTATAAATTATGTTTCAAATCTTTACATTTTGGAAATAATCATTGCTGGAGATTCTGTTA
 161 AATATTTTGGAACTCTTTTTTTTTTTAAATTATAGTATTTCCTCTAAAAAAAATTAAAACCAGCCATTTGTATGGCAAAT
 241 GTCAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' acccGAAAGAUC-AGAGUCGAGa 5'
              | || |:| |:|:||:|: 
Target 5' gaatCCTTGTGGTTTTTAGTTTt 3'
78 - 100 110.00 -8.50
2
miRNA  3' acccgaaagaucagaGUCGAGa 5'
                         |||||: 
Target 5' ----------ggctaCAGCTTc 3'
1 - 12 104.00 -6.70
3
miRNA  3' accCGAAAGAU--------CAGAGUCGAGA 5'
             |:||| ||        ||:|||  |||
Target 5' ttaGTTTTGTATAAATTATGTTTCAAATCT 3'
93 - 122 93.00 -8.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30532760 10 COSMIC
COSN30455792 23 COSMIC
COSN30455838 24 COSMIC
COSN30101960 25 COSMIC
COSN30124465 33 COSMIC
COSN30188391 41 COSMIC
COSN30171221 114 COSMIC
COSN31553211 142 COSMIC
COSN16245146 187 COSMIC
COSN20096997 187 COSMIC
COSN1220414 190 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs757383484 6 dbSNP
rs781082031 7 dbSNP
rs773950560 8 dbSNP
rs745842973 9 dbSNP
rs766111038 10 dbSNP
rs779731914 17 dbSNP
rs1260757889 20 dbSNP
rs748916108 23 dbSNP
rs768201464 24 dbSNP
rs774219018 25 dbSNP
rs979493951 26 dbSNP
rs1244610989 28 dbSNP
rs1422019658 30 dbSNP
rs771757453 38 dbSNP
rs777246905 40 dbSNP
rs529319297 43 dbSNP
rs1375197060 47 dbSNP
rs759994830 50 dbSNP
rs1238304224 51 dbSNP
rs776147055 52 dbSNP
rs1376402451 58 dbSNP
rs548554876 61 dbSNP
rs1329745735 74 dbSNP
rs923739040 75 dbSNP
rs1391785329 78 dbSNP
rs1398294589 79 dbSNP
rs1291721436 81 dbSNP
rs1423926137 83 dbSNP
rs1385383039 105 dbSNP
rs1164912960 109 dbSNP
rs1437232894 113 dbSNP
rs1362885113 127 dbSNP
rs956658441 128 dbSNP
rs953442880 137 dbSNP
rs992040112 143 dbSNP
rs1265697956 153 dbSNP
rs1222471704 156 dbSNP
rs1490649322 173 dbSNP
rs1402537991 174 dbSNP
rs1241374340 176 dbSNP
rs1280378800 176 dbSNP
rs1294090820 176 dbSNP
rs1353019728 176 dbSNP
rs34182904 176 dbSNP
rs397985310 176 dbSNP
rs986125224 181 dbSNP
rs1404311934 187 dbSNP
rs911928236 187 dbSNP
rs1308601578 188 dbSNP
rs1336243697 189 dbSNP
rs112508569 193 dbSNP
rs1304825169 194 dbSNP
rs534467844 195 dbSNP
rs1361254901 198 dbSNP
rs1383529845 205 dbSNP
rs976674238 206 dbSNP
rs1470948970 208 dbSNP
rs578160473 221 dbSNP
rs947956315 222 dbSNP
rs1222975593 226 dbSNP
rs1291306187 227 dbSNP
rs1489941422 232 dbSNP
rs1044981555 239 dbSNP
rs1215019038 242 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084068. RNA binding protein: AGO2. Condition:CLIP_noemetine_SigmaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' acccgaaagaucagagUCGAGa 5'
                          | ||| 
Target 5' ggagugcaguggcacaAUCUC- 3'
11 - 31
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177608. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_10 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' acccgaaagaUCAGAGUCGAGa 5'
                    | ||||||||| 
Target 5' ---------cAAUCUCAGCUCa 3'
1 - 13
Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset GSM1084068
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_SigmaAb
Location of target site ENST00000264254.6 | 3UTR | UGCUGAGGCUGGAGUGCAGUGGCACAAUCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
Click to see details
118 hsa-miR-3160-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT066658 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT075318 SF3B3 splicing factor 3b subunit 3 2 4
MIRT077083 EIF1 eukaryotic translation initiation factor 1 2 2
MIRT100381 HSPA1B heat shock protein family A (Hsp70) member 1B 2 6
MIRT135259 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 4
MIRT184913 ZNF268 zinc finger protein 268 2 2
MIRT218862 CDKN1A cyclin dependent kinase inhibitor 1A 2 2
MIRT446580 FPR2 formyl peptide receptor 2 2 2
MIRT448834 FGD4 FYVE, RhoGEF and PH domain containing 4 2 2
MIRT449455 RNF13 ring finger protein 13 2 2
MIRT452284 CARD8 caspase recruitment domain family member 8 2 2
MIRT452628 FAM162A family with sequence similarity 162 member A 2 2
MIRT453454 GLG1 golgi glycoprotein 1 2 2
MIRT454188 AP1S3 adaptor related protein complex 1 sigma 3 subunit 2 6
MIRT454434 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT454575 NT5DC3 5'-nucleotidase domain containing 3 2 2
MIRT455555 TRAF1 TNF receptor associated factor 1 2 6
MIRT455841 MPL MPL proto-oncogene, thrombopoietin receptor 2 6
MIRT455969 BCAS4 breast carcinoma amplified sequence 4 2 4
MIRT456805 SIGLEC14 sialic acid binding Ig like lectin 14 2 2
MIRT457320 DUSP19 dual specificity phosphatase 19 2 2
MIRT457366 POFUT2 protein O-fucosyltransferase 2 2 2
MIRT457684 ZNF587 zinc finger protein 587 2 2
MIRT458158 LYRM4 LYR motif containing 4 2 6
MIRT458641 SGPP2 sphingosine-1-phosphate phosphatase 2 2 2
MIRT459134 FADS6 fatty acid desaturase 6 2 2
MIRT459153 NARF nuclear prelamin A recognition factor 2 4
MIRT460460 NOM1 nucleolar protein with MIF4G domain 1 2 4
MIRT460974 STK17B serine/threonine kinase 17b 2 2
MIRT461439 ACSBG1 acyl-CoA synthetase bubblegum family member 1 2 2
MIRT461507 NEDD4L neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase 2 2
MIRT462490 GSR glutathione-disulfide reductase 2 2
MIRT462638 PHF5A PHD finger protein 5A 2 2
MIRT463279 ZFX zinc finger protein, X-linked 2 2
MIRT463360 ZFAND4 zinc finger AN1-type containing 4 2 2
MIRT465777 TMOD3 tropomodulin 3 2 2
MIRT466143 TMEM120B transmembrane protein 120B 2 2
MIRT468401 SETD3 SET domain containing 3 2 2
MIRT468998 RNPS1 RNA binding protein with serine rich domain 1 2 2
MIRT471574 PARD6B par-6 family cell polarity regulator beta 2 2
MIRT472108 NME2 NME/NM23 nucleoside diphosphate kinase 2 2 2
MIRT472125 NME1-NME2 NME1-NME2 readthrough 2 2
MIRT473020 MRPS14 mitochondrial ribosomal protein S14 2 2
MIRT473083 MORN4 MORN repeat containing 4 2 2
MIRT475598 HMGB2 high mobility group box 2 2 4
MIRT475937 GXYLT2 glucoside xylosyltransferase 2 2 8
MIRT476117 GPR157 G protein-coupled receptor 157 2 2
MIRT476406 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT478003 DNAL1 dynein axonemal light chain 1 2 2
MIRT487969 IQSEC2 IQ motif and Sec7 domain 2 2 2
MIRT489418 TUBB2A tubulin beta 2A class IIa 2 2
MIRT491522 IL10RA interleukin 10 receptor subunit alpha 2 2
MIRT492673 PLEC plectin 2 2
MIRT493545 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT513085 USP9X ubiquitin specific peptidase 9, X-linked 2 2
MIRT514009 CECR2 CECR2, histone acetyl-lysine reader 2 4
MIRT516683 ZNF860 zinc finger protein 860 2 2
MIRT518392 ZNF250 zinc finger protein 250 2 2
MIRT522683 LUZP1 leucine zipper protein 1 2 6
MIRT524488 CEP97 centrosomal protein 97 2 2
MIRT527457 CLEC12B C-type lectin domain family 12 member B 2 2
MIRT527705 IL17REL interleukin 17 receptor E like 2 2
MIRT531647 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT532381 UMPS uridine monophosphate synthetase 2 2
MIRT532588 MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 2 2
MIRT533555 TPM4 tropomyosin 4 2 2
MIRT548371 ENTPD5 ectonucleoside triphosphate diphosphohydrolase 5 2 4
MIRT550250 PVR poliovirus receptor 2 2
MIRT552555 ZFP36L2 ZFP36 ring finger protein like 2 2 4
MIRT554113 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 2 2
MIRT554131 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 2 2
MIRT561344 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT561638 RUNX3 runt related transcription factor 3 2 2
MIRT566497 PBX2P1 PBX homeobox 2 pseudogene 1 2 2
MIRT570583 OTUD7B OTU deubiquitinase 7B 2 2
MIRT572731 MCTS1 MCTS1, re-initiation and release factor 2 2
MIRT574041 PEX26 peroxisomal biogenesis factor 26 2 2
MIRT575231 Fut1 fucosyltransferase 1 2 2
MIRT606811 BICD2 BICD cargo adaptor 2 2 2
MIRT621016 CLSTN3 calsyntenin 3 2 2
MIRT637852 PDCL3 phosducin like 3 2 2
MIRT640477 ZNF557 zinc finger protein 557 2 2
MIRT642827 LINC00346 long intergenic non-protein coding RNA 346 2 2
MIRT643887 IMP4 IMP4, U3 small nucleolar ribonucleoprotein 2 2
MIRT664874 PCNXL2 pecanex homolog 2 2 2
MIRT680528 PRIM2 DNA primase subunit 2 2 2
MIRT680648 KIAA1456 KIAA1456 2 2
MIRT680807 ZNF578 zinc finger protein 578 2 2
MIRT680921 STX2 syntaxin 2 2 2
MIRT681112 CEP57L1 centrosomal protein 57 like 1 2 2
MIRT681147 INTS7 integrator complex subunit 7 2 2
MIRT681966 TFCP2 transcription factor CP2 2 2
MIRT684316 GTF3C4 general transcription factor IIIC subunit 4 2 2
MIRT684906 GSG2 histone H3 associated protein kinase 2 2
MIRT685499 MED16 mediator complex subunit 16 2 2
MIRT685929 MOCS3 molybdenum cofactor synthesis 3 2 2
MIRT686875 SLC25A32 solute carrier family 25 member 32 2 2
MIRT688204 FNIP1 folliculin interacting protein 1 2 2
MIRT688791 CCNB1 cyclin B1 2 2
MIRT689227 RPS19 ribosomal protein S19 2 2
MIRT690470 ZNF33A zinc finger protein 33A 2 2
MIRT691982 PLCXD1 phosphatidylinositol specific phospholipase C X domain containing 1 2 2
MIRT694006 PPIL4 peptidylprolyl isomerase like 4 2 2
MIRT694529 TRIM72 tripartite motif containing 72 2 2
MIRT695420 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 2 2
MIRT695784 HSD17B12 hydroxysteroid 17-beta dehydrogenase 12 2 2
MIRT697799 UBXN2A UBX domain protein 2A 2 2
MIRT698275 TMEM2 transmembrane protein 2 2 2
MIRT698317 TMEM136 transmembrane protein 136 2 2
MIRT699971 RREB1 ras responsive element binding protein 1 2 2
MIRT700717 PNO1 partner of NOB1 homolog 2 2
MIRT701721 MTMR12 myotubularin related protein 12 2 2
MIRT701879 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT702959 HIF1A hypoxia inducible factor 1 alpha subunit 2 2
MIRT706178 ZNF716 zinc finger protein 716 2 2
MIRT706463 SPRED1 sprouty related EVH1 domain containing 1 2 2
MIRT718154 TTC33 tetratricopeptide repeat domain 33 2 2
MIRT718711 ANKRD18A ankyrin repeat domain 18A 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3160-3p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-3160-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-3160-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-3160-3p Tripterygium wilfordii Hook F resistant tissue
hsa-miR-3160-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3160-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission