pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-3160-1 |
Genomic Coordinates | chr11: 46451805 - 46451889 |
Description | Homo sapiens miR-3160-1 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
pre-miRNA | hsa-mir-3160-2 |
Genomic Coordinates | chr11: 46451807 - 46451887 |
Description | Homo sapiens miR-3160-2 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-3160-3p | ||||||||||||||||||||||||||||||
Sequence | 54| AGAGCUGAGACUAGAAAGCCCA |75 | ||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||
Experiments | Illumina | DRVs in miRNA |
|
||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | PDCL3 | ||||||||||||||||||||
Synonyms | HTPHLP, PHLP2A, PHLP3, VIAF, VIAF1 | ||||||||||||||||||||
Description | phosducin like 3 | ||||||||||||||||||||
Transcript | NM_024065 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on PDCL3 | |||||||||||||||||||||
3'UTR of PDCL3 (miRNA target sites are highlighted) |
>PDCL3|NM_024065|3'UTR 1 GGCTACAGCTTCTATCACATGCCGAACTTTCTTGTGACAAATTGTCTGGATTTTTTAAAAAAGGAAAAAGCAAGAATGAA 81 TCCTTGTGGTTTTTAGTTTTGTATAAATTATGTTTCAAATCTTTACATTTTGGAAATAATCATTGCTGGAGATTCTGTTA 161 AATATTTTGGAACTCTTTTTTTTTTTAAATTATAGTATTTCCTCTAAAAAAAATTAAAACCAGCCATTTGTATGGCAAAT 241 GTCAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293S | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084068. RNA binding protein: AGO2. Condition:CLIP_noemetine_SigmaAb
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HCT116 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177608. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_10
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
CLIP-seq Support 1 for dataset GSM1084068 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noemetine_SigmaAb |
Location of target site | ENST00000264254.6 | 3UTR | UGCUGAGGCUGGAGUGCAGUGGCACAAUCUC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
118 hsa-miR-3160-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT066658 | DYRK2 | dual specificity tyrosine phosphorylation regulated kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT075318 | SF3B3 | splicing factor 3b subunit 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT077083 | EIF1 | eukaryotic translation initiation factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT100381 | HSPA1B | heat shock protein family A (Hsp70) member 1B | ![]() |
![]() |
2 | 6 | ||||||
MIRT135259 | TMBIM6 | transmembrane BAX inhibitor motif containing 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT184913 | ZNF268 | zinc finger protein 268 | ![]() |
![]() |
2 | 2 | ||||||
MIRT218862 | CDKN1A | cyclin dependent kinase inhibitor 1A | ![]() |
![]() |
2 | 2 | ||||||
MIRT446580 | FPR2 | formyl peptide receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT448834 | FGD4 | FYVE, RhoGEF and PH domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT449455 | RNF13 | ring finger protein 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452284 | CARD8 | caspase recruitment domain family member 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452628 | FAM162A | family with sequence similarity 162 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT453454 | GLG1 | golgi glycoprotein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454188 | AP1S3 | adaptor related protein complex 1 sigma 3 subunit | ![]() |
![]() |
2 | 6 | ||||||
MIRT454434 | GTF2F1 | general transcription factor IIF subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454575 | NT5DC3 | 5'-nucleotidase domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455555 | TRAF1 | TNF receptor associated factor 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT455841 | MPL | MPL proto-oncogene, thrombopoietin receptor | ![]() |
![]() |
2 | 6 | ||||||
MIRT455969 | BCAS4 | breast carcinoma amplified sequence 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT456805 | SIGLEC14 | sialic acid binding Ig like lectin 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457320 | DUSP19 | dual specificity phosphatase 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457366 | POFUT2 | protein O-fucosyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457684 | ZNF587 | zinc finger protein 587 | ![]() |
![]() |
2 | 2 | ||||||
MIRT458158 | LYRM4 | LYR motif containing 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT458641 | SGPP2 | sphingosine-1-phosphate phosphatase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459134 | FADS6 | fatty acid desaturase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459153 | NARF | nuclear prelamin A recognition factor | ![]() |
![]() |
2 | 4 | ||||||
MIRT460460 | NOM1 | nucleolar protein with MIF4G domain 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT460974 | STK17B | serine/threonine kinase 17b | ![]() |
![]() |
2 | 2 | ||||||
MIRT461439 | ACSBG1 | acyl-CoA synthetase bubblegum family member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT461507 | NEDD4L | neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase | ![]() |
![]() |
2 | 2 | ||||||
MIRT462490 | GSR | glutathione-disulfide reductase | ![]() |
![]() |
2 | 2 | ||||||
MIRT462638 | PHF5A | PHD finger protein 5A | ![]() |
![]() |
2 | 2 | ||||||
MIRT463279 | ZFX | zinc finger protein, X-linked | ![]() |
![]() |
2 | 2 | ||||||
MIRT463360 | ZFAND4 | zinc finger AN1-type containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT465777 | TMOD3 | tropomodulin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT466143 | TMEM120B | transmembrane protein 120B | ![]() |
![]() |
2 | 2 | ||||||
MIRT468401 | SETD3 | SET domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468998 | RNPS1 | RNA binding protein with serine rich domain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471574 | PARD6B | par-6 family cell polarity regulator beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT472108 | NME2 | NME/NM23 nucleoside diphosphate kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472125 | NME1-NME2 | NME1-NME2 readthrough | ![]() |
![]() |
2 | 2 | ||||||
MIRT473020 | MRPS14 | mitochondrial ribosomal protein S14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT473083 | MORN4 | MORN repeat containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT475598 | HMGB2 | high mobility group box 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT475937 | GXYLT2 | glucoside xylosyltransferase 2 | ![]() |
![]() |
2 | 8 | ||||||
MIRT476117 | GPR157 | G protein-coupled receptor 157 | ![]() |
![]() |
2 | 2 | ||||||
MIRT476406 | GDE1 | glycerophosphodiester phosphodiesterase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT478003 | DNAL1 | dynein axonemal light chain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487969 | IQSEC2 | IQ motif and Sec7 domain 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489418 | TUBB2A | tubulin beta 2A class IIa | ![]() |
![]() |
2 | 2 | ||||||
MIRT491522 | IL10RA | interleukin 10 receptor subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT492673 | PLEC | plectin | ![]() |
![]() |
2 | 2 | ||||||
MIRT493545 | ICOSLG | inducible T-cell costimulator ligand | ![]() |
![]() |
2 | 2 | ||||||
MIRT513085 | USP9X | ubiquitin specific peptidase 9, X-linked | ![]() |
![]() |
2 | 2 | ||||||
MIRT514009 | CECR2 | CECR2, histone acetyl-lysine reader | ![]() |
![]() |
2 | 4 | ||||||
MIRT516683 | ZNF860 | zinc finger protein 860 | ![]() |
![]() |
2 | 2 | ||||||
MIRT518392 | ZNF250 | zinc finger protein 250 | ![]() |
![]() |
2 | 2 | ||||||
MIRT522683 | LUZP1 | leucine zipper protein 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT524488 | CEP97 | centrosomal protein 97 | ![]() |
![]() |
2 | 2 | ||||||
MIRT527457 | CLEC12B | C-type lectin domain family 12 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT527705 | IL17REL | interleukin 17 receptor E like | ![]() |
![]() |
2 | 2 | ||||||
MIRT531647 | C19orf52 | translocase of inner mitochondrial membrane 29 | ![]() |
![]() |
2 | 2 | ||||||
MIRT532381 | UMPS | uridine monophosphate synthetase | ![]() |
![]() |
2 | 2 | ||||||
MIRT532588 | MTHFD1 | methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533555 | TPM4 | tropomyosin 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT548371 | ENTPD5 | ectonucleoside triphosphate diphosphohydrolase 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT550250 | PVR | poliovirus receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT552555 | ZFP36L2 | ZFP36 ring finger protein like 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT554113 | SMARCE1 | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT554131 | SMARCA5 | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT561344 | ZBTB18 | zinc finger and BTB domain containing 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT561638 | RUNX3 | runt related transcription factor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT566497 | PBX2P1 | PBX homeobox 2 pseudogene 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570583 | OTUD7B | OTU deubiquitinase 7B | ![]() |
![]() |
2 | 2 | ||||||
MIRT572731 | MCTS1 | MCTS1, re-initiation and release factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT574041 | PEX26 | peroxisomal biogenesis factor 26 | ![]() |
![]() |
2 | 2 | ||||||
MIRT575231 | Fut1 | fucosyltransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT606811 | BICD2 | BICD cargo adaptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT621016 | CLSTN3 | calsyntenin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT637852 | PDCL3 | phosducin like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT640477 | ZNF557 | zinc finger protein 557 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642827 | LINC00346 | long intergenic non-protein coding RNA 346 | ![]() |
![]() |
2 | 2 | ||||||
MIRT643887 | IMP4 | IMP4, U3 small nucleolar ribonucleoprotein | ![]() |
![]() |
2 | 2 | ||||||
MIRT664874 | PCNXL2 | pecanex homolog 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT680528 | PRIM2 | DNA primase subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT680648 | KIAA1456 | KIAA1456 | ![]() |
![]() |
2 | 2 | ||||||
MIRT680807 | ZNF578 | zinc finger protein 578 | ![]() |
![]() |
2 | 2 | ||||||
MIRT680921 | STX2 | syntaxin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681112 | CEP57L1 | centrosomal protein 57 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681147 | INTS7 | integrator complex subunit 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681966 | TFCP2 | transcription factor CP2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT684316 | GTF3C4 | general transcription factor IIIC subunit 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT684906 | GSG2 | histone H3 associated protein kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT685499 | MED16 | mediator complex subunit 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT685929 | MOCS3 | molybdenum cofactor synthesis 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT686875 | SLC25A32 | solute carrier family 25 member 32 | ![]() |
![]() |
2 | 2 | ||||||
MIRT688204 | FNIP1 | folliculin interacting protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT688791 | CCNB1 | cyclin B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689227 | RPS19 | ribosomal protein S19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690470 | ZNF33A | zinc finger protein 33A | ![]() |
![]() |
2 | 2 | ||||||
MIRT691982 | PLCXD1 | phosphatidylinositol specific phospholipase C X domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT694006 | PPIL4 | peptidylprolyl isomerase like 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT694529 | TRIM72 | tripartite motif containing 72 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695420 | ADH5 | alcohol dehydrogenase 5 (class III), chi polypeptide | ![]() |
![]() |
2 | 2 | ||||||
MIRT695784 | HSD17B12 | hydroxysteroid 17-beta dehydrogenase 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT697799 | UBXN2A | UBX domain protein 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT698275 | TMEM2 | transmembrane protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT698317 | TMEM136 | transmembrane protein 136 | ![]() |
![]() |
2 | 2 | ||||||
MIRT699971 | RREB1 | ras responsive element binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700717 | PNO1 | partner of NOB1 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT701721 | MTMR12 | myotubularin related protein 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701879 | MPLKIP | M-phase specific PLK1 interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT702959 | HIF1A | hypoxia inducible factor 1 alpha subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT706178 | ZNF716 | zinc finger protein 716 | ![]() |
![]() |
2 | 2 | ||||||
MIRT706463 | SPRED1 | sprouty related EVH1 domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT718154 | TTC33 | tetratricopeptide repeat domain 33 | ![]() |
![]() |
2 | 2 | ||||||
MIRT718711 | ANKRD18A | ankyrin repeat domain 18A | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|