pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6737 |
Genomic Coordinates | chr1: 153962351 - 153962420 |
Description | Homo sapiens miR-6737 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6737-5p | |||||||||||||||||||||
Sequence | 6| UUGGGGUGGUCGGCCCUGGAG |26 | |||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||
Experiments | Meta-analysis | |||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | FGF19 | ||||||||||||||||||||
Synonyms | - | ||||||||||||||||||||
Description | fibroblast growth factor 19 | ||||||||||||||||||||
Transcript | NM_005117 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on FGF19 | |||||||||||||||||||||
3'UTR of FGF19 (miRNA target sites are highlighted) |
>FGF19|NM_005117|3'UTR 1 CTGAGACCATGCCCGGGCCTCTTCACTGCTGCCAGGGGCTGTGGTACCTGCAGCGTGGGGGACGTGCTTCTACAAGAACA 81 GTCCTGAGTCCACGTTCTGTTTAGCTTTAGGAAGAAACATCTAGAAGTTGTACATATTCAGAGTTTTCCATTGGCAGTGC 161 CAGTTTCTAGCCAATAGACTTGTCTGATCATAACATTGTAAGCCTGTAGCTTGCCCAGCTGCTGCCTGGGCCCCCATTCT 241 GCTCCCTCGAGGTTGCTGGACAAGCTGCTGCACTGTCTCAGTTCTGCTTGAATACCTCCATCGATGGGGAACTCACTTCC 321 TTTGGAAAAATTCTTATGTCAAGCTGAAATTCTCTAATTTTTTCTCATCACTTCCCCAGGAGCAGCCAGAAGACAGGCAG 401 TAGTTTTAATTTCAGGAACAGGTGATCCACTCTGTAAAACAGCAGGTAAATTTCACTCAACCCCATGTGGGAATTGATCT 481 ATATCTCTACTTCCAGGGACCATTTGCCCTTCCCAAATCCCTCCAGGCCAGAACTGACTGGAGCAGGCATGGCCCACCAG 561 GCTTCAGGAGTAGGGGAAGCCTGGAGCCCCACTCCAGCCCTGGGACAACTTGAGAATTCCCCCTGAGGCCAGTTCTGTCA 641 TGGATGCTGTCCTGAGAATAACTTGCTGTCCCGGTGTCACCTGCTTCCATCTCCCAGCCCACCAGCCCTCTGCCCACCTC 721 ACATGCCTCCCCATGGATTGGGGCCTCCCAGGCCCCCCACCTTATGTCAACCTGCACTTCTTGTTCAAAAATCAGGAAAA 801 GAAAAGATTTGAAGACCCCAAGTCTTGTCAATAACTTGCTGTGTGGAAGCAGCGGGGGAAGACCTAGAACCCTTTCCCCA 881 GCACTTGGTTTTCCAACATGATATTTATGAGTAATTTATTTTGATATGTACATCTCTTATTTTCTTACATTATTTATGCC 961 CCCAAATTATATTTATGTATGTAAGTGAGGTTTGTTTTGTATATTAAAATGGAGTTTGTTTGTAAAAAAAAAAAAAAAAA 1041 AAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293S |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb
HITS-CLIP data was present in GSM1084067. RNA binding protein: AGO2. Condition:CLIP_emetine_SantaCruzAb
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
CLIP-seq Support 1 for dataset GSM1084065 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_emetine_AbnovaAb |
Location of target site | ENST00000294312.3 | 3UTR | UCAGGAAAAGAAAAGAUUUGAAGAC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM1084067 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_emetine_SantaCruzAb |
Location of target site | ENST00000294312.3 | 3UTR | AAAAGAUUUGAAGAC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
67 hsa-miR-6737-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT066215 | MARCH9 | membrane associated ring-CH-type finger 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT074413 | TNRC6A | trinucleotide repeat containing 6A | ![]() |
![]() |
2 | 2 | ||||||
MIRT125300 | MID1IP1 | MID1 interacting protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT153951 | NCOA3 | nuclear receptor coactivator 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452776 | FAM136A | family with sequence similarity 136 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT452977 | CABP4 | calcium binding protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454128 | FOXRED2 | FAD dependent oxidoreductase domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455242 | DDX39B | DExD-box helicase 39B | ![]() |
![]() |
2 | 10 | ||||||
MIRT459007 | UQCRH | ubiquinol-cytochrome c reductase hinge protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT459463 | MUC17 | mucin 17, cell surface associated | ![]() |
![]() |
2 | 4 | ||||||
MIRT460871 | UBE2S | ubiquitin conjugating enzyme E2 S | ![]() |
![]() |
2 | 2 | ||||||
MIRT461264 | COX10 | COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT464540 | UBTF | upstream binding transcription factor, RNA polymerase I | ![]() |
![]() |
2 | 2 | ||||||
MIRT465268 | TRIM28 | tripartite motif containing 28 | ![]() |
![]() |
2 | 2 | ||||||
MIRT465871 | TMEM43 | transmembrane protein 43 | ![]() |
![]() |
2 | 4 | ||||||
MIRT466228 | TMED10 | transmembrane p24 trafficking protein 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468417 | SETD1B | SET domain containing 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT468684 | SEC22C | SEC22 homolog C, vesicle trafficking protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT473399 | MDM4 | MDM4, p53 regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT473517 | MAX | MYC associated factor X | ![]() |
![]() |
2 | 2 | ||||||
MIRT474511 | KLHDC8A | kelch domain containing 8A | ![]() |
![]() |
2 | 2 | ||||||
MIRT475801 | HDGF | heparin binding growth factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT479493 | CDH6 | cadherin 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT480770 | BMP2 | bone morphogenetic protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT481418 | ASB6 | ankyrin repeat and SOCS box containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT482966 | CSTF2 | cleavage stimulation factor subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT483380 | SPATA6 | spermatogenesis associated 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT483677 | CYP11A1 | cytochrome P450 family 11 subfamily A member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT484328 | EPN1 | epsin 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT484963 | UCK1 | uridine-cytidine kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT485908 | PGPEP1 | pyroglutamyl-peptidase I | ![]() |
![]() |
2 | 4 | ||||||
MIRT488149 | PRRC2B | proline rich coiled-coil 2B | ![]() |
![]() |
2 | 4 | ||||||
MIRT488943 | CYP2W1 | cytochrome P450 family 2 subfamily W member 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT491835 | ZBTB7A | zinc finger and BTB domain containing 7A | ![]() |
![]() |
2 | 4 | ||||||
MIRT493026 | NAA50 | N(alpha)-acetyltransferase 50, NatE catalytic subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT499374 | PLCG2 | phospholipase C gamma 2 | ![]() |
![]() |
2 | 11 | ||||||
MIRT499723 | USH1G | USH1 protein network component sans | ![]() |
![]() |
2 | 4 | ||||||
MIRT500349 | ZNF385A | zinc finger protein 385A | ![]() |
![]() |
2 | 2 | ||||||
MIRT509574 | HIST2H2AB | histone cluster 2 H2A family member b | ![]() |
![]() |
2 | 4 | ||||||
MIRT512794 | GLRX | glutaredoxin | ![]() |
![]() |
2 | 2 | ||||||
MIRT513291 | SETBP1 | SET binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT515697 | ZNF321P | zinc finger protein 321, pseudogene | ![]() |
![]() |
2 | 2 | ||||||
MIRT518255 | LEAP2 | liver enriched antimicrobial peptide 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT522026 | PAQR3 | progestin and adipoQ receptor family member 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT523169 | HIST3H3 | histone cluster 3 H3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT524036 | DNAJC8 | DnaJ heat shock protein family (Hsp40) member C8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533476 | TRIM71 | tripartite motif containing 71 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541488 | ADM | adrenomedullin | ![]() |
![]() |
2 | 2 | ||||||
MIRT553987 | SRPR | SRP receptor alpha subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT571445 | YKT6 | YKT6 v-SNARE homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT574889 | Plcg2 | phospholipase C, gamma 2 | ![]() |
![]() |
2 | 7 | ||||||
MIRT607544 | GLI2 | GLI family zinc finger 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT607688 | MAPK10 | mitogen-activated protein kinase 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT610072 | CRLF1 | cytokine receptor like factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT610573 | CACUL1 | CDK2 associated cullin domain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT614041 | THBS2 | thrombospondin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT626318 | LRTOMT | leucine rich transmembrane and O-methyltransferase domain containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT634005 | RIF1 | replication timing regulatory factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT639619 | FGF19 | fibroblast growth factor 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT647343 | RPH3AL | rabphilin 3A like (without C2 domains) | ![]() |
![]() |
2 | 2 | ||||||
MIRT689704 | ATXN2 | ataxin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691170 | APOL6 | apolipoprotein L6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693165 | NPR1 | natriuretic peptide receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711727 | NUPL2 | nucleoporin like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711806 | ELN | elastin | ![]() |
![]() |
2 | 2 | ||||||
MIRT721546 | FXN | frataxin | ![]() |
![]() |
2 | 2 | ||||||
MIRT722979 | GDE1 | glycerophosphodiester phosphodiesterase 1 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|