pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-2115 |
Genomic Coordinates | chr3: 48316360 - 48316459 |
Description | Homo sapiens miR-2115 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-2115-3p | |||||||||
Sequence | 58| CAUCAGAAUUCAUGGAGGCUAG |79 | |||||||||
Evidence | Experimental | |||||||||
Experiments | 454 | DRVs in miRNA |
|
|||||||
SNPs in miRNA |
|
|||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | DEFB118 | ||||||||||||||||||||
Synonyms | C20orf63, DEFB-18, ESC42, ESP13.6 | ||||||||||||||||||||
Description | defensin beta 118 | ||||||||||||||||||||
Transcript | NM_054112 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on DEFB118 | |||||||||||||||||||||
3'UTR of DEFB118 (miRNA target sites are highlighted) |
>DEFB118|NM_054112|3'UTR 1 CTTCCTCTCGGCTATCACTCACCCCTGTCCTCAGAGTGATAAACTAAGTCACATACAGATAAAGCACTGAAAACACCACA 81 GTGACCCTCCCACCCCCCACCAATATGTAATTCTATTAATAGAAACAGCTGTGTAAAGAAGTCTAAAATTTTCACTATTT 161 CCAATGATAAACTCTTCAGTGCTCTTCTTGAAATGTCACATTATTTCCACAACAAGTTATAACCTATTTTTAGTATTTCT 241 TGTTTGCTAGTGACCTATGCACAACTTCAATAGCTTAGTTAGCTATTCCAACAACAATTTCTTCATGTATCGTTCTGTCT 321 TCTCAACAGCTGTCTTCATGGCAGCATAAGTGGTCATGATCAAAATTCTAAATCTTTGCATCTGTGAGAGTAGCTACTAT 401 GACACTAAAAGCTTTTTTTCTAGAACAGGAGACACTTCAGGTGAAAGCATTCATTCTCCTACTAACTATGGCCTTGGAGC 481 CAGGTTTTATCTCTCACTGTAGGAAATTGGCCGCCCCAGGTGTGAGCTATGAAGACTCCTTTTTGCCCCAGTGGCTTTGG 561 GGTTGAAATGCTGTCGAAAAGCTTTTATGGCTCTGTAGACCCATCTTTTTGACCAAGCCTTGATCACACATGGACATCCA 641 AGGGTAATCATGGACCCCCAATTGTGGGTGAAAGGATGGATCATTTATCTACCTGATTACTGAGAGCTTTATTTGTCTCC 721 CTCTGATAGCAAAAAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293S |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084066. RNA binding protein: AGO2. Condition:CLIP_noemetine_SantaCruzAb
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Cardiac Tissues |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM2202479. RNA binding protein: AGO2. Condition:S4_LV_29yo_Male_AGO2_bound_RNA
HITS-CLIP data was present in GSM2202476. RNA binding protein: AGO2. Condition:S1_LV_54yo_Male_AGO2_bound_RNA
... - Spengler RM; Zhang X; Cheng C; McLendon JM; et al., 2016, Nucleic acids research. |
Article |
Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP.
- Spengler RM; Zhang X; Cheng C; McLendon JM; et al.- Nucleic acids research, 2016
MicroRNAs (miRs) have emerged as key biological effectors in human health and disease. These small noncoding RNAs are incorporated into Argonaute (Ago) proteins, where they direct post-transcriptional gene silencing via base-pairing with target transcripts. Although miRs have become intriguing biological entities and attractive therapeutic targets, the translational impacts of miR research remain limited by a paucity of empirical miR targeting data, particularly in human primary tissues. Here, to improve our understanding of the diverse roles miRs play in cardiovascular function and disease, we applied high-throughput methods to globally profile miR:target interactions in human heart tissues. We deciphered Ago2:RNA interactions using crosslinking immunoprecipitation coupled with high-throughput sequencing (HITS-CLIP) to generate the first transcriptome-wide map of miR targeting events in human myocardium, detecting 4000 cardiac Ago2 binding sites across >2200 target transcripts. Our initial exploration of this interactome revealed an abundance of miR target sites in gene coding regions, including several sites pointing to new miR-29 functions in regulating cardiomyocyte calcium, growth and metabolism. Also, we uncovered several clinically-relevant interactions involving common genetic variants that alter miR targeting events in cardiomyopathy-associated genes. Overall, these data provide a critical resource for bolstering translational miR research in heart, and likely beyond.
LinkOut: [PMID: 27418678]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Liver Tissue |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM2550618. RNA binding protein: AGO2. Condition:Patient 1 Tumor 1
... - Luna JM; Barajas JM; Teng KY; Sun HL; Moore et al., 2017, Molecular cell. |
Article |
- Luna JM; Barajas JM; Teng KY; Sun HL; Moore et al. - Molecular cell, 2017
MicroRNA-122, an abundant and conserved liver-specific miRNA, regulates hepatic metabolism and functions as a tumor suppressor, yet systematic and direct biochemical elucidation of the miR-122 target network remains incomplete. To this end, we performed Argonaute crosslinking immunoprecipitation (Argonaute [Ago]-CLIP) sequencing in miR-122 knockout and control mouse livers, as well as in matched human hepatocellular carcinoma (HCC) and benign liver tissue to identify miRNA target sites transcriptome-wide in two species. We observed a majority of miR-122 binding on 3' UTRs and coding exons followed by extensive binding to other genic and non-genic sites. Motif analysis of miR-122-dependent binding revealed a G-bulged motif in addition to canonical motifs. A large number of miR-122 targets were found to be species specific. Upregulation of several common mouse and human targets, most notably BCL9, predicted survival in HCC patients. These results broadly define the molecular consequences of miR-122 downregulation in hepatocellular carcinoma.
LinkOut: [PMID: 28735896]
|
CLIP-seq Support 1 for dataset GSM1084066 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noemetine_SantaCruzAb |
Location of target site | ENST00000253381.2 | 3UTR | GAUAGCAAAAAAAAAAAAAAAAAA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
80 hsa-miR-2115-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT057089 | DDIT4 | DNA damage inducible transcript 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT071216 | FCF1 | FCF1, rRNA-processing protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT226901 | RAD23B | RAD23 homolog B, nucleotide excision repair protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT235961 | BACH1 | BTB domain and CNC homolog 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT294569 | ZNF460 | zinc finger protein 460 | ![]() |
![]() |
2 | 4 | ||||||
MIRT321046 | RAC1 | Rac family small GTPase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT359666 | NUS1 | NUS1 dehydrodolichyl diphosphate synthase subunit | ![]() |
![]() |
2 | 8 | ||||||
MIRT366451 | KLHL15 | kelch like family member 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT405375 | ZBTB18 | zinc finger and BTB domain containing 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT441794 | TCEAL5 | transcription elongation factor A like 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443295 | TCEAL3 | transcription elongation factor A like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455275 | DDX39B | DExD-box helicase 39B | ![]() |
![]() |
2 | 2 | ||||||
MIRT458523 | C5orf22 | chromosome 5 open reading frame 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT464960 | TWIST1 | twist family bHLH transcription factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT466848 | STX6 | syntaxin 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT469252 | RHOB | ras homolog family member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT469825 | RAB14 | RAB14, member RAS oncogene family | ![]() |
![]() |
2 | 4 | ||||||
MIRT470047 | PTGFRN | prostaglandin F2 receptor inhibitor | ![]() |
![]() |
2 | 2 | ||||||
MIRT471420 | PDP2 | pyruvate dehyrogenase phosphatase catalytic subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472024 | NPM1 | nucleophosmin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT484156 | CENPN | centromere protein N | ![]() |
![]() |
2 | 2 | ||||||
MIRT485490 | HMGN2 | high mobility group nucleosomal binding domain 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490462 | PROSER2 | proline and serine rich 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493069 | MTCH1 | mitochondrial carrier 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493573 | HSP90AA1 | heat shock protein 90 alpha family class A member 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT494919 | NDUFC2-KCTD14 | NDUFC2-KCTD14 readthrough | ![]() |
![]() |
2 | 2 | ||||||
MIRT500439 | ZMAT3 | zinc finger matrin-type 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT500931 | SRPR | SRP receptor alpha subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT501551 | POC1B-GALNT4 | POC1B-GALNT4 readthrough | ![]() |
![]() |
2 | 2 | ||||||
MIRT501809 | NEURL1B | neuralized E3 ubiquitin protein ligase 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT502415 | GALNT4 | polypeptide N-acetylgalactosaminyltransferase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT506504 | MSANTD4 | Myb/SANT DNA binding domain containing 4 with coiled-coils | ![]() |
![]() |
2 | 2 | ||||||
MIRT507861 | CCNE2 | cyclin E2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT510511 | YOD1 | YOD1 deubiquitinase | ![]() |
![]() |
2 | 6 | ||||||
MIRT516073 | RAB42 | RAB42, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT519030 | KYNU | kynureninase | ![]() |
![]() |
2 | 6 | ||||||
MIRT521762 | PPIL1 | peptidylprolyl isomerase like 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT522898 | KCNJ3 | potassium voltage-gated channel subfamily J member 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT527370 | MGARP | mitochondria localized glutamic acid rich protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT530691 | C8orf46 | chromosome 8 open reading frame 46 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530867 | TRUB1 | TruB pseudouridine synthase family member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531832 | MTPAP | mitochondrial poly(A) polymerase | ![]() |
![]() |
2 | 4 | ||||||
MIRT533035 | ZBTB5 | zinc finger and BTB domain containing 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533165 | WIPF2 | WAS/WASL interacting protein family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533464 | TRIM71 | tripartite motif containing 71 | ![]() |
![]() |
2 | 2 | ||||||
MIRT534331 | SHCBP1 | SHC binding and spindle associated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539372 | ADSS | adenylosuccinate synthase | ![]() |
![]() |
2 | 6 | ||||||
MIRT545951 | ZBTB10 | zinc finger and BTB domain containing 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT553283 | TSR1 | TSR1, ribosome maturation factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT553532 | TMEM185B | transmembrane protein 185B | ![]() |
![]() |
2 | 4 | ||||||
MIRT556480 | LIPA | lipase A, lysosomal acid type | ![]() |
![]() |
2 | 2 | ||||||
MIRT556975 | HSPA4L | heat shock protein family A (Hsp70) member 4 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT557697 | GATA6 | GATA binding protein 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT558901 | CCDC58 | coiled-coil domain containing 58 | ![]() |
![]() |
2 | 2 | ||||||
MIRT559224 | BLMH | bleomycin hydrolase | ![]() |
![]() |
2 | 2 | ||||||
MIRT559827 | SLPI | secretory leukocyte peptidase inhibitor | ![]() |
![]() |
2 | 2 | ||||||
MIRT563435 | SLC3A2 | solute carrier family 3 member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569270 | PCDH11X | protocadherin 11 X-linked | ![]() |
![]() |
2 | 2 | ||||||
MIRT571386 | JKAMP | JNK1/MAPK8-associated membrane protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT572567 | AFF1 | AF4/FMR2 family member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT610400 | AR | androgen receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT611058 | ZNF621 | zinc finger protein 621 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635118 | TMEM233 | transmembrane protein 233 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641617 | DEFB118 | defensin beta 118 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642146 | CHORDC1 | cysteine and histidine rich domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT647295 | C8orf33 | chromosome 8 open reading frame 33 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648155 | MPLKIP | M-phase specific PLK1 interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT652780 | TENM3 | teneurin transmembrane protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT657356 | HNRNPA2B1 | heterogeneous nuclear ribonucleoprotein A2/B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT658718 | ELN | elastin | ![]() |
![]() |
2 | 2 | ||||||
MIRT662441 | RALGAPA1 | Ral GTPase activating protein catalytic alpha subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665302 | ZBTB38 | zinc finger and BTB domain containing 38 | ![]() |
![]() |
2 | 2 | ||||||
MIRT699898 | RUNX1 | runt related transcription factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700921 | PDS5A | PDS5 cohesin associated factor A | ![]() |
![]() |
2 | 2 | ||||||
MIRT700992 | PDE3A | phosphodiesterase 3A | ![]() |
![]() |
2 | 2 | ||||||
MIRT707397 | DCAF4L1 | DDB1 and CUL4 associated factor 4 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711895 | INSIG2 | insulin induced gene 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712072 | XRCC5 | X-ray repair cross complementing 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT716121 | PTPLAD2 | 3-hydroxyacyl-CoA dehydratase 4 | ![]() |
1 | 1 | |||||||
MIRT724470 | SMAD2 | SMAD family member 2 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|