pre-miRNA Information
pre-miRNA hsa-mir-1185-1   
Genomic Coordinates chr14: 101042977 - 101043062
Synonyms MIRN1185-1, hsa-mir-1185-1, MIR1185-1
Description Homo sapiens miR-1185-1 stem-loop
Comment This sequence was proposed as a miRNA candidate by Berezikov et al by RAKE analysis .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-1185-1-3p
Sequence 53| AUAUACAGGGGGAGACUCUUAU |74
Evidence Not_experimental
Experiments
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 5 14 + 101043033 29233923 MiREDiBase
A-to-I 7 14 + 101043035 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs749794228 1 dbSNP
rs369414498 4 dbSNP
rs771096180 5 dbSNP
rs774958411 7 dbSNP
rs1226171972 11 dbSNP
rs1449899083 14 dbSNP
rs761183893 16 dbSNP
rs1380874583 20 dbSNP
rs771625921 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RUVBL2   
Synonyms CGI-46, ECP-51, ECP51, INO80J, REPTIN, RVB2, TAP54-beta, TIH2, TIP48, TIP49B
Description RuvB like AAA ATPase 2
Transcript NM_006666   
Expression
Putative miRNA Targets on RUVBL2
3'UTR of RUVBL2
(miRNA target sites are highlighted)
>RUVBL2|NM_006666|3'UTR
   1 GTTGGATGTCATCCCCCGACCCCACCCTGTTTTCCACCAGAGTTCTGACACTGTGACTCTGTATAAAATGGTTGGGAAGC
  81 TGCACCCACCCTGTGTATGTGTGGTTGCCCTGAGCCCACAGAAAGACACCTCCAGAGTGCGGATTGAGAAGCC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' uaUUCUCAGAGGGGGACAUAUa 5'
            :| | | |  |:||||||| 
Target 5' ctGACACTGTGACTCTGTATAa 3'
45 - 66 152.00 -9.60
2
miRNA  3' uaUUCUCAGAGG--GGGACAUAUa 5'
            |||   | ||  ||||||:|| 
Target 5' ggAAGCTGCACCCACCCTGTGTAt 3'
75 - 98 142.00 -16.60
3
miRNA  3' uauucuCAGAGG-GGGACAUAua 5'
                | | || |||||| |  
Target 5' tcccccGACCCCACCCTGTTTtc 3'
12 - 34 104.00 -11.86
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30161272 16 COSMIC
COSN30468266 18 COSMIC
COSN31512799 86 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs761406558 5 dbSNP
rs765025780 8 dbSNP
rs558017198 15 dbSNP
rs758255007 16 dbSNP
rs780045417 18 dbSNP
rs111564806 19 dbSNP
rs1362552454 20 dbSNP
rs756253228 22 dbSNP
rs778081352 24 dbSNP
rs1347529536 25 dbSNP
rs1208483675 26 dbSNP
rs1445886626 28 dbSNP
rs1262971127 35 dbSNP
rs749272679 39 dbSNP
rs1204605772 42 dbSNP
rs1246322321 43 dbSNP
rs201570299 47 dbSNP
rs1270435415 48 dbSNP
rs944338805 50 dbSNP
rs373012966 51 dbSNP
rs779287504 52 dbSNP
rs746428805 53 dbSNP
rs1334862284 56 dbSNP
rs1236542216 57 dbSNP
rs1198107021 68 dbSNP
rs764859975 69 dbSNP
rs533700885 83 dbSNP
rs113453475 86 dbSNP
rs1234418663 98 dbSNP
rs1251114000 98 dbSNP
rs903471820 99 dbSNP
rs1301493688 107 dbSNP
rs569880835 108 dbSNP
rs775870202 109 dbSNP
rs747407636 110 dbSNP
rs1454292330 111 dbSNP
rs768146510 115 dbSNP
rs762509063 116 dbSNP
rs761161758 126 dbSNP
rs764860251 127 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000601968.1 | 3UTR | AAAAUGGUUGGGAAGCUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000601968.1 | 3UTR | UAAAAUGGUUGGGAAGCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
114 hsa-miR-1185-1-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT066415 TBK1 TANK binding kinase 1 2 4
MIRT073567 NR2F2 nuclear receptor subfamily 2 group F member 2 2 2
MIRT074516 USP1 ubiquitin specific peptidase 1 2 4
MIRT080576 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 6
MIRT086539 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 2
MIRT086547 MOB4 MOB family member 4, phocein 2 2
MIRT088684 EML4 echinoderm microtubule associated protein like 4 2 4
MIRT090811 MBNL1 muscleblind like splicing regulator 1 2 4
MIRT095500 PURA purine rich element binding protein A 2 2
MIRT109530 KLHL15 kelch like family member 15 2 6
MIRT109807 ZFX zinc finger protein, X-linked 2 2
MIRT117888 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT120273 GSK3B glycogen synthase kinase 3 beta 2 4
MIRT149892 LDLR low density lipoprotein receptor 2 2
MIRT178475 LCOR ligand dependent nuclear receptor corepressor 2 4
MIRT193445 RORA RAR related orphan receptor A 2 2
MIRT198527 DSG2 desmoglein 2 2 2
MIRT226427 TP53INP1 tumor protein p53 inducible nuclear protein 1 2 2
MIRT227669 SET SET nuclear proto-oncogene 2 2
MIRT320405 HOXA9 homeobox A9 2 2
MIRT407774 MRPL35 mitochondrial ribosomal protein L35 2 2
MIRT439228 ZMIZ1 zinc finger MIZ-type containing 1 1 1
MIRT439312 VAT1L vesicle amine transport 1 like 1 1
MIRT439421 TMOD1 tropomodulin 1 1 1
MIRT439446 TMEM104 transmembrane protein 104 1 1
MIRT439524 STIM2 stromal interaction molecule 2 1 1
MIRT439612 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 1
MIRT439997 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT440017 PCSK1 proprotein convertase subtilisin/kexin type 1 1 1
MIRT440131 NCOA4 nuclear receptor coactivator 4 1 1
MIRT440311 LRRC1 leucine rich repeat containing 1 1 1
MIRT440475 IAPP islet amyloid polypeptide 1 1
MIRT440511 HERC2 HECT and RLD domain containing E3 ubiquitin protein ligase 2 1 1
MIRT440617 FOXA2 forkhead box A2 1 1
MIRT440666 FBXL16 F-box and leucine rich repeat protein 16 1 1
MIRT440705 ERO1LB endoplasmic reticulum oxidoreductase 1 beta 1 1
MIRT441007 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT441018 CAND1 cullin associated and neddylation dissociated 1 1 1
MIRT441062 C1orf43 chromosome 1 open reading frame 43 1 1
MIRT441209 ARCN1 archain 1 1 1
MIRT449461 HAT1 histone acetyltransferase 1 2 2
MIRT467104 SRI sorcin 2 2
MIRT468060 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 10
MIRT468476 SESN3 sestrin 3 2 4
MIRT473533 MAX MYC associated factor X 2 2
MIRT473852 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT474711 KIF13A kinesin family member 13A 2 6
MIRT481665 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 2 2
MIRT485120 SF3B3 splicing factor 3b subunit 3 2 2
MIRT493055 MTFR1 mitochondrial fission regulator 1 2 2
MIRT504258 C1orf147 chromosome 1 open reading frame 147 2 4
MIRT504361 ARID1B AT-rich interaction domain 1B 2 4
MIRT505748 SENP1 SUMO1/sentrin specific peptidase 1 2 8
MIRT506298 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 2 6
MIRT508442 ZNF608 zinc finger protein 608 2 4
MIRT512782 COL4A3BP collagen type IV alpha 3 binding protein 2 2
MIRT520447 TSPAN2 tetraspanin 2 2 4
MIRT522133 NRBF2 nuclear receptor binding factor 2 2 6
MIRT522395 MYADM myeloid associated differentiation marker 2 4
MIRT523397 GRIK3 glutamate ionotropic receptor kainate type subunit 3 2 4
MIRT523938 E2F8 E2F transcription factor 8 2 4
MIRT524349 CREB1 cAMP responsive element binding protein 1 2 2
MIRT524711 BRMS1L breast cancer metastasis-suppressor 1 like 2 4
MIRT525134 ZNF256 zinc finger protein 256 2 2
MIRT525710 DCAF12L2 DDB1 and CUL4 associated factor 12 like 2 2 2
MIRT531264 PPIL3 peptidylprolyl isomerase like 3 2 2
MIRT538844 BTG1 BTG anti-proliferation factor 1 2 2
MIRT541366 CDKN1B cyclin dependent kinase inhibitor 1B 2 2
MIRT542093 KCNK10 potassium two pore domain channel subfamily K member 10 2 6
MIRT543770 RBM12B RNA binding motif protein 12B 2 4
MIRT543940 NCOA7 nuclear receptor coactivator 7 2 2
MIRT545150 GABRG1 gamma-aminobutyric acid type A receptor gamma1 subunit 2 2
MIRT545842 ZNF264 zinc finger protein 264 2 4
MIRT548057 GOLGA7 golgin A7 2 2
MIRT549242 ATXN1L ataxin 1 like 2 4
MIRT551829 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 2 2
MIRT552484 ZNF136 zinc finger protein 136 2 2
MIRT553663 TGFBR2 transforming growth factor beta receptor 2 2 2
MIRT554988 RAB39B RAB39B, member RAS oncogene family 2 2
MIRT555760 PCTP phosphatidylcholine transfer protein 2 2
MIRT556923 IRF2BP2 interferon regulatory factor 2 binding protein 2 2 4
MIRT564991 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT566458 PGGT1B protein geranylgeranyltransferase type I subunit beta 2 2
MIRT566538 PANK3 pantothenate kinase 3 2 2
MIRT567732 DLX2 distal-less homeobox 2 2 2
MIRT570081 KANSL1L KAT8 regulatory NSL complex subunit 1 like 2 2
MIRT571735 RNF11 ring finger protein 11 2 2
MIRT573529 MDM2 MDM2 proto-oncogene 2 2
MIRT574459 RPS16 ribosomal protein S16 2 2
MIRT574992 Phka1 phosphorylase kinase alpha 1 2 3
MIRT576349 Pxdn peroxidasin 2 2
MIRT610196 CD99 CD99 molecule (Xg blood group) 2 4
MIRT612920 GPRIN3 GPRIN family member 3 2 2
MIRT615021 DUSP6 dual specificity phosphatase 6 2 2
MIRT623573 IRS1 insulin receptor substrate 1 2 2
MIRT624437 CASD1 CAS1 domain containing 1 2 2
MIRT628714 ZNF585A zinc finger protein 585A 2 2
MIRT639565 PCK1 phosphoenolpyruvate carboxykinase 1 2 4
MIRT641485 POLA2 DNA polymerase alpha 2, accessory subunit 2 2
MIRT641657 PAPOLG poly(A) polymerase gamma 2 2
MIRT642210 RUVBL2 RuvB like AAA ATPase 2 2 2
MIRT653010 STX7 syntaxin 7 2 2
MIRT656130 MSH6 mutS homolog 6 2 2
MIRT656893 KIAA2018 upstream transcription factor family member 3 2 2
MIRT660130 BRPF3 bromodomain and PHD finger containing 3 2 2
MIRT660855 AFAP1 actin filament associated protein 1 2 2
MIRT676843 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 3
MIRT681473 DIP2A disco interacting protein 2 homolog A 2 2
MIRT682253 RS1 retinoschisin 1 2 2
MIRT694296 COPB2 coatomer protein complex subunit beta 2 2 2
MIRT694401 ALDH1A3 aldehyde dehydrogenase 1 family member A3 2 2
MIRT705277 BACH1 BTB domain and CNC homolog 1 2 2
MIRT720833 C1orf52 chromosome 1 open reading frame 52 2 2
MIRT735713 SIRT1 sirtuin 1 2 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-1185-1 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-1185-1 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-1185-1-3p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-1185-1-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-1185-1-3p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-1185-1-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-1185-1-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-1185-1-3p Palbociclib 5330286 NSC758247 approved resistant cell line (T47D)
hsa-miR-1185-1-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-1185-1-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-1185-1-3p Prednisone/Azathioprine/Methotrexate/Cyclophosphamide/Mycophenolate mofetil sensitive tissue (myasthenia gravis)
hsa-miR-1185-1-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-1185-1-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-1185-1-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-1185-1-3p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-1185-1-3p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-1185-1-3p Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-1185-1-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-1185-1-3p Gemcitabine 60750 NSC613327 approved resistant cell line (MDA-231)
hsa-miR-1185-1-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-1185-1-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-1185-1-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-1185-1-3p Cisplatin 5460033 NSC119875 approved resistant cell line (TOV-112D)

Error report submission