miRTarBase - #MIRT645861


—
pre-miRNA Information
pre-miRNA hsa-mir-6501   
Genomic Coordinates chr21: 33550662 - 33550728
Description Homo sapiens miR-6501 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6501-5p
Sequence 3| AGUUGCCAGGGCUGCCUUUGGU |24
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
1055619 20 ClinVar
COSM5974214 5 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs756127353 5 dbSNP
rs764400023 6 dbSNP
rs753967693 8 dbSNP
rs1283296362 14 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GBP6   
Synonyms -
Description guanylate binding protein family member 6
Transcript NM_198460   
Expression
Putative miRNA Targets on GBP6
3'UTR of GBP6
(miRNA target sites are highlighted)		 
>GBP6|NM_198460|3'UTR
   1 GGATATTATAGATTGTACATATATGCTTTGGACTATTTTTGATCTGTATGTTTTTCATTTTCATTCAGCAAGTTTTTTTT
  81 TTTTTTCAGAGTCTTACTCTGTTGCCCAGGCTGGAGTACAGTGGTGCAATCTCAGCTCACTGCAACCTCTGCCTCCTGGG
 161 TTCAAGAGATTCACCTGCCTCAGCCCCCTAGTAGCTGGGATTATAGGTGTACACCACCACACCCAGCTAATTTTTGTATT
 241 TTTAGTAGAGATGGGGTTTCACTATGTTGGCCAGGCTGGTCTCGAACTCTTGACCTCAAATGATCCACCCGCCTCGGCCT
 321 CCCAAAGTGCTGGGTTTACAGGCATGAGCCACCATGCCCAGCCCTCATTTAGCAAAGTTTTAAACATAAAAAGTGCTTAT
 401 TAGAGGATATCAGTGCCTGGCCCACATGAGAGAACAGATCCATACACACTTTGAAAAACTTTGTTCACTTTTAGGAAATA
 481 TAATTTTGAAAAATCATTTACATACAAGAGGTCCACTGAGGCATTGCTTTTAATGGCAAAATATTGCAATGTACTTGAAT
 561 GTCCTTCACATTAGATTGGTAAGATAAATTTTAGTATGTGCATGTACTGGAATATTATATAGCCAGTAAACAAATTGACA
 641 ATGAAGCTCTATTTGTACCAGTAAAGAATGGTCTTGAAGAGACATTGTAAAATGAAAAAAAAAAAAACCAAGTTGTAAAG
 721 CAATGTAGATTATCTTATCAGCATGGAAAAAATGCAATTATTATATGGAAGCATGCAAATATATCTCTGGAAAGATTAAT
 801 CAAAATCTATTATTATTGGCTCCTTCTGGGAAGAACCAAGTGAATGTAGGGGTTGAAGGAACACATACTCTTCACTTTAT
 881 ACTCTTGAATTTTGTAAAGAAATCTTATTTTACCGATTCAGAAATAAATAAGAAAATGTAAGAGACAATGCTAATAATGA
 961 TAACAATAAAAAAATAGTGAAATTGGCTATCAGATGATGAAATTCCTTGTTGCTTCTAGGAATTACATCAGCCAGCCCAA
1041 TGAGGGGTCTAAGACTAAGATCTGAGTACTAGAATGCAAAAAATTTGCATCATATTCTTGTTTTCATTTTGGCCTGGTTT
1121 TTCGATCCCTTCTATTTGTTTCGAGACTAAGGCATACACTTTTCTGTGGCCTTTGAAATCTCAGCTACAGTAGCCTCTAC
1201 TTCCTTTCTCTGAATTCAAGTTTTAAGGTGTTAGAAGCATAAATTACCAAACATTAAGATTAAGCACTGATAGGAAGGAT
1281 CCTGCCAACCTTGTCAGTAGTGGTCTTTTTGCGGTAGCCTCAGATAGAAAGGACAATGTGCCTTTCCAGAACTGAACCCC
1361 CTGATGGGGGATGATAGACCCAGACACATAGAGGCCTGGTGTTGACCCTTAATTGTTAGAATCTAAGAAGATTCAGTTAT
1441 AGTAATGAGTGGCAGACTGCAAGGCCTGATGGAGATAATTCTGAAGATGGTCAATACAATGGACCAGCCATAGGGTTAAA
1521 TGGGATGGGGAGAAAACAATCAAGTGAAGTAAATGCTGTCTATCAGGATGTTGAGAGGTAGCCCTGATAAAGTGTCACAT
1601 CCATAGCCTTGATCTGAGCTAATTTCAGACCCTGAACTCAGTTGGAGTGGAGGGCAGTACCCCAGGAAAGGACACTGCAA
1681 CTCCAGGACCCAAATAAATGATAATGATTTCCCAAGTTCTCCTCCTAGGAAACGTCTGGAGCCATTTACTAGATATCCAT
1761 ATACTAGGGAAATACAAACACCCAAATATTTCAAGGACCCTTGGAATCAGGATCCAAGTTGCCCATGGTACCTAGATCAT
1841 GGAGAGTCATCGTAAAATGCCTGTTAAAATAGGGAATTAGGGCCTCCAGGTTGTAATTATAGTCTTGGCACACATGAACT
1921 TATTGCAATATAGTATTTGTTTGAAATGTAAAGGTAAAGTTTGTTTGAAGACAGATACCTTATTTTTCTGTACATCTCCT
2001 TGGGAGTATGTTCAGGCATAGGTTGTGCTAAATAAGCTTCTTTTATAAAAACAATAGGCTGATGCATGGGTGATTATTTT
2081 CAATTGATAAAATATCATGAACTTTCCAGAGATCAGTGGTAATAAGTTGTTTGAATTTTCGACACCAGATTAAGGTCTCT
2161 GAGGTGGTTTAAAGGCTATGAGGCCAGGTGCAGTGGCTCACGCCTATAATCTCAGCAACTTGGGAGGCCGAAGCAGGCAG
2241 ATCACTTGAGGTCAGAAGTTTGAGACCAGCCTGGCCAACATGGCGAAACCCTGCCTTTACTAAAAATACAAAAATTAACC
2321 AAGTGTGGTGGCACACGCCTGTCATGCCAGCTACACAGGAGGATGAGGCAGGAAAATCACTTGAACCTGGGAGGTGGAGG
2401 TTGCAGTGAGCCGAGATTGTGCCATTGCACTCCAGCCCGGGCAACAGAGCCTGGGCGACAGAGTGAGGCTCTGTCTCAAA
2481 AAATTAAACTAAATTAAAGCTATGAGAAGAAAATAAATTTTCCTGGTATAGTGTCCTTCTCTAGACCTCATGTCCTACAG
2561 TCTCTGTGAAACTGGGCCAAAGATAGAATTTTTTTTTCTGTGCTTTATACAGTGACTCAGACAAACCTATGACCTCACAC
2641 AAATCTGTAACTTCATGTATCACAGTCTCTATAAAACTATATCAAAGAAAG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugguuuccGUCGGGACCGUUGa 5'
                  |||||| |||||| 
Target 5' ttgcactcCAGCCCGGGCAACa 3'
 2425 - 2446 138.00 -19.90
2 
miRNA  3' ugGUUUCCGU--CGGG----ACCGUUga 5'
            | :|||||  ||::    ||||||  
Target 5' caCTGAGGCATTGCTTTTAATGGCAAaa 3'
 514 - 541 136.00 -13.80
3 
miRNA  3' uggUUUCCGUC--GGGACCGUUGa 5'
             | ||| ||  :|||| |||| 
Target 5' ctgATAGGAAGGATCCTGCCAACc 3'
 1267 - 1290 133.00 -15.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30494317 10 COSMIC
COSN30131234 42 COSMIC
COSN30462171 57 COSMIC
COSN30486961 63 COSMIC
COSN20121434 85 COSMIC
COSN20095020 87 COSMIC
COSN24690445 88 COSMIC
COSN30026193 352 COSMIC
COSN5379115 511 COSMIC
COSN15827309 769 COSMIC
COSN32056859 870 COSMIC
COSN14941110 947 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1209234632 2 dbSNP
rs553010466 3 dbSNP
rs574968072 6 dbSNP
rs1206394053 7 dbSNP
rs1246997519 8 dbSNP
rs1461530915 10 dbSNP
rs776076864 14 dbSNP
rs1366276173 15 dbSNP
rs759050983 16 dbSNP
rs376434444 17 dbSNP
rs752402555 18 dbSNP
rs758204851 19 dbSNP
rs371113368 22 dbSNP
rs1320348500 23 dbSNP
rs376414968 24 dbSNP
rs751496578 26 dbSNP
rs866980043 27 dbSNP
rs1454832253 33 dbSNP
rs1229522288 36 dbSNP
rs1376419114 36 dbSNP
rs965992901 42 dbSNP
rs1442548959 43 dbSNP
rs563845603 44 dbSNP
rs781313220 49 dbSNP
rs1243900852 50 dbSNP
rs1408272573 68 dbSNP
rs531236846 70 dbSNP
rs1181479118 73 dbSNP
rs1411772242 73 dbSNP
rs1483478036 73 dbSNP
rs370789372 73 dbSNP
rs371623293 73 dbSNP
rs386367605 73 dbSNP
rs386367606 73 dbSNP
rs878935942 73 dbSNP
rs1254286922 77 dbSNP
rs532401995 83 dbSNP
rs1203380360 85 dbSNP
rs71954362 85 dbSNP
rs1247534701 88 dbSNP
rs1247671711 89 dbSNP
rs59650926 90 dbSNP
rs1264269433 94 dbSNP
rs1356073977 96 dbSNP
rs1206377972 97 dbSNP
rs1252048650 98 dbSNP
rs768461821 99 dbSNP
rs1483809237 100 dbSNP
rs1179587208 102 dbSNP
rs1249130649 110 dbSNP
rs546480861 122 dbSNP
rs1423958167 123 dbSNP
rs921421225 125 dbSNP
rs1295186455 127 dbSNP
rs564365943 127 dbSNP
rs1366699676 130 dbSNP
rs1456377278 134 dbSNP
rs528480686 143 dbSNP
rs984206373 144 dbSNP
rs774137733 146 dbSNP
rs1349252555 157 dbSNP
rs370799614 170 dbSNP
rs568523374 174 dbSNP
rs1037415990 175 dbSNP
rs1414448081 176 dbSNP
rs1168951379 179 dbSNP
rs1472448717 182 dbSNP
rs1268551577 186 dbSNP
rs921441019 189 dbSNP
rs895754729 192 dbSNP
rs1487768894 198 dbSNP
rs1427994777 199 dbSNP
rs949992614 200 dbSNP
rs1297823126 201 dbSNP
rs765326614 210 dbSNP
rs1265848189 213 dbSNP
rs750531015 219 dbSNP
rs529311676 232 dbSNP
rs113009875 237 dbSNP
rs1051699709 238 dbSNP
rs1355323086 243 dbSNP
rs1384895005 247 dbSNP
rs1366743092 256 dbSNP
rs1289430052 265 dbSNP
rs548003290 266 dbSNP
rs1390971905 271 dbSNP
rs1157184707 273 dbSNP
rs555615963 284 dbSNP
rs1201375482 285 dbSNP
rs1229826231 295 dbSNP
rs1277152149 301 dbSNP
rs957761781 308 dbSNP
rs1340485689 309 dbSNP
rs181545699 311 dbSNP
rs1032732716 312 dbSNP
rs1250470739 316 dbSNP
rs137963587 317 dbSNP
rs1037047451 320 dbSNP
rs1009925326 328 dbSNP
rs1257403080 331 dbSNP
rs1230720755 333 dbSNP
rs995591428 357 dbSNP
rs1023013351 374 dbSNP
rs1298198207 375 dbSNP
rs1437247032 386 dbSNP
rs558805437 394 dbSNP
rs1362967997 406 dbSNP
rs1253506068 407 dbSNP
rs1434468164 408 dbSNP
rs1403108429 409 dbSNP
rs570380902 411 dbSNP
rs1464855589 414 dbSNP
rs1377462465 422 dbSNP
rs1019008482 428 dbSNP
rs114705730 429 dbSNP
rs977402030 431 dbSNP
rs1442513311 432 dbSNP
rs1257827441 433 dbSNP
rs960626728 438 dbSNP
rs1482791473 439 dbSNP
rs1275021157 442 dbSNP
rs1230374570 450 dbSNP
rs1360014303 453 dbSNP
rs1467619765 456 dbSNP
rs111900084 459 dbSNP
rs185957801 461 dbSNP
rs1296800078 465 dbSNP
rs1301123572 479 dbSNP
rs1028535735 480 dbSNP
rs142072072 495 dbSNP
rs984258654 509 dbSNP
rs909986195 510 dbSNP
rs1436378329 515 dbSNP
rs940081353 520 dbSNP
rs972785479 525 dbSNP
rs979059368 529 dbSNP
rs917228414 532 dbSNP
rs1432025167 535 dbSNP
rs537447201 542 dbSNP
rs1044705618 566 dbSNP
rs780438977 567 dbSNP
rs1472820624 571 dbSNP
rs1312375262 578 dbSNP
rs1369742057 581 dbSNP
rs935851061 585 dbSNP
rs932375770 603 dbSNP
rs1235701778 604 dbSNP
rs1206956699 622 dbSNP
rs1481983485 626 dbSNP
rs12760699 642 dbSNP
rs987014714 658 dbSNP
rs76197787 659 dbSNP
rs541901327 661 dbSNP
rs1242744187 667 dbSNP
rs1354988558 671 dbSNP
rs1209269253 688 dbSNP
rs1249880351 689 dbSNP
rs12760843 690 dbSNP
rs1447407680 692 dbSNP
rs1010388481 693 dbSNP
rs1185754015 694 dbSNP
rs1160879090 695 dbSNP
rs1328739589 695 dbSNP
rs779199744 695 dbSNP
rs557599731 698 dbSNP
rs1195571540 700 dbSNP
rs1412235920 704 dbSNP
rs1183983266 708 dbSNP
rs1425646910 709 dbSNP
rs1040075078 710 dbSNP
rs190710917 711 dbSNP
rs1428678566 713 dbSNP
rs1453216416 718 dbSNP
rs931334587 731 dbSNP
rs1457891078 747 dbSNP
rs901504255 752 dbSNP
rs1348883842 753 dbSNP
rs1279293583 755 dbSNP
rs1437631903 760 dbSNP
rs905969165 768 dbSNP
rs1003342410 774 dbSNP
rs995821171 775 dbSNP
rs1322208413 779 dbSNP
rs1460462274 785 dbSNP
rs546229582 786 dbSNP
rs1160897777 802 dbSNP
rs1455273636 803 dbSNP
rs1406835145 814 dbSNP
rs1028591393 828 dbSNP
rs954253593 829 dbSNP
rs1478896494 840 dbSNP
rs1323115349 843 dbSNP
rs896286635 847 dbSNP
rs1387146002 848 dbSNP
rs1468068019 855 dbSNP
rs1005746559 865 dbSNP
rs1017099194 866 dbSNP
rs564775791 867 dbSNP
rs1327251181 882 dbSNP
rs1283840514 883 dbSNP
rs1220162647 886 dbSNP
rs1020862340 887 dbSNP
rs528507463 895 dbSNP
rs973224523 903 dbSNP
rs967936800 905 dbSNP
rs979145680 912 dbSNP
rs1370205116 914 dbSNP
rs116592952 915 dbSNP
rs576883977 916 dbSNP
rs1176414554 923 dbSNP
rs1415961436 927 dbSNP
rs1322194640 939 dbSNP
rs980045729 941 dbSNP
rs1269906849 942 dbSNP
rs927234054 944 dbSNP
rs1391951905 962 dbSNP
rs561512627 976 dbSNP
rs935904993 977 dbSNP
rs1241739184 978 dbSNP
rs1054246468 979 dbSNP
rs780941350 984 dbSNP
rs1276888447 994 dbSNP
rs1234060188 999 dbSNP
rs529349207 1010 dbSNP
rs972886996 1016 dbSNP
rs1300466741 1030 dbSNP
rs1225528876 1032 dbSNP
rs1360748801 1034 dbSNP
rs183208209 1042 dbSNP
rs945857413 1043 dbSNP
rs1449844127 1056 dbSNP
rs187208998 1057 dbSNP
rs530616526 1063 dbSNP
rs920212142 1067 dbSNP
rs769611162 1070 dbSNP
rs1430178183 1079 dbSNP
rs931534172 1081 dbSNP
rs552222539 1085 dbSNP
rs996261985 1088 dbSNP
rs1166712468 1092 dbSNP
rs1426779586 1095 dbSNP
rs1418955888 1101 dbSNP
rs1182542933 1115 dbSNP
rs1189681442 1117 dbSNP
rs570740107 1118 dbSNP
rs927265425 1119 dbSNP
rs374700135 1124 dbSNP
rs777333259 1125 dbSNP
rs1277396407 1127 dbSNP
rs1203689912 1130 dbSNP
rs4658148 1143 dbSNP
rs1400572167 1144 dbSNP
rs1017151540 1154 dbSNP
rs770848941 1160 dbSNP
rs1166109765 1184 dbSNP
rs559147859 1191 dbSNP
rs1292355011 1194 dbSNP
rs1410201877 1210 dbSNP
rs1372220717 1218 dbSNP
rs546579891 1229 dbSNP
rs1461377165 1235 dbSNP
rs1350430386 1239 dbSNP
rs113504501 1247 dbSNP
rs1024824876 1253 dbSNP
rs1042185616 1253 dbSNP
rs971483954 1256 dbSNP
rs903810569 1266 dbSNP
rs980098124 1275 dbSNP
rs927286598 1276 dbSNP
rs1300883936 1279 dbSNP
rs957318482 1297 dbSNP
rs1254482692 1299 dbSNP
rs764375614 1309 dbSNP
rs990024093 1313 dbSNP
rs145908791 1314 dbSNP
rs1289628758 1322 dbSNP
rs913110585 1335 dbSNP
rs945882803 1340 dbSNP
rs1040183783 1341 dbSNP
rs1347939577 1349 dbSNP
rs1223077167 1354 dbSNP
rs1351973219 1357 dbSNP
rs923037282 1357 dbSNP
rs1007985033 1359 dbSNP
rs1019406128 1362 dbSNP
rs1295283282 1362 dbSNP
rs557091847 1380 dbSNP
rs961111607 1381 dbSNP
rs575940901 1382 dbSNP
rs6669782 1383 dbSNP
rs558032382 1385 dbSNP
rs953011402 1386 dbSNP
rs980723756 1394 dbSNP
rs17130793 1396 dbSNP
rs1418916242 1398 dbSNP
rs1268660903 1409 dbSNP
rs182765714 1411 dbSNP
rs561755438 1412 dbSNP
rs897377318 1420 dbSNP
rs762015146 1423 dbSNP
rs1024461440 1429 dbSNP
rs1200960284 1433 dbSNP
rs188184223 1438 dbSNP
rs1208842526 1442 dbSNP
rs745971302 1444 dbSNP
rs907312819 1445 dbSNP
rs1330693259 1450 dbSNP
rs138871034 1451 dbSNP
rs1416655135 1453 dbSNP
rs1034353513 1456 dbSNP
rs765431719 1479 dbSNP
rs117142190 1481 dbSNP
rs1303281867 1487 dbSNP
rs7526896 1492 dbSNP
rs1020637567 1498 dbSNP
rs552371120 1500 dbSNP
rs944649188 1504 dbSNP
rs1371584406 1521 dbSNP
rs562395281 1524 dbSNP
rs7526910 1527 dbSNP
rs546571080 1528 dbSNP
rs1378623318 1529 dbSNP
rs1050073933 1530 dbSNP
rs931756804 1532 dbSNP
rs142877914 1539 dbSNP
rs1188587535 1546 dbSNP
rs1259190329 1554 dbSNP
rs1465899941 1554 dbSNP
rs535421849 1557 dbSNP
rs908926765 1568 dbSNP
rs191836309 1571 dbSNP
rs1243709586 1572 dbSNP
rs1231808134 1595 dbSNP
rs993896047 1599 dbSNP
rs755590099 1600 dbSNP
rs1298305466 1617 dbSNP
rs1229195475 1631 dbSNP
rs1342609061 1641 dbSNP
rs1381807591 1649 dbSNP
rs1036006179 1653 dbSNP
rs1207550277 1658 dbSNP
rs1433270921 1676 dbSNP
rs952959123 1678 dbSNP
rs1169826032 1679 dbSNP
rs980288863 1681 dbSNP
rs568987552 1687 dbSNP
rs367616041 1701 dbSNP
rs539131019 1707 dbSNP
rs1046357794 1709 dbSNP
rs1423960859 1713 dbSNP
rs1257868119 1718 dbSNP
rs1437295795 1722 dbSNP
rs1208440893 1727 dbSNP
rs907365887 1729 dbSNP
rs1393878384 1730 dbSNP
rs546079284 1734 dbSNP
rs564181108 1735 dbSNP
rs1034405878 1743 dbSNP
rs573314875 1750 dbSNP
rs1341243320 1760 dbSNP
rs1295400326 1765 dbSNP
rs7513174 1776 dbSNP
rs1020269939 1778 dbSNP
rs1355296458 1791 dbSNP
rs1309157680 1797 dbSNP
rs946152821 1799 dbSNP
rs182593746 1806 dbSNP
rs967733360 1810 dbSNP
rs976020748 1811 dbSNP
rs1166763819 1813 dbSNP
rs1458017246 1823 dbSNP
rs1369811964 1828 dbSNP
rs1185442615 1832 dbSNP
rs1030621322 1836 dbSNP
rs753181656 1837 dbSNP
rs546839963 1838 dbSNP
rs1435968239 1845 dbSNP
rs1272230494 1851 dbSNP
rs555637232 1852 dbSNP
rs908982376 1853 dbSNP
rs865931920 1858 dbSNP
rs573724841 1860 dbSNP
rs1049577333 1867 dbSNP
rs889722756 1872 dbSNP
rs1289300386 1874 dbSNP
rs972171267 1878 dbSNP
rs1444848599 1882 dbSNP
rs748768903 1884 dbSNP
rs1409041136 1889 dbSNP
rs943954146 1890 dbSNP
rs1386843942 1894 dbSNP
rs544215067 1905 dbSNP
rs770382526 1917 dbSNP
rs993927460 1922 dbSNP
rs1161043920 1923 dbSNP
rs556111427 1932 dbSNP
rs187277085 1935 dbSNP
rs1026772083 1948 dbSNP
rs1452236267 1951 dbSNP
rs888203139 1957 dbSNP
rs529072395 1958 dbSNP
rs1034511528 1973 dbSNP
rs1055869298 1977 dbSNP
rs893249663 1979 dbSNP
rs192109827 1985 dbSNP
rs1225803675 1991 dbSNP
rs1349071564 1996 dbSNP
rs960583037 2004 dbSNP
rs564348791 2027 dbSNP
rs993018081 2038 dbSNP
rs1323264521 2041 dbSNP
rs1020244008 2044 dbSNP
rs1338941038 2048 dbSNP
rs1011652665 2049 dbSNP
rs1319925505 2053 dbSNP
rs745771354 2076 dbSNP
rs903184743 2082 dbSNP
rs528272920 2085 dbSNP
rs1407051852 2086 dbSNP
rs997889464 2089 dbSNP
rs1030259957 2090 dbSNP
rs549049734 2094 dbSNP
rs540564316 2095 dbSNP
rs926066579 2111 dbSNP
rs569133663 2114 dbSNP
rs953250748 2119 dbSNP
rs147018119 2127 dbSNP
rs1218288032 2129 dbSNP
rs1249241065 2130 dbSNP
rs1445513724 2132 dbSNP
rs1283923159 2133 dbSNP
rs1201420796 2138 dbSNP
rs148066218 2141 dbSNP
rs7535441 2142 dbSNP
rs7525249 2148 dbSNP
rs1271556270 2155 dbSNP
rs918962935 2156 dbSNP
rs970428107 2165 dbSNP
rs1474842325 2174 dbSNP
rs1172803141 2180 dbSNP
rs1334516645 2182 dbSNP
rs1040949764 2183 dbSNP
rs897068137 2184 dbSNP
rs1173009703 2189 dbSNP
rs1335982068 2193 dbSNP
rs1420248060 2194 dbSNP
rs1188367310 2202 dbSNP
rs1389343869 2203 dbSNP
rs1437232163 2218 dbSNP
rs533055134 2220 dbSNP
rs1188653021 2223 dbSNP
rs150827848 2224 dbSNP
rs928910246 2230 dbSNP
rs568340203 2235 dbSNP
rs1343513654 2242 dbSNP
rs1274414526 2243 dbSNP
rs1234151810 2259 dbSNP
rs1276899425 2262 dbSNP
rs888223662 2266 dbSNP
rs1284471219 2268 dbSNP
rs1321488363 2270 dbSNP
rs937580601 2271 dbSNP
rs1001265406 2274 dbSNP
rs567100461 2275 dbSNP
rs867764306 2285 dbSNP
rs1977667 2286 dbSNP
rs1408328768 2295 dbSNP
rs1041813347 2296 dbSNP
rs185529662 2306 dbSNP
rs1476383388 2311 dbSNP
rs997543756 2319 dbSNP
rs1187683652 2324 dbSNP
rs1481221706 2325 dbSNP
rs1020525475 2328 dbSNP
rs142903604 2337 dbSNP
rs553937580 2338 dbSNP
rs889067283 2342 dbSNP
rs1007474738 2352 dbSNP
rs760471876 2358 dbSNP
rs963248608 2359 dbSNP
rs766004658 2362 dbSNP
rs993705861 2370 dbSNP
rs1026078821 2373 dbSNP
rs1412098604 2385 dbSNP
rs146119573 2391 dbSNP
rs981828176 2392 dbSNP
rs976579603 2393 dbSNP
rs1272109446 2394 dbSNP
rs1415994472 2400 dbSNP
rs1383966500 2413 dbSNP
rs1420100418 2414 dbSNP
rs1410755875 2420 dbSNP
rs371642743 2426 dbSNP
rs763617916 2434 dbSNP
rs926282601 2439 dbSNP
rs140146474 2440 dbSNP
rs773337076 2444 dbSNP
rs1215058700 2451 dbSNP
rs376216270 2457 dbSNP
rs190554122 2458 dbSNP
rs1228748548 2476 dbSNP
rs1318573140 2489 dbSNP
rs546037353 2504 dbSNP
rs192639573 2523 dbSNP
rs545528447 2526 dbSNP
rs1223086525 2539 dbSNP
rs977967891 2540 dbSNP
rs553950215 2545 dbSNP
rs1443221466 2552 dbSNP
rs924742320 2563 dbSNP
rs937090710 2572 dbSNP
rs1055513425 2574 dbSNP
rs1157383359 2575 dbSNP
rs74741808 2576 dbSNP
rs1014411838 2577 dbSNP
rs74100526 2579 dbSNP
rs1452077298 2585 dbSNP
rs1205416235 2587 dbSNP
rs889118299 2587 dbSNP
rs1357465649 2588 dbSNP
rs1214842882 2589 dbSNP
rs903473746 2589 dbSNP
rs1348438565 2590 dbSNP
rs1000374744 2593 dbSNP
rs1236545132 2600 dbSNP
rs143877192 2601 dbSNP
rs1302933052 2603 dbSNP
rs1037632973 2609 dbSNP
rs1382928402 2613 dbSNP
rs953371874 2617 dbSNP
rs1007966188 2623 dbSNP
rs1198259619 2636 dbSNP
rs1251825863 2644 dbSNP
rs1376561855 2649 dbSNP
rs1211094500 2654 dbSNP
rs766345556 2657 dbSNP
rs1176153156 2662 dbSNP
rs1432314229 2666 dbSNP
rs1019069275 2672 dbSNP
rs899051154 2680 dbSNP
rs145850040 2684 dbSNP
rs1026550249 2692 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uggUUUCCGUCGGGACCGUUGa 5'
             | ||  ||||: |||:|| 
Target 5' --aACAG--AGCCUGGGCGACa 3'
 		1 - 18
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000370456.4 | 3UTR | AACAGAGCCUGGGCGACAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
167 hsa-miR-6501-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT156859 FAM126B family with sequence similarity 126 member B 2 2
MIRT173355 TP53INP1 tumor protein p53 inducible nuclear protein 1 2 2
MIRT369102 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT442037 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT442829 AZIN1 antizyme inhibitor 1 2 2
MIRT443729 CCND2 cyclin D2 2 2
MIRT453771 NUCB1 nucleobindin 1 2 10
MIRT453875 IFRD1 interferon related developmental regulator 1 2 12
MIRT454229 OSBPL10 oxysterol binding protein like 10 2 11
MIRT458829 RPUSD2 RNA pseudouridylate synthase domain containing 2 2 2
MIRT459898 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 10
MIRT464162 VMP1 vacuole membrane protein 1 2 15
MIRT495411 SMAD2 SMAD family member 2 2 2
MIRT496906 TRIM56 tripartite motif containing 56 2 2
MIRT498653 AP3B2 adaptor related protein complex 3 beta 2 subunit 2 6
MIRT498706 PGAM5 PGAM family member 5, mitochondrial serine/threonine protein phosphatase 2 10
MIRT499308 ZNF485 zinc finger protein 485 2 6
MIRT499707 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 2 10
MIRT499755 CIRH1A UTP4, small subunit processome component 2 6
MIRT499827 PCSK9 proprotein convertase subtilisin/kexin type 9 2 8
MIRT503691 MAVS mitochondrial antiviral signaling protein 2 2
MIRT512418 LAYN layilin 2 4
MIRT516232 RAB3B RAB3B, member RAS oncogene family 2 2
MIRT522554 MCAM melanoma cell adhesion molecule 2 4
MIRT523760 FBXO27 F-box protein 27 2 4
MIRT525107 PRKD2 protein kinase D2 2 2
MIRT525919 KIAA0391 KIAA0391 2 2
MIRT527246 COMMD6 COMM domain containing 6 2 2
MIRT527564 ADCY7 adenylate cyclase 7 2 2
MIRT528764 CD1D CD1d molecule 2 2
MIRT529362 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 4
MIRT529464 ZNF546 zinc finger protein 546 2 2
MIRT530676 CHRNB1 cholinergic receptor nicotinic beta 1 subunit 2 4
MIRT531635 C19orf52 translocase of inner mitochondrial membrane 29 2 4
MIRT531909 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT532172 SEC14L5 SEC14 like lipid binding 5 2 4
MIRT534234 SLC25A16 solute carrier family 25 member 16 2 4
MIRT534561 RRAGD Ras related GTP binding D 2 2
MIRT534971 PSD3 pleckstrin and Sec7 domain containing 3 2 2
MIRT536738 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT538544 CELF1 CUGBP Elav-like family member 1 2 2
MIRT540462 ZNF71 zinc finger protein 71 2 2
MIRT540554 PPIC peptidylprolyl isomerase C 2 2
MIRT543593 KIAA1549 KIAA1549 2 2
MIRT543963 RNF20 ring finger protein 20 2 2
MIRT544047 C9orf64 chromosome 9 open reading frame 64 2 2
MIRT544670 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT550665 TRAF1 TNF receptor associated factor 1 2 2
MIRT558540 CSNK1G3 casein kinase 1 gamma 3 2 4
MIRT574917 Vmp1 vacuole membrane protein 1 2 9
MIRT575298 Osbpl10 oxysterol binding protein-like 10 2 7
MIRT607960 SNX22 sorting nexin 22 2 2
MIRT610649 TIPRL TOR signaling pathway regulator 2 8
MIRT615899 GATAD1 GATA zinc finger domain containing 1 2 2
MIRT617438 CCS copper chaperone for superoxide dismutase 2 2
MIRT617510 C5orf45 MRN complex interacting protein 2 2
MIRT617548 MTO1 mitochondrial tRNA translation optimization 1 2 2
MIRT620565 WBSCR27 methyltransferase like 27 2 2
MIRT623166 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT624161 DGKE diacylglycerol kinase epsilon 2 2
MIRT626090 MKLN1 muskelin 1 2 2
MIRT627010 FIG4 FIG4 phosphoinositide 5-phosphatase 2 2
MIRT627073 SF3A1 splicing factor 3a subunit 1 2 2
MIRT627136 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT627340 TSHZ2 teashirt zinc finger homeobox 2 2 2
MIRT627436 TAS2R5 taste 2 receptor member 5 2 2
MIRT628273 CYB5D1 cytochrome b5 domain containing 1 2 2
MIRT629091 F2RL1 F2R like trypsin receptor 1 2 4
MIRT629282 UNC13A unc-13 homolog A 2 2
MIRT630122 ARHGEF5 Rho guanine nucleotide exchange factor 5 2 2
MIRT630247 SMTNL2 smoothelin like 2 2 2
MIRT631260 CENPM centromere protein M 2 2
MIRT631336 CD300E CD300e molecule 2 2
MIRT631399 IL2RA interleukin 2 receptor subunit alpha 2 2
MIRT632593 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT632991 DUSP18 dual specificity phosphatase 18 2 2
MIRT633079 CXorf21 chromosome X open reading frame 21 2 2
MIRT634223 TMEM132B transmembrane protein 132B 2 2
MIRT635046 MYH11 myosin heavy chain 11 2 2
MIRT636444 LRCH3 leucine rich repeats and calponin homology domain containing 3 2 2
MIRT636649 CDK4 cyclin dependent kinase 4 2 2
MIRT637129 BAMBI BMP and activin membrane bound inhibitor 2 2
MIRT637282 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT637527 RGS9BP regulator of G protein signaling 9 binding protein 2 2
MIRT637783 OLA1 Obg like ATPase 1 2 2
MIRT637920 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT638238 SLC1A5 solute carrier family 1 member 5 2 2
MIRT638444 PLXDC2 plexin domain containing 2 2 2
MIRT639765 GPR45 G protein-coupled receptor 45 2 2
MIRT640437 ERVMER34-1 endogenous retrovirus group MER34 member 1, envelope 2 2
MIRT643006 ZNF829 zinc finger protein 829 2 2
MIRT644233 SLC35E3 solute carrier family 35 member E3 2 2
MIRT644661 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT644957 ATP6AP1L ATPase H+ transporting accessory protein 1 like 2 2
MIRT645086 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT645256 DFFA DNA fragmentation factor subunit alpha 2 2
MIRT645861 GBP6 guanylate binding protein family member 6 2 2
MIRT645987 ACP6 acid phosphatase 6, lysophosphatidic 2 2
MIRT646502 FAM217B family with sequence similarity 217 member B 2 2
MIRT646811 COX19 COX19, cytochrome c oxidase assembly factor 2 2
MIRT647706 NFX1 nuclear transcription factor, X-box binding 1 2 2
MIRT649657 TEP1 telomerase associated protein 1 2 2
MIRT650550 YIPF4 Yip1 domain family member 4 2 2
MIRT650785 GSR glutathione-disulfide reductase 2 2
MIRT651461 XIAP X-linked inhibitor of apoptosis 2 2
MIRT652098 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT654117 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT658901 DPY19L4 dpy-19 like 4 2 2
MIRT659370 CREG2 cellular repressor of E1A stimulated genes 2 2 2
MIRT662537 MTAP methylthioadenosine phosphorylase 2 2
MIRT662617 MCM8 minichromosome maintenance 8 homologous recombination repair factor 2 2
MIRT663491 IYD iodotyrosine deiodinase 2 2
MIRT663899 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT664552 MKI67IP nucleolar protein interacting with the FHA domain of MKI67 1 1
MIRT664582 HSD17B12 hydroxysteroid 17-beta dehydrogenase 12 2 2
MIRT664953 PTCD3 pentatricopeptide repeat domain 3 2 2
MIRT665193 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 2 2
MIRT665446 WDR17 WD repeat domain 17 2 2
MIRT665894 TCEANC2 transcription elongation factor A N-terminal and central domain containing 2 2 2
MIRT666480 SBNO1 strawberry notch homolog 1 2 2
MIRT666514 RNF170 ring finger protein 170 2 2
MIRT666692 RBM23 RNA binding motif protein 23 2 2
MIRT666791 PSMD1 proteasome 26S subunit, non-ATPase 1 2 2
MIRT667453 MAPK14 mitogen-activated protein kinase 14 2 2
MIRT667553 LRAT lecithin retinol acyltransferase 2 4
MIRT667744 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT668080 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT668114 GK5 glycerol kinase 5 (putative) 2 2
MIRT668501 ESYT2 extended synaptotagmin 2 2 2
MIRT668942 CNKSR3 CNKSR family member 3 2 2
MIRT670408 ELP2 elongator acetyltransferase complex subunit 2 2 2
MIRT671134 CD226 CD226 molecule 2 2
MIRT671919 PLEKHS1 pleckstrin homology domain containing S1 2 4
MIRT672287 GP2 glycoprotein 2 2 2
MIRT672427 POLR2D RNA polymerase II subunit D 2 2
MIRT672762 UBE2V2 ubiquitin conjugating enzyme E2 V2 2 2
MIRT672923 LRRC2 leucine rich repeat containing 2 2 2
MIRT673150 C1orf50 chromosome 1 open reading frame 50 2 2
MIRT673309 UBE2G2 ubiquitin conjugating enzyme E2 G2 2 2
MIRT673560 PLA2G16 phospholipase A2 group XVI 2 2
MIRT673895 DCTN6 dynactin subunit 6 2 2
MIRT674513 PRR23A proline rich 23A 2 2
MIRT674614 RBBP4 RB binding protein 4, chromatin remodeling factor 2 2
MIRT674747 SLC16A1 solute carrier family 16 member 1 2 2
MIRT675693 PIWIL1 piwi like RNA-mediated gene silencing 1 2 2
MIRT675890 SNAP29 synaptosome associated protein 29 2 2
MIRT685271 KIAA1143 KIAA1143 2 2
MIRT686057 KCNA7 potassium voltage-gated channel subfamily A member 7 2 2
MIRT693886 C3orf62 chromosome 3 open reading frame 62 2 2
MIRT695594 TMEM199 transmembrane protein 199 2 2
MIRT696592 ORMDL2 ORMDL sphingolipid biosynthesis regulator 2 2 2
MIRT698041 TRPM7 transient receptor potential cation channel subfamily M member 7 2 2
MIRT699907 RUNDC1 RUN domain containing 1 2 2
MIRT706608 CYB5B cytochrome b5 type B 2 2
MIRT706628 PNPT1 polyribonucleotide nucleotidyltransferase 1 2 2
MIRT706640 NCBP2 nuclear cap binding protein subunit 2 2 2
MIRT706676 COL13A1 collagen type XIII alpha 1 chain 2 2
MIRT706723 RFK riboflavin kinase 2 2
MIRT706857 MAFF MAF bZIP transcription factor F 2 2
MIRT706891 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 2 2
MIRT706958 FANCC Fanconi anemia complementation group C 2 2
MIRT706976 XPO5 exportin 5 2 2
MIRT707010 RRP36 ribosomal RNA processing 36 2 2
MIRT707028 ACTR5 ARP5 actin related protein 5 homolog 2 2
MIRT707068 MED29 mediator complex subunit 29 2 2
MIRT713253 ZFP30 ZFP30 zinc finger protein 2 2
MIRT719130 NR2F6 nuclear receptor subfamily 2 group F member 6 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-6501 Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-6501 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-6501-5p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-6501-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-6501-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-6501-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-6501-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-6501-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-6501-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-6501-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-6501-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-6501-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)

Error report submission