pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-378g |
Genomic Coordinates | chr1: 94745860 - 94745900 |
Description | Homo sapiens miR-378g stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | |
---|---|
Mature miRNA | hsa-miR-378g |
Sequence | 2| ACUGGGCUUGGAGUCAGAAG |21 |
Evidence | Experimental |
Experiments | Illumina |
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | MGST3 | ||||||||||||||||||||
Synonyms | GST-III | ||||||||||||||||||||
Description | microsomal glutathione S-transferase 3 | ||||||||||||||||||||
Transcript | NM_004528 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on MGST3 | |||||||||||||||||||||
3'UTR of MGST3 (miRNA target sites are highlighted) |
>MGST3|NM_004528|3'UTR 1 AGAATTATAGGGGTTTAAAAACTCTCATTCATTTTAAATGACTTACCTTTATTTCCAGTTACATTTTTTTTCTAAATATA 81 ATAAAAACTTACCTGGCATCAGCCTCATACCTAAAACTCCTGACTCTTACCACTCATTTCCGTTTGAGTCTGTATCTGAA 161 ATCAGTAGCCTAGTCCTACTAGATGAGAAAGGAGCCACAAGTATTGTGCCCTCTCCTCACCCTTCCAGCAGATGCTTCTG 241 TAGTATGTGAGGTTGAGAAAAAGTCTGATTGTGGTGATGTAGGTATAGTCATGCCACAGTGATGAAAAATTAAAGAAAAA 321 TCTTCTAGCTCTCAGGATATGCATTATCACTTGCTACAGATACTCCAAGGCCAAAGGAATGCTTGAGCCTAAAAGTTCAA 401 GACCAGCCTGGGCAACATAGCAAAACCCCATCTCTACAAAAAAATATACAACAGTTAGCCAGGCATGATGGCACATGTCT 481 GCAGTCCCAGCTACTTGGGAGGCTAAGGTGGGAGGATCACTTGAGCCCAGGGTGTCAAGGCTGCAGTGAGTTATGATCAC 561 ACTGCTGCACTCCAGCGTGGGTGACAGAGCAAGACCCTGTCTCAAATAAATAAAAATTAAGTTTCTATTAAAAAAAAAAA 641 A Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293S |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
CLIP-seq Support 1 for dataset GSM4903836 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / 124_TD_21_a |
Location of target site | NM_004528 | 3UTR | GUGGGAGGAUCACUUGAGCCCAGG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM4903837 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / 124_TD_21_b |
Location of target site | NM_004528 | 3UTR | CUUGGGAGGCUAAGGUGGGAGGAUCACUUGAGCCCAGG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM4903838 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / 124_TD_21_c |
Location of target site | NM_004528 | 3UTR | ACUUGGGAGGCUAAGGUGGGAGGAUCACUUGAGCCCAGG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM1084065 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_emetine_AbnovaAb |
Location of target site | ENST00000367889.3 | 3UTR | CUAAGGUGGGAGGAUCACUUGAGC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
68 hsa-miR-378g Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT444739 | SMYD1 | SET and MYND domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT456104 | VAV3 | vav guanine nucleotide exchange factor 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT458683 | MRI1 | methylthioribose-1-phosphate isomerase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT465802 | TMEM91 | transmembrane protein 91 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470843 | PLXND1 | plexin D1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT497263 | GRK6 | G protein-coupled receptor kinase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT497674 | SYNGR1 | synaptogyrin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498218 | TLN2 | talin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498309 | BCL11B | B-cell CLL/lymphoma 11B | ![]() |
![]() |
2 | 2 | ||||||
MIRT504046 | TOMM5 | translocase of outer mitochondrial membrane 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT518196 | CLEC4E | C-type lectin domain family 4 member E | ![]() |
![]() |
2 | 2 | ||||||
MIRT533143 | WNT10A | Wnt family member 10A | ![]() |
![]() |
2 | 2 | ||||||
MIRT533540 | TPR | translocated promoter region, nuclear basket protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT533679 | TMEM86A | transmembrane protein 86A | ![]() |
![]() |
2 | 2 | ||||||
MIRT540892 | SRSF9 | serine and arginine rich splicing factor 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541329 | G3BP1 | G3BP stress granule assembly factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541850 | PLIN5 | perilipin 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT551431 | F2 | coagulation factor II, thrombin | ![]() |
![]() |
2 | 2 | ||||||
MIRT552105 | PPP1R1A | protein phosphatase 1 regulatory inhibitor subunit 1A | ![]() |
![]() |
2 | 2 | ||||||
MIRT564912 | YTHDF1 | YTH N6-methyladenosine RNA binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568605 | ACVR2A | activin A receptor type 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT572604 | PAPLN | papilin, proteoglycan like sulfated glycoprotein | ![]() |
![]() |
2 | 2 | ||||||
MIRT574234 | DMRT2 | doublesex and mab-3 related transcription factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT575688 | Map1b | microtubule-associated protein 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT576643 | Mill2 | MHC I like leukocyte 2 | ![]() |
1 | 1 | |||||||
MIRT609877 | RAD54L2 | RAD54 like 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT610057 | MYBPC1 | myosin binding protein C, slow type | ![]() |
![]() |
2 | 2 | ||||||
MIRT610791 | KLK2 | kallikrein related peptidase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617175 | GOSR2 | golgi SNAP receptor complex member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617707 | RUSC2 | RUN and SH3 domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT620577 | WBSCR27 | methyltransferase like 27 | ![]() |
![]() |
2 | 4 | ||||||
MIRT622657 | POU2F3 | POU class 2 homeobox 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT624561 | BDP1 | B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB | ![]() |
![]() |
2 | 2 | ||||||
MIRT634255 | TIAL1 | TIA1 cytotoxic granule associated RNA binding protein like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT634677 | GDE1 | glycerophosphodiester phosphodiesterase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635254 | FBXL20 | F-box and leucine rich repeat protein 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT637081 | SELPLG | selectin P ligand | ![]() |
![]() |
2 | 2 | ||||||
MIRT639021 | AAK1 | AP2 associated kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT640396 | ZNF785 | zinc finger protein 785 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642441 | CLUAP1 | clusterin associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT645666 | ADK | adenosine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT646083 | MGST3 | microsomal glutathione S-transferase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650513 | UFM1 | ubiquitin fold modifier 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT652474 | TMEM181 | transmembrane protein 181 | ![]() |
![]() |
2 | 2 | ||||||
MIRT652584 | TIMM8A | translocase of inner mitochondrial membrane 8A | ![]() |
![]() |
2 | 2 | ||||||
MIRT654763 | PRKAR2A | protein kinase cAMP-dependent type II regulatory subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT655200 | PHAX | phosphorylated adaptor for RNA export | ![]() |
![]() |
2 | 2 | ||||||
MIRT658353 | FAM65B | RHO family interacting cell polarization regulator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT661820 | PRPSAP1 | phosphoribosyl pyrophosphate synthetase associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662190 | MEI1 | meiotic double-stranded break formation protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT664375 | CYB5A | cytochrome b5 type A | ![]() |
![]() |
2 | 2 | ||||||
MIRT665025 | ELK1 | ELK1, ETS transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT666492 | SBNO1 | strawberry notch homolog 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT668480 | EXOSC2 | exosome component 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682768 | TMEM120B | transmembrane protein 120B | ![]() |
![]() |
2 | 2 | ||||||
MIRT689628 | NAA30 | N(alpha)-acetyltransferase 30, NatC catalytic subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT691846 | OSCAR | osteoclast associated, immunoglobulin-like receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT696490 | COX6B1 | cytochrome c oxidase subunit 6B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712480 | FSTL3 | follistatin like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712780 | ZNF154 | zinc finger protein 154 | ![]() |
![]() |
2 | 2 | ||||||
MIRT716607 | MPPED1 | metallophosphoesterase domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT719357 | ITPKB | inositol-trisphosphate 3-kinase B | ![]() |
![]() |
2 | 2 | ||||||
MIRT719739 | SLC39A11 | solute carrier family 39 member 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT722569 | C1orf95 | stum, mechanosensory transduction mediator homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT722838 | C17orf102 | chromosome 17 open reading frame 102 | ![]() |
![]() |
2 | 2 | ||||||
MIRT733138 | LINC00963 | long intergenic non-protein coding RNA 963 | ![]() |
![]() |
![]() |
3 | 0 | |||||
MIRT733139 | CHI3L1 | chitinase 3 like 1 | ![]() |
![]() |
![]() |
3 | 0 | |||||
MIRT736944 | TARBP2 | TARBP2, RISC loading complex RNA binding subunit | ![]() |
![]() |
2 | 0 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|