pre-miRNA Information
pre-miRNA hsa-mir-412   
Genomic Coordinates chr14: 101065447 - 101065537
Synonyms MIRN412, hsa-mir-412, MIR412
Description Homo sapiens miR-412 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-412-3p
Sequence 54| ACUUCACCUGGUCCACUAGCCGU |76
Evidence Not_experimental
Experiments
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
rs61992671 18 GWAS
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs369997462 1 dbSNP
rs1439693090 7 dbSNP
rs1301668924 11 dbSNP
rs534204576 13 dbSNP
rs775386036 14 dbSNP
rs762832140 15 dbSNP
rs1203323285 16 dbSNP
rs61992671 18 dbSNP
rs1022012324 19 dbSNP
rs1207609936 20 dbSNP
rs139967426 21 dbSNP
rs539487075 22 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol LTF   
Synonyms GIG12, HEL110, HLF2, LF
Description lactotransferrin
Transcript NM_002343   
Expression
Putative miRNA Targets on LTF
3'UTR of LTF
(miRNA target sites are highlighted)
>LTF|NM_002343|3'UTR
   1 AACCGAAGAAGATGGCCCAGCTCCCCAAGAAAGCCTCAGCCATTCACTGCCCCCAGCTCTTCTCCCCAGGTGTGTTGGGG
  81 CCTTGGCCTCCCCTGCTGAAGGTGGGGATTGCCCATCCATCTGCTTACAATTCCCTGCTGTCGTCTTAGCAAGAAGTAAA
 161 ATGAGAAATTTTGTTGATATTCTCTCCTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ugccGAUCACCUGGUCCACUUCa 5'
              ||: | ||  |||||::| 
Target 5' tcccCTGCT-GA--AGGTGGGGa 3'
89 - 108 118.00 -11.70
2
miRNA  3' ugccgaucaccuGGUCCACuuca 5'
                      |||||||    
Target 5' cagctcttctccCCAGGTGtgtt 3'
54 - 76 95.00 -12.82
3
miRNA  3' ugccgaucaccUGGUCCACUUCa 5'
                     ||| |  |||| 
Target 5' ----------aACC-GAAGAAGa 3'
1 - 12 83.00 -5.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30473662 5 COSMIC
COSN30448898 52 COSMIC
COSN30453356 67 COSMIC
COSN31503973 67 COSMIC
COSN31552415 68 COSMIC
COSN30126194 86 COSMIC
COSN30508292 87 COSMIC
COSN31576472 153 COSMIC
COSN30134661 170 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs376733498 1 dbSNP
rs1340233449 2 dbSNP
rs909995859 3 dbSNP
rs376868882 4 dbSNP
rs764625773 5 dbSNP
rs756609751 6 dbSNP
rs752833842 12 dbSNP
rs748874733 13 dbSNP
rs1347042363 15 dbSNP
rs767529262 16 dbSNP
rs1361237817 18 dbSNP
rs759760642 19 dbSNP
rs1400756131 20 dbSNP
rs1362539033 22 dbSNP
rs1200910034 23 dbSNP
rs774399947 24 dbSNP
rs373956800 25 dbSNP
rs761566342 26 dbSNP
rs1378619707 30 dbSNP
rs773833182 35 dbSNP
rs368908092 36 dbSNP
rs768768367 37 dbSNP
rs775141634 39 dbSNP
rs760842849 40 dbSNP
rs1239446352 43 dbSNP
rs745555612 44 dbSNP
rs1478246786 47 dbSNP
rs1169828612 48 dbSNP
rs1209771410 50 dbSNP
rs778477597 51 dbSNP
rs955670367 52 dbSNP
rs1468080247 55 dbSNP
rs966059572 59 dbSNP
rs1803904 60 dbSNP
rs369747155 62 dbSNP
rs1375263135 65 dbSNP
rs1413299757 67 dbSNP
rs1017220386 75 dbSNP
rs1340779971 82 dbSNP
rs1031572592 86 dbSNP
rs999668203 88 dbSNP
rs376823399 90 dbSNP
rs1332309295 118 dbSNP
rs1233969394 122 dbSNP
rs564177995 123 dbSNP
rs144469141 128 dbSNP
rs1022016194 129 dbSNP
rs1012013317 132 dbSNP
rs1277290566 142 dbSNP
rs752768909 142 dbSNP
rs1275182485 143 dbSNP
rs1229720923 145 dbSNP
rs894807117 147 dbSNP
rs1434949182 158 dbSNP
rs1009326644 162 dbSNP
rs892307897 162 dbSNP
rs575897383 163 dbSNP
rs1160829938 170 dbSNP
rs1246377748 171 dbSNP
rs1361508758 179 dbSNP
rs939247331 204 dbSNP
rs1286753755 212 dbSNP
rs1392312094 225 dbSNP
rs939282166 230 dbSNP
rs1327731571 247 dbSNP
rs926568474 249 dbSNP
rs1242154880 252 dbSNP
rs1309783438 257 dbSNP
rs1389387189 263 dbSNP
rs1215385944 266 dbSNP
rs768157954 277 dbSNP
rs1489560935 283 dbSNP
rs1048121563 284 dbSNP
rs930454040 285 dbSNP
rs1453133386 291 dbSNP
rs183434463 292 dbSNP
rs1381393994 299 dbSNP
rs1418834214 303 dbSNP
rs746942192 318 dbSNP
rs1369866259 321 dbSNP
rs760047040 335 dbSNP
rs1324647845 344 dbSNP
rs982875693 345 dbSNP
rs930098839 347 dbSNP
rs922797020 352 dbSNP
rs1372411540 359 dbSNP
rs1221880733 360 dbSNP
rs1314562167 373 dbSNP
rs1423853653 381 dbSNP
rs76019827 384 dbSNP
rs146288743 387 dbSNP
rs986846911 396 dbSNP
rs771304857 407 dbSNP
rs1018509703 408 dbSNP
rs537961112 409 dbSNP
rs578083867 410 dbSNP
rs1416331841 411 dbSNP
rs978754335 433 dbSNP
rs1482206913 434 dbSNP
rs967701310 438 dbSNP
rs1206359651 439 dbSNP
rs1170715618 443 dbSNP
rs1353891952 446 dbSNP
rs1439848390 447 dbSNP
rs367557037 449 dbSNP
rs1022508175 450 dbSNP
rs549372113 457 dbSNP
rs34278344 464 dbSNP
rs1301077093 467 dbSNP
rs1292875898 468 dbSNP
rs1332835761 470 dbSNP
rs1220572342 471 dbSNP
rs1212194662 473 dbSNP
rs1203016489 494 dbSNP
rs113172483 495 dbSNP
rs1034854573 498 dbSNP
rs1278500934 512 dbSNP
rs1034671568 519 dbSNP
rs1003816652 532 dbSNP
rs537045784 537 dbSNP
rs886124189 538 dbSNP
rs148754589 543 dbSNP
rs1404128366 546 dbSNP
rs995196794 550 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' ugccgaucaccuggucCACUUCa 5'
                          |||||| 
Target 5' --aaaaggagagagaaGUGAAGa 3'
1 - 21
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000231751.4 | 3UTR | AAAAGGAGAGAGAAGUGAAGAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
Click to see details
Click to see details
138 hsa-miR-412-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005780 ACVR1C activin A receptor type 1C 1 1
MIRT062013 YOD1 YOD1 deubiquitinase 2 2
MIRT345112 ATXN7L3 ataxin 7 like 3 2 2
MIRT383735 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT396956 CELF1 CUGBP Elav-like family member 1 2 2
MIRT439280 XIAP X-linked inhibitor of apoptosis 1 1
MIRT439313 VAT1 vesicle amine transport 1 1 1
MIRT439375 TUBA1A tubulin alpha 1a 1 1
MIRT439418 TMOD1 tropomodulin 1 1 1
MIRT439503 SURF4 surfeit 4 1 1
MIRT439563 SON SON DNA binding protein 1 1
MIRT439598 SLC3A2 solute carrier family 3 member 2 1 1
MIRT439670 SETD1B SET domain containing 1B 1 1
MIRT439767 RMND5A required for meiotic nuclear division 5 homolog A 1 1
MIRT439922 PPL periplakin 1 1
MIRT439947 PLEKHA6 pleckstrin homology domain containing A6 1 1
MIRT439952 PLCB4 phospholipase C beta 4 1 1
MIRT439961 PKD1 polycystin 1, transient receptor potential channel interacting 1 1
MIRT440005 PEG3 paternally expressed 3 1 1
MIRT440061 OSBPL8 oxysterol binding protein like 8 1 1
MIRT440166 MYH14 myosin heavy chain 14 1 1
MIRT440276 MAPK8IP1 mitogen-activated protein kinase 8 interacting protein 1 1 1
MIRT440437 IPO13 importin 13 1 1
MIRT440441 INTS3 integrator complex subunit 3 1 1
MIRT440448 INS insulin 1 1
MIRT440461 IGF2R insulin like growth factor 2 receptor 1 1
MIRT440472 IARS isoleucyl-tRNA synthetase 1 1
MIRT440530 GUCY1A3 guanylate cyclase 1 soluble subunit alpha 1 1
MIRT440542 GOLGA2 golgin A2 1 1
MIRT440569 GIGYF1 GRB10 interacting GYF protein 1 1 1
MIRT440608 FTSJD2 cap methyltransferase 1 1 1
MIRT440750 EEF1A2 eukaryotic translation elongation factor 1 alpha 2 1 1
MIRT440781 DOT1L DOT1 like histone lysine methyltransferase 1 1
MIRT440804 DNAJA4 DnaJ heat shock protein family (Hsp40) member A4 1 1
MIRT440867 CSDE1 cold shock domain containing E1 1 1
MIRT440890 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT440917 COL1A1 collagen type I alpha 1 chain 1 1
MIRT440967 CDH22 cadherin 22 1 1
MIRT440968 CDH2 cadherin 2 1 1
MIRT441024 CALR calreticulin 1 1
MIRT441278 ACTB actin beta 1 1
MIRT448421 TNFAIP3 TNF alpha induced protein 3 2 2
MIRT462833 BCL3 B-cell CLL/lymphoma 3 2 2
MIRT465062 TSR1 TSR1, ribosome maturation factor 2 2
MIRT476050 GRSF1 G-rich RNA sequence binding factor 1 2 2
MIRT485318 MZT1 mitotic spindle organizing protein 1 2 4
MIRT493584 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 6
MIRT494567 BAK1 BCL2 antagonist/killer 1 2 2
MIRT497393 RALY RALY heterogeneous nuclear ribonucleoprotein 2 2
MIRT503250 ZNF257 zinc finger protein 257 2 10
MIRT503656 ZNF138 zinc finger protein 138 2 10
MIRT505882 RNF219 ring finger protein 219 2 2
MIRT507525 DSTN destrin, actin depolymerizing factor 2 4
MIRT510663 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 4
MIRT514682 ZNF701 zinc finger protein 701 2 4
MIRT515370 ZNF208 zinc finger protein 208 2 6
MIRT525237 KCNJ12 potassium voltage-gated channel subfamily J member 12 2 2
MIRT527963 MTAP methylthioadenosine phosphorylase 2 2
MIRT528482 STAMBPL1 STAM binding protein like 1 2 2
MIRT529909 C1orf64 steroid receptor associated and regulated protein 2 4
MIRT531558 SRD5A1 steroid 5 alpha-reductase 1 2 2
MIRT532234 KLF2 Kruppel like factor 2 2 4
MIRT532480 HOXA13 homeobox A13 2 2
MIRT535544 P2RY2 purinergic receptor P2Y2 2 2
MIRT547311 NR1D2 nuclear receptor subfamily 1 group D member 2 2 2
MIRT551795 ZNF117 zinc finger protein 117 2 4
MIRT554939 RAP1A RAP1A, member of RAS oncogene family 2 2
MIRT558171 EIF5A2 eukaryotic translation initiation factor 5A2 2 2
MIRT568771 LY6K lymphocyte antigen 6 family member K 2 2
MIRT570766 ZNF99 zinc finger protein 99 2 2
MIRT572405 MRPS14 mitochondrial ribosomal protein S14 2 2
MIRT573396 DLC1 DLC1 Rho GTPase activating protein 2 2
MIRT610403 RXRB retinoid X receptor beta 2 2
MIRT610886 SCN8A sodium voltage-gated channel alpha subunit 8 2 2
MIRT611197 TMEM105 transmembrane protein 105 2 2
MIRT611244 ZNF550 zinc finger protein 550 2 2
MIRT615669 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 4
MIRT617974 DOCK4 dedicator of cytokinesis 4 2 2
MIRT619150 ZNF326 zinc finger protein 326 2 2
MIRT619608 MKKS McKusick-Kaufman syndrome 2 2
MIRT621053 DGKD diacylglycerol kinase delta 2 2
MIRT623665 HRK harakiri, BCL2 interacting protein 2 2
MIRT624883 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 2 2
MIRT624939 MARCH2 membrane associated ring-CH-type finger 2 2 2
MIRT634198 TMOD2 tropomodulin 2 2 4
MIRT636727 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT637741 POLR3K RNA polymerase III subunit K 2 2
MIRT638002 ZC3H13 zinc finger CCCH-type containing 13 2 2
MIRT640395 ZNF785 zinc finger protein 785 2 2
MIRT640505 ANTXR1 anthrax toxin receptor 1 2 2
MIRT641293 SLAMF1 signaling lymphocytic activation molecule family member 1 2 2
MIRT641863 STOML1 stomatin like 1 2 2
MIRT642600 C14orf180 chromosome 14 open reading frame 180 2 2
MIRT642895 CASP1 caspase 1 2 2
MIRT643967 FHL2 four and a half LIM domains 2 2 4
MIRT645237 KCTD12 potassium channel tetramerization domain containing 12 2 2
MIRT646621 CENPL centromere protein L 2 2
MIRT648620 CYB561A3 cytochrome b561 family member A3 2 2
MIRT648908 ZNF551 zinc finger protein 551 2 2
MIRT649439 HIBADH 3-hydroxyisobutyrate dehydrogenase 2 2
MIRT650637 LTF lactotransferrin 2 2
MIRT650971 STARD3NL STARD3 N-terminal like 2 2
MIRT651067 ZNF518B zinc finger protein 518B 2 4
MIRT652384 TMEM55A phosphatidylinositol-4,5-bisphosphate 4-phosphatase 2 2 2
MIRT653958 SEPN1 selenoprotein N 2 2
MIRT656885 KIF1C kinesin family member 1C 2 2
MIRT657965 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT658080 FOXR2 forkhead box R2 2 2
MIRT662570 IL2RA interleukin 2 receptor subunit alpha 2 2
MIRT663089 METTL10 EEF1A lysine methyltransferase 2 2 2
MIRT683705 ZNF195 zinc finger protein 195 2 2
MIRT683835 ZNF682 zinc finger protein 682 2 2
MIRT706811 APOL4 apolipoprotein L4 2 2
MIRT707575 DYNC2LI1 dynein cytoplasmic 2 light intermediate chain 1 2 2
MIRT708606 ZNF260 zinc finger protein 260 2 2
MIRT708859 TMSB4X thymosin beta 4, X-linked 2 2
MIRT709861 PDIK1L PDLIM1 interacting kinase 1 like 2 2
MIRT709987 RBM41 RNA binding motif protein 41 2 2
MIRT710098 KPNA5 karyopherin subunit alpha 5 2 2
MIRT710211 ENAH ENAH, actin regulator 2 2
MIRT710868 B3GALNT1 beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) 2 2
MIRT710986 SUSD5 sushi domain containing 5 2 2
MIRT711460 RNF145 ring finger protein 145 2 2
MIRT712302 PGM2L1 phosphoglucomutase 2 like 1 2 2
MIRT713609 SYTL4 synaptotagmin like 4 2 2
MIRT713789 MAK16 MAK16 homolog 2 2
MIRT715480 MYO9B myosin IXB 2 2
MIRT716328 POU5F1 POU class 5 homeobox 1 2 2
MIRT717252 TMEM246 transmembrane protein 246 2 2
MIRT718077 CLIC5 chloride intracellular channel 5 2 2
MIRT718463 EED embryonic ectoderm development 2 2
MIRT718645 NKPD1 NTPase KAP family P-loop domain containing 1 2 2
MIRT718982 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 2
MIRT721078 RPS9 ribosomal protein S9 2 2
MIRT721419 SEC24A SEC24 homolog A, COPII coat complex component 2 2
MIRT721863 CENPJ centromere protein J 2 2
MIRT722492 PNKD paroxysmal nonkinesigenic dyskinesia 2 2
MIRT723391 CALN1 calneuron 1 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-412 Gemcitabine approved 60750 Northern blot Mz-ChA-1 human cholangiocarcinoma cell lines 16762633 2006 down-regulated
miR-412 Progesterone approved 5994 Microarray Breast cancer 22330642 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-412 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-412 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-412-3p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-412-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-412-3p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780)
hsa-miR-412-3p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (RKO)
hsa-miR-412-3p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (HCT-116)
hsa-miR-412-3p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780)
hsa-miR-412-3p Doxorubicin 31703 NSC123127 approved sensitive High Anaplastic Thyroid Cancer tissue
hsa-miR-412-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM36)
hsa-miR-412-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-412-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM43)
hsa-miR-412-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-412-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-412-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-412-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-412-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (Panc1-GR1)
hsa-miR-412-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission