pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-548t |
Genomic Coordinates | chr4: 173268160 - 173268233 |
Description | Homo sapiens miR-548t stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-548t-3p | |||||||||||||||||||||||||||||||||||
Sequence | 46| AAAAACCACAAUUACUUUUGCACCA |70 | |||||||||||||||||||||||||||||||||||
Evidence | Not_experimental | |||||||||||||||||||||||||||||||||||
Experiments | ||||||||||||||||||||||||||||||||||||
Editing Events in miRNAs |
|
|||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | SLC30A1 | ||||||||||||||||||||
Synonyms | ZNT1, ZRC1 | ||||||||||||||||||||
Description | solute carrier family 30 member 1 | ||||||||||||||||||||
Transcript | NM_021194 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on SLC30A1 | |||||||||||||||||||||
3'UTR of SLC30A1 (miRNA target sites are highlighted) |
>SLC30A1|NM_021194|3'UTR 1 GTCTTGAAAAAGATGTGATATTTGACTTTTGCTTTAAACTGCAAGAGGAAAAAGACTCCACTGAAATTCTAAGTTTGCCA 81 AGTAGTGTAATTGAAGTCCTTGTCTGGTCACACAGTTTAATTCTATTTTTGTAAGAACATAATGGGACTGCATAACAGAG 161 TTCTATATTACAATTTTGTGATTATTAGTACAGAGTACAGCTATGCTGTGACTGTTTTGGAAAGCCAGTTTTAACACTAT 241 GTTACATTTTTGTTTAAAGTAAGTTAAACCTTATATAACATAATGACATTTGATTTCTGGATTTTTCCCATGATAAAAAT 321 TAGGGGGATAAATAAAATTGTTACTGGAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293S | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
CLIP-seq Support 1 for dataset GSM1084065 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_emetine_AbnovaAb |
Location of target site | ENST00000367001.4 | 3UTR | AAAAGGUUUGGGUGGUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
168 hsa-miR-548t-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT059365 | ANP32E | acidic nuclear phosphoprotein 32 family member E | ![]() |
![]() |
2 | 2 | ||||||
MIRT072839 | ARIH1 | ariadne RBR E3 ubiquitin protein ligase 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT076945 | PCGF2 | polycomb group ring finger 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT083941 | TFAP2C | transcription factor AP-2 gamma | ![]() |
![]() |
2 | 2 | ||||||
MIRT085401 | ETS2 | ETS proto-oncogene 2, transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT109790 | KLHL15 | kelch like family member 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT114046 | AKAP11 | A-kinase anchoring protein 11 | ![]() |
![]() |
2 | 10 | ||||||
MIRT130165 | TXNIP | thioredoxin interacting protein | ![]() |
![]() |
2 | 6 | ||||||
MIRT150013 | MIDN | midnolin | ![]() |
![]() |
2 | 2 | ||||||
MIRT181258 | ASH1L | ASH1 like histone lysine methyltransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT205594 | NCL | nucleolin | ![]() |
![]() |
2 | 2 | ||||||
MIRT222253 | ACTB | actin beta | ![]() |
![]() |
2 | 4 | ||||||
MIRT245653 | EIF5AL1 | eukaryotic translation initiation factor 5A-like 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT250947 | CDK5R1 | cyclin dependent kinase 5 regulatory subunit 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT252497 | NWD1 | NACHT and WD repeat domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT271990 | ARF1 | ADP ribosylation factor 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT280804 | RNF11 | ring finger protein 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT293803 | FEM1A | fem-1 homolog A | ![]() |
![]() |
2 | 2 | ||||||
MIRT318231 | RREB1 | ras responsive element binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT341455 | ATP6V0B | ATPase H+ transporting V0 subunit b | ![]() |
![]() |
2 | 2 | ||||||
MIRT347413 | CEBPG | CCAAT/enhancer binding protein gamma | ![]() |
![]() |
2 | 4 | ||||||
MIRT351860 | PLEKHA3 | pleckstrin homology domain containing A3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT357983 | GRPEL2 | GrpE like 2, mitochondrial | ![]() |
![]() |
2 | 2 | ||||||
MIRT377094 | PPP1CB | protein phosphatase 1 catalytic subunit beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT407303 | IGFBP5 | insulin like growth factor binding protein 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT441564 | LMOD3 | leiomodin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT442364 | ZC3H12C | zinc finger CCCH-type containing 12C | ![]() |
![]() |
2 | 2 | ||||||
MIRT443228 | ARL5B | ADP ribosylation factor like GTPase 5B | ![]() |
![]() |
2 | 2 | ||||||
MIRT443404 | HMX3 | H6 family homeobox 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446055 | NR5A2 | nuclear receptor subfamily 5 group A member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT448277 | ZNF652 | zinc finger protein 652 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450822 | KCNB1 | potassium voltage-gated channel subfamily B member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453016 | CCDC115 | coiled-coil domain containing 115 | ![]() |
![]() |
2 | 17 | ||||||
MIRT454463 | PPP2R2B | protein phosphatase 2 regulatory subunit Bbeta | ![]() |
![]() |
2 | 2 | ||||||
MIRT456360 | CITED2 | Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT460007 | DNALI1 | dynein axonemal light intermediate chain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT463154 | ZNF385A | zinc finger protein 385A | ![]() |
![]() |
2 | 6 | ||||||
MIRT463766 | YPEL2 | yippee like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468310 | SFT2D2 | SFT2 domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470668 | POLR2D | RNA polymerase II subunit D | ![]() |
![]() |
2 | 4 | ||||||
MIRT478517 | CTTN | cortactin | ![]() |
![]() |
2 | 2 | ||||||
MIRT480507 | C11orf57 | chromosome 11 open reading frame 57 | ![]() |
![]() |
2 | 2 | ||||||
MIRT484718 | INHBA | inhibin beta A subunit | ![]() |
![]() |
2 | 12 | ||||||
MIRT485494 | HMGN2 | high mobility group nucleosomal binding domain 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487302 | SLC38A9 | solute carrier family 38 member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487771 | ANKEF1 | ankyrin repeat and EF-hand domain containing 1 | ![]() |
![]() |
2 | 16 | ||||||
MIRT491876 | YWHAZ | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta | ![]() |
![]() |
2 | 2 | ||||||
MIRT494304 | CEP120 | centrosomal protein 120 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495396 | TRIM24 | tripartite motif containing 24 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495646 | CDK1 | cyclin dependent kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496665 | TMEM237 | transmembrane protein 237 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496837 | ZNF460 | zinc finger protein 460 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498638 | CHD4 | chromodomain helicase DNA binding protein 4 | ![]() |
![]() |
2 | 10 | ||||||
MIRT503928 | FBXL13 | F-box and leucine rich repeat protein 13 | ![]() |
![]() |
2 | 4 | ||||||
MIRT506063 | PPP2R2A | protein phosphatase 2 regulatory subunit Balpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT506582 | MIER3 | MIER family member 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT506606 | MAT2A | methionine adenosyltransferase 2A | ![]() |
![]() |
2 | 4 | ||||||
MIRT506844 | KIF23 | kinesin family member 23 | ![]() |
![]() |
2 | 6 | ||||||
MIRT508536 | RPP14 | ribonuclease P/MRP subunit p14 | ![]() |
![]() |
2 | 4 | ||||||
MIRT509669 | ZNF354B | zinc finger protein 354B | ![]() |
![]() |
2 | 10 | ||||||
MIRT511170 | MBNL3 | muscleblind like splicing regulator 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT512147 | COX6B1 | cytochrome c oxidase subunit 6B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT512831 | ID4 | inhibitor of DNA binding 4, HLH protein | ![]() |
![]() |
2 | 6 | ||||||
MIRT514558 | XRCC3 | X-ray repair cross complementing 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT515856 | AJAP1 | adherens junctions associated protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT521848 | PNISR | PNN interacting serine and arginine rich protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT525364 | SYNM | synemin | ![]() |
![]() |
2 | 2 | ||||||
MIRT527120 | ARHGAP15 | Rho GTPase activating protein 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT527271 | FBLN2 | fibulin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT527439 | COL4A3 | collagen type IV alpha 3 chain | ![]() |
![]() |
2 | 2 | ||||||
MIRT527658 | CD300E | CD300e molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT528334 | TBC1D22B | TBC1 domain family member 22B | ![]() |
![]() |
2 | 2 | ||||||
MIRT529033 | EXOC8 | exocyst complex component 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT529321 | PDE5A | phosphodiesterase 5A | ![]() |
![]() |
2 | 2 | ||||||
MIRT529677 | TRPV2 | transient receptor potential cation channel subfamily V member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT529846 | SMTN | smoothelin | ![]() |
![]() |
2 | 2 | ||||||
MIRT530385 | ZNF431 | zinc finger protein 431 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530913 | GPR85 | G protein-coupled receptor 85 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531794 | KDR | kinase insert domain receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT532246 | KLF2 | Kruppel like factor 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT532658 | CBX7 | chromobox 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533630 | TMX3 | thioredoxin related transmembrane protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT534811 | RAB33B | RAB33B, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT534975 | PSD3 | pleckstrin and Sec7 domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT536588 | ITPKB | inositol-trisphosphate 3-kinase B | ![]() |
![]() |
2 | 2 | ||||||
MIRT536779 | HNRNPD | heterogeneous nuclear ribonucleoprotein D | ![]() |
![]() |
2 | 2 | ||||||
MIRT538764 | CABLES1 | Cdk5 and Abl enzyme substrate 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539294 | ANGEL2 | angel homolog 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539621 | SHISA9 | shisa family member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539651 | BUB1 | BUB1 mitotic checkpoint serine/threonine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT540347 | OPHN1 | oligophrenin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540413 | PITPNC1 | phosphatidylinositol transfer protein, cytoplasmic 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541396 | CDC27 | cell division cycle 27 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542916 | HSBP1 | heat shock factor binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544710 | EIF5A | eukaryotic translation initiation factor 5A | ![]() |
![]() |
2 | 4 | ||||||
MIRT544998 | MFF | mitochondrial fission factor | ![]() |
![]() |
2 | 4 | ||||||
MIRT553289 | TSPAN3 | tetraspanin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT553455 | TNRC6C | trinucleotide repeat containing 6C | ![]() |
![]() |
2 | 2 | ||||||
MIRT553782 | TAF13 | TATA-box binding protein associated factor 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT554656 | ROBO1 | roundabout guidance receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT555104 | PURB | purine rich element binding protein B | ![]() |
![]() |
2 | 2 | ||||||
MIRT557235 | HNRNPA1 | heterogeneous nuclear ribonucleoprotein A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT560861 | GAL3ST3 | galactose-3-O-sulfotransferase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT561545 | SON | SON DNA binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT561554 | SLMO2 | PRELI domain containing 3B | ![]() |
![]() |
2 | 2 | ||||||
MIRT563764 | ZNF678 | zinc finger protein 678 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565653 | SIX4 | SIX homeobox 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568080 | CELF2 | CUGBP Elav-like family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568759 | MYBL1 | MYB proto-oncogene like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569078 | CADM2 | cell adhesion molecule 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569509 | THYN1 | thymocyte nuclear protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT571268 | CDKN2AIP | CDKN2A interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT571809 | PHF19 | PHD finger protein 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572554 | DKK3 | dickkopf WNT signaling pathway inhibitor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573782 | SLC24A4 | solute carrier family 24 member 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT576441 | Ccdc115 | coiled-coil domain containing 115 | ![]() |
![]() |
2 | 10 | ||||||
MIRT576712 | Slc30a3 | solute carrier family 30 (zinc transporter), member 3 | ![]() |
![]() |
2 | 3 | ||||||
MIRT608377 | PIWIL2 | piwi like RNA-mediated gene silencing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT608484 | NKTR | natural killer cell triggering receptor | ![]() |
![]() |
2 | 6 | ||||||
MIRT610186 | FAM49A | family with sequence similarity 49 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT611631 | EDIL3 | EGF like repeats and discoidin domains 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT613534 | TRA2B | transformer 2 beta homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT616221 | PTPN11 | protein tyrosine phosphatase, non-receptor type 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622370 | SALL1 | spalt like transcription factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT624371 | CDK12 | cyclin dependent kinase 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT624995 | ZNF665 | zinc finger protein 665 | ![]() |
![]() |
2 | 4 | ||||||
MIRT626875 | AP3B1 | adaptor related protein complex 3 beta 1 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT627737 | RAP2B | RAP2B, member of RAS oncogene family | ![]() |
![]() |
2 | 4 | ||||||
MIRT628490 | ADAT2 | adenosine deaminase, tRNA specific 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT633647 | PLEKHG7 | pleckstrin homology and RhoGEF domain containing G7 | ![]() |
![]() |
2 | 4 | ||||||
MIRT634028 | SLC30A3 | solute carrier family 30 member 3 | ![]() |
![]() |
2 | 3 | ||||||
MIRT635923 | GLTSCR2 | NOP53 ribosome biogenesis factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT638287 | SERBP1 | SERPINE1 mRNA binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641959 | RNF115 | ring finger protein 115 | ![]() |
![]() |
2 | 2 | ||||||
MIRT643573 | CTNNA3 | catenin alpha 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT645180 | NOL9 | nucleolar protein 9 | ![]() |
![]() |
2 | 4 | ||||||
MIRT647497 | ZNF639 | zinc finger protein 639 | ![]() |
![]() |
2 | 2 | ||||||
MIRT647682 | PCK1 | phosphoenolpyruvate carboxykinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648422 | MYOZ3 | myozenin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650113 | ZCCHC9 | zinc finger CCHC-type containing 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651076 | ZNF518B | zinc finger protein 518B | ![]() |
![]() |
2 | 4 | ||||||
MIRT651415 | ZADH2 | zinc binding alcohol dehydrogenase domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651456 | XKR4 | XK related 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT653619 | SLC30A4 | solute carrier family 30 member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT653637 | SLC30A1 | solute carrier family 30 member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT654896 | POU2F1 | POU class 2 homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT656483 | MAP3K9 | mitogen-activated protein kinase kinase kinase 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT658016 | GABRA4 | gamma-aminobutyric acid type A receptor alpha4 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT658041 | FZD10 | frizzled class receptor 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT660093 | BTBD3 | BTB domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663923 | MAGEF1 | MAGE family member F1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665882 | TGIF2 | TGFB induced factor homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669051 | CEP128 | centrosomal protein 128 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669711 | AAGAB | alpha and gamma adaptin binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT686812 | SNX2 | sorting nexin 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT689883 | SOD2 | superoxide dismutase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693274 | GLRX2 | glutaredoxin 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT697056 | BCAR1 | BCAR1, Cas family scaffolding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT703297 | GID4 | GID complex subunit 4 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT704087 | DYRK2 | dual specificity tyrosine phosphorylation regulated kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT707719 | CDC6 | cell division cycle 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT708136 | GK5 | glycerol kinase 5 (putative) | ![]() |
![]() |
2 | 2 | ||||||
MIRT709212 | KLHL30 | kelch like family member 30 | ![]() |
![]() |
2 | 2 | ||||||
MIRT710062 | RWDD2A | RWD domain containing 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT712770 | POU6F2 | POU class 6 homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715073 | TMTC1 | transmembrane and tetratricopeptide repeat containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715387 | TADA3 | transcriptional adaptor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT717712 | NCKAP1 | NCK associated protein 1 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|