>SERPINC1|NM_000488|3'UTR
   1 AATGTTCTTATTCTTTGCACCTCTTCCTATTTTTGGTTTGTGAACAGAAGTAAAAATAAATACAAACTACTTCCATCTCA
  81 CATTA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' cgaGAAAAGUAAUUACAUCUGu 5' :|||| :|| |||: || Target 5' ctaTTTTTGGTT--TGTGAACa 3'	27 - 46	111.00	-6.20

Mutant ID	Mutant Position	Mutant Source
COSN30526014	5	COSMIC
COSN24298093	15	COSMIC
COSN26994375	20	COSMIC
COSN30478776	35	COSMIC
COSN28852868	51	COSMIC
COSN30104731	51	COSMIC
COSN30533151	56	COSMIC
COSN30162338	73	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs904717916	4	dbSNP
rs1020453934	6	dbSNP
rs753725301	12	dbSNP
rs766334816	17	dbSNP
rs755838660	18	dbSNP
rs1336444125	20	dbSNP
rs1029907432	21	dbSNP
rs1247393849	29	dbSNP
rs370533988	29	dbSNP
rs377120264	34	dbSNP
rs761064819	35	dbSNP
rs775742595	35	dbSNP
rs1385332988	48	dbSNP
rs1338428623	49	dbSNP
rs767187085	50	dbSNP
rs1405212986	51	dbSNP
rs961575521	59	dbSNP
rs1261533554	60	dbSNP
rs1486047798	81	dbSNP
rs563362925	90	dbSNP

- Genes & development, 2013

When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.