pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-2115 |
Genomic Coordinates | chr3: 48316360 - 48316459 |
Description | Homo sapiens miR-2115 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-2115-3p | |||||||||
Sequence | 58| CAUCAGAAUUCAUGGAGGCUAG |79 | |||||||||
Evidence | Experimental | |||||||||
Experiments | 454 | DRVs in miRNA |
|
|||||||
SNPs in miRNA |
|
|||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | ELN | ||||||||||||||||||||
Synonyms | ADCL1, SVAS, WBS, WS | ||||||||||||||||||||
Description | elastin | ||||||||||||||||||||
Transcript | NM_000501 | ||||||||||||||||||||
Other Transcripts | NM_001081752 , NM_001081753 , NM_001081754 , NM_001081755 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on ELN | |||||||||||||||||||||
3'UTR of ELN (miRNA target sites are highlighted) |
>ELN|NM_000501|3'UTR 1 GCTTCCTAGGACCCCTGACTCACGACCTCATCAACGTTGGTGCTACTGCTTGGTGGAGAATGTAAACCCTTTGTAACCCC 81 ATCCCATGCCCCTCCGACTCCCCACCCCAGGAGGGAACGGGCAGGCCGGGCGGCCTTGCAGATCCACAGGGCAAGGAAAC 161 AAGAGGGGAGCGGCCAAGTGCCCCGACCAGGAGGCCCCCTACTTCAGAGGCAAGGGCCATGTGGTCCTGGCCCCCCACCC 241 CATCCCTTCCCACCTAGGAGCTCCCCCTCCACACAGCCTCCATCTCCAGGGGAACTTGGTGCTACACGCTGGTGCTCTTA 321 TCTTCCTGGGGGGAGGGAGGAGGGAAGGGTGGCCCCTCGGGGAACCCCCTACCTGGGGCTCCTCTAAAGATGGTGCAGAC 401 ACTTCCTGGGCAGTCCCAGCTCCCCCTGCCCACCAGGACCCACCGTTGGCTGCCATCCAGTTGGTACCCAAGCACCTGAA 481 GCCTCAAAGCTGGATTCGCTCTAGCATCCCTCCTCTCCTGGGTCCACTTGGCCGTCTCCTCCCCACCGATCGCTGTTCCC 561 CACATCTGGGGCGCTTTTGGGTTGGAAAACCACCCCACACTGGGAATAGCCACCTTGCCCTTGTAGAATCCATCCGCCCA 641 TCCGTCCATTCATCCATCGGTCCGTCCATCCATGTCCCCAGTTGACCGCCCGGCACCACTAGCTGGCTGGGTGCACCCAC 721 CATCAACCTGGTTGACCTGTCATGGCCGCCTGTGCCCTGCCTCCACCCCCATCCTACACTCCCCCAGGGCGTGCGGGGCT 801 GTGCAGACTGGGGTGCCAGGCATCTCCTCCCCACCCGGGGTGTCCCCACATGCAGTACTGTATACCCCCCATCCCTCCCT 881 CGGTCCACTGAACTTCAGAGCAGTTCCCATTCCTGCCCCGCCCATCTTTTTGTGTCTCGCTGTGATAGATCAATAAATAT 961 TTTATTTTTTGTCCTGGATATTTGGGGATTATTTTTGATTGTTGATATTCTCTTTTGGTTTTATTGTTGTGGTTCATTGA 1041 AAAAAAAAGATAATTTTTTTTTCTGATCCGGGGAGCTGTATCCCCAGTAGAAAAAACATTTTAATCACTCTAATATAACT 1121 CTGGATGAAACACACCTTTTTTTTTAATAAGAAAAGAGAATTAACTGCTTCAGAAATGACTAATAAATGAAAAACCTTTA 1201 AAGGAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293S |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
CLIP-seq Support 1 for dataset GSM1084065 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_emetine_AbnovaAb |
Location of target site | ENST00000252034.7 | 3UTR | AAAAGAUAAUUUUUUUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
80 hsa-miR-2115-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT057089 | DDIT4 | DNA damage inducible transcript 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT071216 | FCF1 | FCF1, rRNA-processing protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT226901 | RAD23B | RAD23 homolog B, nucleotide excision repair protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT235961 | BACH1 | BTB domain and CNC homolog 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT294569 | ZNF460 | zinc finger protein 460 | ![]() |
![]() |
2 | 4 | ||||||
MIRT321046 | RAC1 | Rac family small GTPase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT359666 | NUS1 | NUS1 dehydrodolichyl diphosphate synthase subunit | ![]() |
![]() |
2 | 8 | ||||||
MIRT366451 | KLHL15 | kelch like family member 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT405375 | ZBTB18 | zinc finger and BTB domain containing 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT441794 | TCEAL5 | transcription elongation factor A like 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443295 | TCEAL3 | transcription elongation factor A like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455275 | DDX39B | DExD-box helicase 39B | ![]() |
![]() |
2 | 2 | ||||||
MIRT458523 | C5orf22 | chromosome 5 open reading frame 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT464960 | TWIST1 | twist family bHLH transcription factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT466848 | STX6 | syntaxin 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT469252 | RHOB | ras homolog family member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT469825 | RAB14 | RAB14, member RAS oncogene family | ![]() |
![]() |
2 | 4 | ||||||
MIRT470047 | PTGFRN | prostaglandin F2 receptor inhibitor | ![]() |
![]() |
2 | 2 | ||||||
MIRT471420 | PDP2 | pyruvate dehyrogenase phosphatase catalytic subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472024 | NPM1 | nucleophosmin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT484156 | CENPN | centromere protein N | ![]() |
![]() |
2 | 2 | ||||||
MIRT485490 | HMGN2 | high mobility group nucleosomal binding domain 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490462 | PROSER2 | proline and serine rich 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493069 | MTCH1 | mitochondrial carrier 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493573 | HSP90AA1 | heat shock protein 90 alpha family class A member 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT494919 | NDUFC2-KCTD14 | NDUFC2-KCTD14 readthrough | ![]() |
![]() |
2 | 2 | ||||||
MIRT500439 | ZMAT3 | zinc finger matrin-type 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT500931 | SRPR | SRP receptor alpha subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT501551 | POC1B-GALNT4 | POC1B-GALNT4 readthrough | ![]() |
![]() |
2 | 2 | ||||||
MIRT501809 | NEURL1B | neuralized E3 ubiquitin protein ligase 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT502415 | GALNT4 | polypeptide N-acetylgalactosaminyltransferase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT506504 | MSANTD4 | Myb/SANT DNA binding domain containing 4 with coiled-coils | ![]() |
![]() |
2 | 2 | ||||||
MIRT507861 | CCNE2 | cyclin E2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT510511 | YOD1 | YOD1 deubiquitinase | ![]() |
![]() |
2 | 6 | ||||||
MIRT516073 | RAB42 | RAB42, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT519030 | KYNU | kynureninase | ![]() |
![]() |
2 | 6 | ||||||
MIRT521762 | PPIL1 | peptidylprolyl isomerase like 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT522898 | KCNJ3 | potassium voltage-gated channel subfamily J member 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT527370 | MGARP | mitochondria localized glutamic acid rich protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT530691 | C8orf46 | chromosome 8 open reading frame 46 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530867 | TRUB1 | TruB pseudouridine synthase family member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531832 | MTPAP | mitochondrial poly(A) polymerase | ![]() |
![]() |
2 | 4 | ||||||
MIRT533035 | ZBTB5 | zinc finger and BTB domain containing 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533165 | WIPF2 | WAS/WASL interacting protein family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533464 | TRIM71 | tripartite motif containing 71 | ![]() |
![]() |
2 | 2 | ||||||
MIRT534331 | SHCBP1 | SHC binding and spindle associated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539372 | ADSS | adenylosuccinate synthase | ![]() |
![]() |
2 | 6 | ||||||
MIRT545951 | ZBTB10 | zinc finger and BTB domain containing 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT553283 | TSR1 | TSR1, ribosome maturation factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT553532 | TMEM185B | transmembrane protein 185B | ![]() |
![]() |
2 | 4 | ||||||
MIRT556480 | LIPA | lipase A, lysosomal acid type | ![]() |
![]() |
2 | 2 | ||||||
MIRT556975 | HSPA4L | heat shock protein family A (Hsp70) member 4 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT557697 | GATA6 | GATA binding protein 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT558901 | CCDC58 | coiled-coil domain containing 58 | ![]() |
![]() |
2 | 2 | ||||||
MIRT559224 | BLMH | bleomycin hydrolase | ![]() |
![]() |
2 | 2 | ||||||
MIRT559827 | SLPI | secretory leukocyte peptidase inhibitor | ![]() |
![]() |
2 | 2 | ||||||
MIRT563435 | SLC3A2 | solute carrier family 3 member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569270 | PCDH11X | protocadherin 11 X-linked | ![]() |
![]() |
2 | 2 | ||||||
MIRT571386 | JKAMP | JNK1/MAPK8-associated membrane protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT572567 | AFF1 | AF4/FMR2 family member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT610400 | AR | androgen receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT611058 | ZNF621 | zinc finger protein 621 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635118 | TMEM233 | transmembrane protein 233 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641617 | DEFB118 | defensin beta 118 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642146 | CHORDC1 | cysteine and histidine rich domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT647295 | C8orf33 | chromosome 8 open reading frame 33 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648155 | MPLKIP | M-phase specific PLK1 interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT652780 | TENM3 | teneurin transmembrane protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT657356 | HNRNPA2B1 | heterogeneous nuclear ribonucleoprotein A2/B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT658718 | ELN | elastin | ![]() |
![]() |
2 | 2 | ||||||
MIRT662441 | RALGAPA1 | Ral GTPase activating protein catalytic alpha subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665302 | ZBTB38 | zinc finger and BTB domain containing 38 | ![]() |
![]() |
2 | 2 | ||||||
MIRT699898 | RUNX1 | runt related transcription factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700921 | PDS5A | PDS5 cohesin associated factor A | ![]() |
![]() |
2 | 2 | ||||||
MIRT700992 | PDE3A | phosphodiesterase 3A | ![]() |
![]() |
2 | 2 | ||||||
MIRT707397 | DCAF4L1 | DDB1 and CUL4 associated factor 4 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711895 | INSIG2 | insulin induced gene 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712072 | XRCC5 | X-ray repair cross complementing 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT716121 | PTPLAD2 | 3-hydroxyacyl-CoA dehydratase 4 | ![]() |
1 | 1 | |||||||
MIRT724470 | SMAD2 | SMAD family member 2 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|