pre-miRNA Information
pre-miRNA hsa-mir-4763   
Genomic Coordinates chr22: 46113566 - 46113657
Description Homo sapiens miR-4763 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4763-5p
Sequence 19| CGCCUGCCCAGCCCUCCUGCU |39
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs374776264 1 dbSNP
rs1174502793 2 dbSNP
rs966122637 3 dbSNP
rs891363409 6 dbSNP
rs1303008773 8 dbSNP
rs1446379219 11 dbSNP
rs1410535134 13 dbSNP
rs1424733379 14 dbSNP
rs1372551711 16 dbSNP
rs756995936 17 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DSN1   
Synonyms C20orf172, KNL3, MIS13, dJ469A13.2, hKNL-3
Description DSN1 homolog, MIS12 kinetochore complex component
Transcript NM_001145315   
Other Transcripts NM_001145316 , NM_001145317 , NM_001145318 , NM_024918   
Expression
Putative miRNA Targets on DSN1
3'UTR of DSN1
(miRNA target sites are highlighted)
>DSN1|NM_001145315|3'UTR
   1 CTTTATGAGAGTTTCTGCCACAAGGTGCCCAAGAGGAGAGGAATGGGAAGAGTGCCCCAGCACGTGGTGACTGCGTGATT
  81 TCTGCTCGTTGCCTTTGAAGATAACTGGCAGGACTGACTGTAGAACACTTTGACTTTTTTCAAAAAGTGATGGAATTTGT
 161 ACATCCAAATGAATATTGTATAGACAATTTTCCCAGGAATGTGCAAAATGCTTGAAAGTTCAAACTTCTTTTTTGAAATG
 241 ATCTTCAGATCCAGTGGCCCATTCTTTTATCTTTATCCTGTGAAGGTGTTTTTCAGGTTTTGAAACAATCCAAAAATCAT
 321 TTAGGACCAAGTCTAAGGAAACATTTTAGTGGCCAAGTTGGATTCCGATTGTAAAGGAATGATACTAATTTTCTAGCATG
 401 GCTCTGAAGGTGATTTTAGGTAGAAGAGTTTTGAGGCTGGGCGCAATGGCTCACGCCTGTAATCCTAGCATTTTGGGTGA
 481 CTGAGGCGGGTGGATTGCTTGAGCCCAGAAGTTGAAGACCAGCCTGAGAAATAAGGTGAAACCCTGTCTACAAAAAATAC
 561 AAAAAGTTAGCTGGGTGTGGTGGCGTGTGCCTGTAGTGCTAGCTACTCAGAAGGCTGAGGTGGGAGGATTGTTTGAGCCC
 641 AGGAGGTTGAGGCTGCAGTGAGTTCTAATTGCGCCACTGCACTCCAGCCTGAGCGACAGAGTGAGACACTGTCTTAAAAA
 721 AAATTAAAAATTGTAAAAAAATGAAAAAAAAAGTTTTGAGCATTATTTGCATCATTGGGATACATATGTCACTTCACAAG
 801 ATGTTCAATTTGAAGGAAATACCACTCATTCTCTATGTCCTGTTGTCTGTAGTGTGCTTCAGTTTTTCATATTGAGTTGA
 881 CCTAAATCCTGGATTCATGACAAGAAAGGAGTAAGTACTACTATTCATTGTTCTATTTGTTTATAATCTGTATTATAAAA
 961 TTGCACATAATTAAAAGCTTTCCCTTGTCTTCATCTA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ucgUCCUCCCGACCCGUCCgc 5'
             | ||   || ||||||  
Target 5' ttgAAGATAACT-GGCAGGac 3'
95 - 114 125.00 -12.00
2
miRNA  3' ucguCCUCCCGAC-CCGUCCGc 5'
              ||: | ||| |||:||: 
Target 5' ttttGGGTGACTGAGGCGGGTg 3'
471 - 492 125.00 -21.90
3
miRNA  3' ucGUCCUCCCGAC-CCGUCCgc 5'
            || || ||||| ||::||  
Target 5' ctCA-GAAGGCTGAGGTGGGag 3'
606 - 626 114.00 -18.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30145891 15 COSMIC
COSN30456281 57 COSMIC
COSN30506982 64 COSMIC
COSN30185756 69 COSMIC
COSN30183344 82 COSMIC
COSN31599316 87 COSMIC
COSN30171530 97 COSMIC
COSN16084785 183 COSMIC
COSN23574401 194 COSMIC
COSN7090299 221 COSMIC
COSN19029197 364 COSMIC
COSN15817520 381 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs536379032 4 dbSNP
rs900680665 7 dbSNP
rs1302432119 15 dbSNP
rs756963497 20 dbSNP
rs753437238 23 dbSNP
rs372728206 29 dbSNP
rs1193076820 35 dbSNP
rs1443449492 38 dbSNP
rs755656856 45 dbSNP
rs1382417964 46 dbSNP
rs1480870956 52 dbSNP
rs1043253721 56 dbSNP
rs947651081 63 dbSNP
rs1464306768 64 dbSNP
rs1302054960 65 dbSNP
rs1485680960 74 dbSNP
rs1259113740 75 dbSNP
rs777337216 87 dbSNP
rs912872807 88 dbSNP
rs1223727781 91 dbSNP
rs1302875883 101 dbSNP
rs974493791 109 dbSNP
rs758946908 123 dbSNP
rs77399897 125 dbSNP
rs1231346264 132 dbSNP
rs928368198 135 dbSNP
rs553098340 147 dbSNP
rs1356870188 163 dbSNP
rs1251170240 179 dbSNP
rs138062724 181 dbSNP
rs62208060 182 dbSNP
rs189424374 186 dbSNP
rs565077146 187 dbSNP
rs1290213950 191 dbSNP
rs549850112 215 dbSNP
rs1020473020 218 dbSNP
rs1175061938 224 dbSNP
rs973957649 225 dbSNP
rs960037939 226 dbSNP
rs961610358 230 dbSNP
rs1369885721 243 dbSNP
rs1436488317 251 dbSNP
rs199914954 256 dbSNP
rs367833837 261 dbSNP
rs754090494 275 dbSNP
rs1389841102 277 dbSNP
rs1001594663 278 dbSNP
rs905937611 285 dbSNP
rs1015534830 286 dbSNP
rs569695133 292 dbSNP
rs1016147670 303 dbSNP
rs78017147 313 dbSNP
rs1226819946 318 dbSNP
rs529759562 323 dbSNP
rs886385588 329 dbSNP
rs1047651351 334 dbSNP
rs1263806313 349 dbSNP
rs932992476 351 dbSNP
rs146919614 366 dbSNP
rs1039200931 367 dbSNP
rs1451031979 379 dbSNP
rs1186447693 388 dbSNP
rs547921340 400 dbSNP
rs925021109 415 dbSNP
rs1166269412 429 dbSNP
rs1030333927 439 dbSNP
rs1347654838 442 dbSNP
rs996223499 443 dbSNP
rs532605300 445 dbSNP
rs947543245 446 dbSNP
rs1427933099 449 dbSNP
rs913497491 452 dbSNP
rs900649479 454 dbSNP
rs565231650 455 dbSNP
rs1230569237 459 dbSNP
rs1310655667 466 dbSNP
rs1021764740 468 dbSNP
rs1270172679 472 dbSNP
rs1463735322 482 dbSNP
rs1252125467 487 dbSNP
rs1206533879 488 dbSNP
rs937710304 491 dbSNP
rs1247241638 495 dbSNP
rs1473069316 521 dbSNP
rs1011768786 522 dbSNP
rs184199274 524 dbSNP
rs1410982508 525 dbSNP
rs1422670833 535 dbSNP
rs1159265551 544 dbSNP
rs1390336510 549 dbSNP
rs1455339024 555 dbSNP
rs980509384 562 dbSNP
rs1360175013 566 dbSNP
rs1265889580 568 dbSNP
rs970194096 575 dbSNP
rs1016344557 577 dbSNP
rs1379080973 578 dbSNP
rs1226078988 580 dbSNP
rs148827327 585 dbSNP
rs1053409057 589 dbSNP
rs1435328626 601 dbSNP
rs1283293709 605 dbSNP
rs938347046 613 dbSNP
rs950509024 615 dbSNP
rs1235603870 627 dbSNP
rs1482905903 635 dbSNP
rs1182212116 636 dbSNP
rs1413580400 648 dbSNP
rs1471401722 651 dbSNP
rs906872094 655 dbSNP
rs1325682693 657 dbSNP
rs760937275 667 dbSNP
rs1439074181 672 dbSNP
rs6102084 673 dbSNP
rs764999138 675 dbSNP
rs1294616497 680 dbSNP
rs1359041803 691 dbSNP
rs919735312 694 dbSNP
rs1309902809 696 dbSNP
rs1348781101 703 dbSNP
rs973883828 708 dbSNP
rs901749653 710 dbSNP
rs1170769754 711 dbSNP
rs1276275370 713 dbSNP
rs939898530 716 dbSNP
rs1038736861 724 dbSNP
rs908452292 724 dbSNP
rs879079129 726 dbSNP
rs986738623 731 dbSNP
rs191234301 733 dbSNP
rs1030301287 742 dbSNP
rs1246885916 742 dbSNP
rs75726820 743 dbSNP
rs974772397 751 dbSNP
rs1171104643 753 dbSNP
rs1478818775 753 dbSNP
rs531501841 753 dbSNP
rs913369554 753 dbSNP
rs947574507 753 dbSNP
rs371933156 754 dbSNP
rs1053211315 758 dbSNP
rs759370998 761 dbSNP
rs1324323683 771 dbSNP
rs572475582 780 dbSNP
rs928865232 787 dbSNP
rs980156218 788 dbSNP
rs970435507 797 dbSNP
rs1228880701 803 dbSNP
rs1275262 808 dbSNP
rs1340009973 812 dbSNP
rs1194688183 825 dbSNP
rs1300730268 833 dbSNP
rs759494462 833 dbSNP
rs1452942453 835 dbSNP
rs1021690955 844 dbSNP
rs1012149050 846 dbSNP
rs534777130 849 dbSNP
rs1231603208 852 dbSNP
rs1252748650 856 dbSNP
rs577009931 868 dbSNP
rs892005959 870 dbSNP
rs1450417719 872 dbSNP
rs1032304395 873 dbSNP
rs750534890 875 dbSNP
rs1003135714 879 dbSNP
rs1026185497 882 dbSNP
rs11473416 884 dbSNP
rs1393023413 884 dbSNP
rs1403798472 888 dbSNP
rs906840973 902 dbSNP
rs150160659 903 dbSNP
rs1394907229 904 dbSNP
rs1435488736 921 dbSNP
rs1299572564 930 dbSNP
rs948392582 936 dbSNP
rs1226653050 940 dbSNP
rs898234957 950 dbSNP
rs1284269391 956 dbSNP
rs1357924457 961 dbSNP
rs1038157782 963 dbSNP
rs1207565990 982 dbSNP
rs1272073075 989 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' ucgUCCUCCCGACCCGUCCgc 5'
             | |||||  |||| ||  
Target 5' aaaAAGAGGG-AGGGCUGG-- 3'
2 - 19
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000426836.1 | 3UTR | AAAAGAGGGAGGGCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000426836.1 | 3UTR | AAAAAAGAGGGAGGGCUGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
69 hsa-miR-4763-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT116035 DEPDC1 DEP domain containing 1 2 2
MIRT347197 SIN3B SIN3 transcription regulator family member B 2 2
MIRT443248 C9orf170 chromosome 9 open reading frame 170 2 2
MIRT475164 IP6K1 inositol hexakisphosphate kinase 1 2 2
MIRT495486 VTI1B vesicle transport through interaction with t-SNAREs 1B 2 2
MIRT496755 TGIF2 TGFB induced factor homeobox 2 2 2
MIRT496863 C21orf2 chromosome 21 open reading frame 2 2 2
MIRT499264 NBPF11 NBPF member 11 2 2
MIRT499517 MAFK MAF bZIP transcription factor K 2 2
MIRT512952 MKI67 marker of proliferation Ki-67 2 2
MIRT514656 NUP93 nucleoporin 93 2 2
MIRT517986 SLC16A13 solute carrier family 16 member 13 2 2
MIRT522816 KLHL9 kelch like family member 9 2 4
MIRT525495 CD63 CD63 molecule 2 2
MIRT528111 FOXH1 forkhead box H1 2 2
MIRT531683 MYO3A myosin IIIA 2 2
MIRT534806 RAB37 RAB37, member RAS oncogene family 2 2
MIRT573041 SHMT1 serine hydroxymethyltransferase 1 2 2
MIRT576720 Wars tryptophanyl-tRNA synthetase 2 2
MIRT609727 MLXIPL MLX interacting protein like 2 2
MIRT610843 FAM180B family with sequence similarity 180 member B 2 4
MIRT614735 STAT5A signal transducer and activator of transcription 5A 2 2
MIRT616981 EPOR erythropoietin receptor 2 2
MIRT617265 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT619405 INTS7 integrator complex subunit 7 2 2
MIRT621832 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT621893 TAF13 TATA-box binding protein associated factor 13 2 2
MIRT630263 SMIM14 small integral membrane protein 14 2 2
MIRT634879 SENP8 SUMO/sentrin peptidase family member, NEDD8 specific 2 2
MIRT636863 ARSE arylsulfatase E (chondrodysplasia punctata 1) 2 2
MIRT637653 ADAT1 adenosine deaminase, tRNA specific 1 2 2
MIRT637699 ZNF439 zinc finger protein 439 2 2
MIRT637759 GATAD1 GATA zinc finger domain containing 1 2 2
MIRT638193 TAOK1 TAO kinase 1 2 2
MIRT638996 ADO 2-aminoethanethiol dioxygenase 2 2
MIRT642221 RABAC1 Rab acceptor 1 2 2
MIRT643327 ATCAY ATCAY, caytaxin 2 4
MIRT643419 ERVMER34-1 endogenous retrovirus group MER34 member 1, envelope 2 2
MIRT644499 RNF14 ring finger protein 14 2 2
MIRT644603 NT5DC3 5'-nucleotidase domain containing 3 2 2
MIRT644795 C21orf59 chromosome 21 open reading frame 59 2 2
MIRT648732 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT653856 SHE Src homology 2 domain containing E 2 2
MIRT654129 RPL14 ribosomal protein L14 2 4
MIRT658876 DSN1 DSN1 homolog, MIS12 kinetochore complex component 2 2
MIRT671624 C20orf144 chromosome 20 open reading frame 144 2 4
MIRT677367 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT677579 TRIM65 tripartite motif containing 65 2 2
MIRT678220 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT679613 RRP36 ribosomal RNA processing 36 2 2
MIRT686081 PNPLA3 patatin like phospholipase domain containing 3 2 2
MIRT691817 ICA1L islet cell autoantigen 1 like 2 2
MIRT693869 COX19 COX19, cytochrome c oxidase assembly factor 2 2
MIRT694544 BPNT1 3'(2'), 5'-bisphosphate nucleotidase 1 2 2
MIRT694926 ANKS4B ankyrin repeat and sterile alpha motif domain containing 4B 2 2
MIRT697758 USP37 ubiquitin specific peptidase 37 2 2
MIRT697891 UBE2B ubiquitin conjugating enzyme E2 B 2 2
MIRT701569 MYPN myopalladin 2 2
MIRT703081 GPRIN3 GPRIN family member 3 2 2
MIRT708104 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 2 2
MIRT708320 NT5C 5', 3'-nucleotidase, cytosolic 2 2
MIRT709878 TRAF1 TNF receptor associated factor 1 2 2
MIRT713545 GJB1 gap junction protein beta 1 2 2
MIRT716275 NUP85 nucleoporin 85 2 2
MIRT716621 CRCP CGRP receptor component 2 2
MIRT717987 C9orf171 cilia and flagella associated protein 77 2 2
MIRT718438 RAB11B RAB11B, member RAS oncogene family 2 2
MIRT722544 AGPAT4 1-acylglycerol-3-phosphate O-acyltransferase 4 2 2
MIRT724013 F2RL1 F2R like trypsin receptor 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4763 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-mir-4763 Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-mir-4763 Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-mir-4763 Vincristine 5978 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-mir-4763 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-4763 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-4763-5p Anthracycline 30323 NSC82151 approved resistant High Breast Cancer tissue
hsa-miR-4763-5p Fluorouracil 3385 NSC19893 approved resistant High Breast Cancer tissue
hsa-miR-4763-5p Cyclophosphamide 2907 NSC26271 approved resistant High Breast Cancer tissue
hsa-miR-4763-5p Methotrexate 126941 NSC740 approved resistant High Breast Cancer tissue
hsa-miR-4763-5p Taxol 36314 NSC125973 approved resistant High Breast Cancer tissue
hsa-miR-4763-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-4763-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-4763-5p Tamoxifen 2733525 NSC180973 approved sensitive cell line (LCC2)
hsa-miR-4763-5p Platinum 23939 sensitive tissue (non-small cell lung cancer)
hsa-miR-4763-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-4763-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-4763-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission