pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4457 |
Genomic Coordinates | chr5: 1309310 - 1309377 |
Description | Homo sapiens miR-4457 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4457 | |||||||||||||||||||||
Sequence | 43| UCACAAGGUAUUGACUGGCGUA |64 | |||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||
Experiments | Illumina | |||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | DEPTOR | ||||||||||||||||||||
Synonyms | DEP.6, DEPDC6 | ||||||||||||||||||||
Description | DEP domain containing MTOR interacting protein | ||||||||||||||||||||
Transcript | NM_022783 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on DEPTOR | |||||||||||||||||||||
3'UTR of DEPTOR (miRNA target sites are highlighted) |
>DEPTOR|NM_022783|3'UTR 1 GCTCCTGGGCCTCCCAGCCCTCCAGTGGCCTGTGGGTGAGGGAAGCCAGAATGACACAAAGCAATGCAAAGACAAGATTG 81 CCATGCAAATGGATGGTTTTGGACATACGAGTCTTCTCCGCACATACATGTCTAAAGTTGAGTTTTATACACTGAATGTG 161 GAAGAACCGGGTATCATATCTTTTTTAAAAAATGTCAGTGTAGAAAACATTTGGGAAACCATTTTCCTACATGATAGAAC 241 TGCCTTACTAGATTTCTATTTGTAGCTCTCATTCATTGTTTTTTATCTTAGTTTGCAGAAAGGTGTTGAAATGCTTCTCT 321 AGCCCAAACAGCGACATGCTAAAGTCCCCTTCTTCAGAGTCAATAGAGTAGTTGTTAAAGGTTTTAAATTGTACTTTCTC 401 CAAAATTAGCATGCAGCTATTTAATAGGGAATCTAGATTTCACCAAGATTCAAATCAAAGCAACATTTAAAGGAATAAGA 481 CCTGTTCACTAGCATTTTCAAGGGGGTTCTAAAGCATTCAAGTGCTTAAAAGCCATAAAAAATGACTTCTTAATTCCTGC 561 CTTTAGTGTCAACTTTTAAGTTAATACAGGTTTCAATTGTGGCATTAGGAAAAAAAAAAACCTTGTGATGCTATGGTTGG 641 GGGTAGTTAGGGAGAGACTACATGAAATTGTGTGCCCCTATTTTCTTTCTGATCCTAAATCATTTTGTTTTATAAATCAG 721 CTATAGCATCTTTCTAGAATTAATCCTGAATATGTTGAATGTTAAAATAGAGAAGTTTGTATATACACATAATTAAAAAT 801 CAACCCTTCTGGCAAGATTTCACTTTGAAGGTGTCTGTTTTTAAGGGAAGGCTAAAACTTTGCTGATATGTGATAAAACT 881 TGAACTCTAAATTGCCTCCTTAGCCTGAATTTTTACTAGCTTTCTAGTGTAACATATTCTAAGGACATGACATGCTGCTT 961 ATTTGGGGGGATTATTTTTCACCAAAATGATCATCTTGTGTTGTAACTTTTCAGCTCACTTGTATATACGCACGTTTTCA 1041 TTTTTGGTCTAGAAAATAGTGCATTTTGGGGCTCAGCGTGCAGAGGAAATTCCTCAAAGTGCCAAATTAGGCAGTCAGGA 1121 AATACTAAATTCTTCATTCCAAATAATGGATCTGAATGATGACGTTAATTTTTTATCATGCATTAACAAAATAAAATATG 1201 AGAATTGTACCACA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293S |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
CLIP-seq Support 1 for dataset GSM1084065 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_emetine_AbnovaAb |
Location of target site | ENST00000286234.5 | 3UTR | AUUAGGAAAAAAAAAAAC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
83 hsa-miR-4457 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT098032 | SOBP | sine oculis binding protein homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT202580 | PCMTD2 | protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT247137 | WEE1 | WEE1 G2 checkpoint kinase | ![]() |
![]() |
2 | 4 | ||||||
MIRT349266 | PTBP1 | polypyrimidine tract binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT363756 | EIF4EBP1 | eukaryotic translation initiation factor 4E binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443586 | FAM84B | family with sequence similarity 84 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT452333 | EIF5AL1 | eukaryotic translation initiation factor 5A-like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453864 | ZBTB40 | zinc finger and BTB domain containing 40 | ![]() |
![]() |
2 | 4 | ||||||
MIRT471486 | PDE4D | phosphodiesterase 4D | ![]() |
![]() |
2 | 4 | ||||||
MIRT476290 | GMFB | glia maturation factor beta | ![]() |
![]() |
2 | 8 | ||||||
MIRT479897 | CCDC117 | coiled-coil domain containing 117 | ![]() |
![]() |
2 | 4 | ||||||
MIRT484251 | ANK1 | ankyrin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491473 | TMEM214 | transmembrane protein 214 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493804 | GAN | gigaxonin | ![]() |
![]() |
2 | 6 | ||||||
MIRT499252 | VAV3 | vav guanine nucleotide exchange factor 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT502271 | HNRNPA1 | heterogeneous nuclear ribonucleoprotein A1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT504651 | RPL9 | ribosomal protein L9 | ![]() |
![]() |
2 | 6 | ||||||
MIRT505211 | UBN2 | ubinuclein 2 | ![]() |
![]() |
2 | 8 | ||||||
MIRT508952 | SNRPB | small nuclear ribonucleoprotein polypeptides B and B1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT512691 | POP1 | POP1 homolog, ribonuclease P/MRP subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT513320 | SCUBE3 | signal peptide, CUB domain and EGF like domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT513870 | HOXA5 | homeobox A5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT517342 | ZNF529 | zinc finger protein 529 | ![]() |
![]() |
2 | 4 | ||||||
MIRT518947 | LSG1 | large 60S subunit nuclear export GTPase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT520867 | SUGT1 | SGT1 homolog, MIS12 kinetochore complex assembly cochaperone | ![]() |
![]() |
2 | 2 | ||||||
MIRT528325 | GIGYF2 | GRB10 interacting GYF protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531990 | SLCO1B3 | solute carrier organic anion transporter family member 1B3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533298 | USP46 | ubiquitin specific peptidase 46 | ![]() |
![]() |
2 | 2 | ||||||
MIRT545257 | TRIM36 | tripartite motif containing 36 | ![]() |
![]() |
2 | 4 | ||||||
MIRT547038 | POGZ | pogo transposable element derived with ZNF domain | ![]() |
![]() |
2 | 2 | ||||||
MIRT556103 | MOAP1 | modulator of apoptosis 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT558321 | DR1 | down-regulator of transcription 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT558521 | CSRNP3 | cysteine and serine rich nuclear protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT560906 | TMED10 | transmembrane p24 trafficking protein 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568448 | ARPP19 | cAMP regulated phosphoprotein 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570586 | OTUD7B | OTU deubiquitinase 7B | ![]() |
![]() |
2 | 2 | ||||||
MIRT572799 | SIGLEC14 | sialic acid binding Ig like lectin 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573863 | C9orf78 | chromosome 9 open reading frame 78 | ![]() |
![]() |
2 | 2 | ||||||
MIRT575058 | P2ry1 | purinergic receptor P2Y, G-protein coupled 1 | ![]() |
![]() |
2 | 5 | ||||||
MIRT609931 | SLC38A1 | solute carrier family 38 member 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT610836 | ZNF585A | zinc finger protein 585A | ![]() |
![]() |
2 | 4 | ||||||
MIRT611474 | P2RY1 | purinergic receptor P2Y1 | ![]() |
![]() |
2 | 7 | ||||||
MIRT613569 | YY2 | YY2 transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT618626 | GREB1 | growth regulation by estrogen in breast cancer 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT620606 | SAP30 | Sin3A associated protein 30 | ![]() |
![]() |
2 | 2 | ||||||
MIRT621017 | CLSTN3 | calsyntenin 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT635314 | FAM179A | TOG array regulator of axonemal microtubules 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635919 | GLTSCR2 | NOP53 ribosome biogenesis factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT640598 | TM9SF4 | transmembrane 9 superfamily member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641784 | YWHAB | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta | ![]() |
![]() |
2 | 4 | ||||||
MIRT644067 | IQCE | IQ motif containing E | ![]() |
![]() |
2 | 2 | ||||||
MIRT648288 | TRAPPC2L | trafficking protein particle complex 2 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT658085 | FOXR2 | forkhead box R2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT659077 | DEPTOR | DEP domain containing MTOR interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT665307 | ZBTB37 | zinc finger and BTB domain containing 37 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665975 | SYTL4 | synaptotagmin like 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT666302 | SLC25A25 | solute carrier family 25 member 25 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674906 | RASSF9 | Ras association domain family member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT680086 | THAP1 | THAP domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681488 | DIP2A | disco interacting protein 2 homolog A | ![]() |
![]() |
2 | 2 | ||||||
MIRT691244 | DFNB59 | pejvakin | ![]() |
![]() |
2 | 2 | ||||||
MIRT692362 | AGTRAP | angiotensin II receptor associated protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT693035 | MB21D1 | Mab-21 domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693837 | STAT5A | signal transducer and activator of transcription 5A | ![]() |
![]() |
2 | 2 | ||||||
MIRT694479 | LRTOMT | leucine rich transmembrane and O-methyltransferase domain containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT696070 | ZNF264 | zinc finger protein 264 | ![]() |
![]() |
2 | 2 | ||||||
MIRT696578 | TTC21B | tetratricopeptide repeat domain 21B | ![]() |
![]() |
2 | 2 | ||||||
MIRT696760 | MTFMT | mitochondrial methionyl-tRNA formyltransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT697307 | ZNF652 | zinc finger protein 652 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700152 | RNF115 | ring finger protein 115 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701056 | PARP2 | poly(ADP-ribose) polymerase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701198 | OTUD3 | OTU deubiquitinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701335 | NSD1 | nuclear receptor binding SET domain protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT702656 | ITGA3 | integrin subunit alpha 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703618 | FBXO45 | F-box protein 45 | ![]() |
![]() |
2 | 2 | ||||||
MIRT704673 | CHTOP | chromatin target of PRMT1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT708894 | ZNF780A | zinc finger protein 780A | ![]() |
![]() |
2 | 2 | ||||||
MIRT711620 | DGKH | diacylglycerol kinase eta | ![]() |
![]() |
2 | 2 | ||||||
MIRT713745 | TMEM81 | transmembrane protein 81 | ![]() |
![]() |
2 | 2 | ||||||
MIRT719712 | CD101 | CD101 molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT720294 | DLGAP3 | DLG associated protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT722606 | CCDC152 | coiled-coil domain containing 152 | ![]() |
![]() |
2 | 2 | ||||||
MIRT724566 | ACSBG1 | acyl-CoA synthetase bubblegum family member 1 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|