pre-miRNA Information
pre-miRNA hsa-mir-378g   
Genomic Coordinates chr1: 94745860 - 94745900
Description Homo sapiens miR-378g stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-378g
Sequence 2| ACUGGGCUUGGAGUCAGAAG |21
Evidence Experimental
Experiments Illumina
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MEI1   
Synonyms SPATA38
Description meiotic double-stranded break formation protein 1
Transcript NM_152513   
Expression
Putative miRNA Targets on MEI1
3'UTR of MEI1
(miRNA target sites are highlighted)
>MEI1|NM_152513|3'UTR
   1 TCCTCAGGACTTGAAGGCCCAGAAGTGGAGAGAGAATGAGACCTGGAGACAAAGGGCATAATTGTTGGGGAAATGGATGA
  81 CAGCTGAAGCTATTCATATGGAGCCATATACTCTATTGTTGAAATAGAATAAGGAAATAAAATGATACACTCACAT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' gaagaCUGAG-GUUCGGGUCa 5'
               ||||:  |:|||||| 
Target 5' ctcagGACTTGAAGGCCCAGa 3'
3 - 23 139.00 -18.20
2
miRNA  3' gaaGACUGAGGUUCGGguca 5'
             :| |: : :||||    
Target 5' ctaTTCATATGGAGCCatat 3'
90 - 109 85.00 -6.70
3
miRNA  3' gaagACUGAGGUUCGgguca 5'
              ||||    |||     
Target 5' tggaTGAC----AGCtgaag 3'
74 - 89 66.00 -5.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26984181 8 COSMIC
COSN30454844 21 COSMIC
COSN509382 23 COSMIC
COSN30482654 47 COSMIC
COSN30102539 62 COSMIC
COSN30104418 76 COSMIC
COSN26739218 95 COSMIC
COSN166765 108 COSMIC
COSN5137217 119 COSMIC
COSN30160360 122 COSMIC
COSN30510007 138 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1336348503 5 dbSNP
rs1241101876 8 dbSNP
rs771223149 9 dbSNP
rs1328248916 13 dbSNP
rs562828197 14 dbSNP
rs1353088604 18 dbSNP
rs1289690459 22 dbSNP
rs181404057 22 dbSNP
rs924320122 23 dbSNP
rs759640205 25 dbSNP
rs767713885 26 dbSNP
rs776069887 31 dbSNP
rs761327867 35 dbSNP
rs764351052 37 dbSNP
rs373052509 42 dbSNP
rs201702273 43 dbSNP
rs757597232 44 dbSNP
rs1391872525 49 dbSNP
rs749663310 51 dbSNP
rs1460061913 57 dbSNP
rs1298784981 59 dbSNP
rs141703079 62 dbSNP
rs1472277619 63 dbSNP
rs200233383 65 dbSNP
rs370426055 73 dbSNP
rs938482196 74 dbSNP
rs915617301 83 dbSNP
rs1453176659 98 dbSNP
rs917982258 102 dbSNP
rs865917916 103 dbSNP
rs948599105 106 dbSNP
rs139561 108 dbSNP
rs909703383 114 dbSNP
rs939952544 117 dbSNP
rs1036945954 126 dbSNP
rs1278339165 130 dbSNP
rs897830917 131 dbSNP
rs1439217841 149 dbSNP
rs755682582 151 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' gaagaCUGAGGUUCGGGUCa 5'
               ||   ::|| || | 
Target 5' ggagaGAGAAUGAGACCUGg 3'
7 - 26
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_152513 | 3UTR | AAGUGGAGAGAGAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000400107.1 | 3UTR | AGAAGUGGAGAGAGAAUGAGACCUGGAGAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
68 hsa-miR-378g Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT444739 SMYD1 SET and MYND domain containing 1 2 2
MIRT456104 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT458683 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT465802 TMEM91 transmembrane protein 91 2 2
MIRT470843 PLXND1 plexin D1 2 2
MIRT497263 GRK6 G protein-coupled receptor kinase 6 2 2
MIRT497674 SYNGR1 synaptogyrin 1 2 2
MIRT498218 TLN2 talin 2 2 2
MIRT498309 BCL11B B-cell CLL/lymphoma 11B 2 2
MIRT504046 TOMM5 translocase of outer mitochondrial membrane 5 2 2
MIRT518196 CLEC4E C-type lectin domain family 4 member E 2 2
MIRT533143 WNT10A Wnt family member 10A 2 2
MIRT533540 TPR translocated promoter region, nuclear basket protein 2 2
MIRT533679 TMEM86A transmembrane protein 86A 2 2
MIRT540892 SRSF9 serine and arginine rich splicing factor 9 2 2
MIRT541329 G3BP1 G3BP stress granule assembly factor 1 2 2
MIRT541850 PLIN5 perilipin 5 2 2
MIRT551431 F2 coagulation factor II, thrombin 2 2
MIRT552105 PPP1R1A protein phosphatase 1 regulatory inhibitor subunit 1A 2 2
MIRT564912 YTHDF1 YTH N6-methyladenosine RNA binding protein 1 2 2
MIRT568605 ACVR2A activin A receptor type 2A 2 2
MIRT572604 PAPLN papilin, proteoglycan like sulfated glycoprotein 2 2
MIRT574234 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT575688 Map1b microtubule-associated protein 1B 2 2
MIRT576643 Mill2 MHC I like leukocyte 2 1 1
MIRT609877 RAD54L2 RAD54 like 2 2 4
MIRT610057 MYBPC1 myosin binding protein C, slow type 2 2
MIRT610791 KLK2 kallikrein related peptidase 2 2 2
MIRT617175 GOSR2 golgi SNAP receptor complex member 2 2 2
MIRT617707 RUSC2 RUN and SH3 domain containing 2 2 2
MIRT620577 WBSCR27 methyltransferase like 27 2 4
MIRT622657 POU2F3 POU class 2 homeobox 3 2 4
MIRT624561 BDP1 B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB 2 2
MIRT634255 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT634677 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT635254 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT637081 SELPLG selectin P ligand 2 2
MIRT639021 AAK1 AP2 associated kinase 1 2 2
MIRT640396 ZNF785 zinc finger protein 785 2 2
MIRT642441 CLUAP1 clusterin associated protein 1 2 2
MIRT645666 ADK adenosine kinase 2 2
MIRT646083 MGST3 microsomal glutathione S-transferase 3 2 2
MIRT650513 UFM1 ubiquitin fold modifier 1 2 2
MIRT652474 TMEM181 transmembrane protein 181 2 2
MIRT652584 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT654763 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 2
MIRT655200 PHAX phosphorylated adaptor for RNA export 2 2
MIRT658353 FAM65B RHO family interacting cell polarization regulator 2 2 2
MIRT661820 PRPSAP1 phosphoribosyl pyrophosphate synthetase associated protein 1 2 2
MIRT662190 MEI1 meiotic double-stranded break formation protein 1 2 2
MIRT664375 CYB5A cytochrome b5 type A 2 2
MIRT665025 ELK1 ELK1, ETS transcription factor 2 2
MIRT666492 SBNO1 strawberry notch homolog 1 2 2
MIRT668480 EXOSC2 exosome component 2 2 2
MIRT682768 TMEM120B transmembrane protein 120B 2 2
MIRT689628 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT691846 OSCAR osteoclast associated, immunoglobulin-like receptor 2 2
MIRT696490 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT712480 FSTL3 follistatin like 3 2 2
MIRT712780 ZNF154 zinc finger protein 154 2 2
MIRT716607 MPPED1 metallophosphoesterase domain containing 1 2 2
MIRT719357 ITPKB inositol-trisphosphate 3-kinase B 2 2
MIRT719739 SLC39A11 solute carrier family 39 member 11 2 2
MIRT722569 C1orf95 stum, mechanosensory transduction mediator homolog 2 2
MIRT722838 C17orf102 chromosome 17 open reading frame 102 2 2
MIRT733138 LINC00963 long intergenic non-protein coding RNA 963 3 0
MIRT733139 CHI3L1 chitinase 3 like 1 3 0
MIRT736944 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-378g Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-378g Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-378g Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-378g Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-378g Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (500nM)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (500nM)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-miR-378g Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-miR-378g Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-378g Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line
hsa-miR-378g Dabrafenib + Trametinib sensitive High Melanoma cell line
hsa-miR-378g Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line
hsa-mir-378g Decitabine 451668 approved sensitive tissue (esopheageal cancer)
hsa-miR-378g Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-378g Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-378g Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-378g Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-378g Tripterygium wilfordii Hook F resistant tissue
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM36)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-378g Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-378g Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-378g Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-378g Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-378g Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission