pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4282 |
Genomic Coordinates | chr6: 72967687 - 72967753 |
Description | Homo sapiens miR-4282 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4282 | ||||||||||||
Sequence | 40| UAAAAUUUGCAUCCAGGA |57 | ||||||||||||
Evidence | Experimental | ||||||||||||
Experiments | SOLiD | DRVs in miRNA |
|
||||||||||
SNPs in miRNA |
|
||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | RALGAPA1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | GARNL1, GRIPE, RalGAPalpha1, TULIP1, p240 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | Ral GTPase activating protein catalytic alpha subunit 1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_014990 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Other Transcripts | NM_194301 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on RALGAPA1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of RALGAPA1 (miRNA target sites are highlighted) |
>RALGAPA1|NM_014990|3'UTR 1 ATATCAGTTCTGTTTATCTGAAGGCTCCTACCCAGAGATTCTACCCAGTGAAACTCCCACAGCAACGCAGGTAGATGGGG 81 CTGACCTGGCCTCTCCAATGTCTCCTCGAACTAGCAAAAGCCGCATGTCCATGAAGCTGCGTCGTTCCTCTGGCTCAGCC 161 AATAAATCCTAAGGAGACAAGCAGCCCAGCAGTGATCAGCAGTAGCCACCTTAGCACGAACATAGGGTTAACCCTTTCAG 241 GCCTTCATGTCTGCCATAACATGCATGTTTCTTCCTGTACATTTATTTGAGAAAACACTGGATTTAAATAATTTTAAATA 321 ATTTGTAGCTTAATATTAAAGATTTAAGTTATTTATTGTTTCATTTTTTTTCCCACAATCCAAGCTGCCATATTTTGAGG 401 GCAGGGGGAGTTTTATTCTACACCCTTTACCTTCCTAGATAATTATGTCTAAGTAGTTTTATCTTTAATTTCATGGTTAA 481 CTGTGAGCCAAAATACAATTGGACAATTAGTCTCATTATTTATTGTGCCCCATTGCAACTTTATGGTTCAATAAATATAT 561 AATTTTTTACAAATGTAAAATTTTACATTTAAGCATTTGTAAAGTTACAGCAAAAGATGTACCTGTTAATACACAGAATG 641 TGTACAGATTATTTGTTATGACAATAAAACACTCAAAATAAATGGTCTTTAGCATCTCAAATTCCAACTGAAATCATTTT 721 AGTATTAACTCTTCTTCCCAAAGCAATGTCTCATTTCTTGGCTGTGCAGGTGATGCCATGTTATATCCAATAACTAGAAA 801 AATCACTGTGCTGAACTTTTATGTTTAGCTTCCAAGTATTTTTCTAATGTTTTGCATTTCAAGTGGTATCACTGTTAAAT 881 GCCATTTGTTTTCAGATTGTGGCCTTTTATTATTGGCTGCTAGATCCTGGTGTTTCTATGTTCTTTTTTAAGCACCAAAA 961 AGAAGATGGGGAAGAAAAGAAGGAAAATTTTCTGATATAAATATGTTGTTCAAATTATGAGTATTATTTAAAAAAGAAAA 1041 AGGAACATAACCCAGGAGTCTAAGTTAAATCTAATATTGTTAATACTGAACTTGCAGGTCCAGGTTGGTATACATTCCAC 1121 CCTCTAGAAGTATTTTCTTACAGTAGATAAGCTGCTCACATTTTGTTTTGAATGGGCATCTCCTGAGGAAATGTAGCATG 1201 ACATTGGTACTAACTGCATGTGTAAATACATCATACTGGCAAACCGTAAAATATAAATTATGTATCATCATTCATGTAGT 1281 ATCTATAATTTGTAACAGTGGGGGGGAAAGATGACATGGTATTTAATAATACAATAAAAATATTCTTATCACTTCCTATC 1361 CAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293S |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
CLIP-seq Support 1 for dataset GSM4903833 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / CTL_TD_21_a |
Location of target site | NM_014990 | 3UTR | UUUUUUAAGCACCAAAAAGAAGAUGGGGAAGAAAAGAAGGAAAAUUUUCUGAUAUAAAUAUGUUGUUCAAAUUAUGAGUAUUA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM4903838 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / 124_TD_21_c |
Location of target site | NM_014990 | 3UTR | AAGAAAAGAAGGAAAAUUUUCUGAUAUAAAUAUGUUGUUCAAAUUAUGAGUAUUA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM1084064 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noemetine_AbnovaAb |
Location of target site | ENST00000389698.3 | 3UTR | AGAAGAUGGGGAAGAAAAGAAGGAAAAUUUUCU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
280 hsa-miR-4282 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT057628 | LCOR | ligand dependent nuclear receptor corepressor | ![]() |
![]() |
2 | 2 | ||||||
MIRT060732 | RPS3 | ribosomal protein S3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT063371 | ETNK1 | ethanolamine kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT066257 | LRIG3 | leucine rich repeats and immunoglobulin like domains 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT070774 | HIF1A | hypoxia inducible factor 1 alpha subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT070871 | EIF2S1 | eukaryotic translation initiation factor 2 subunit alpha | ![]() |
![]() |
2 | 4 | ||||||
MIRT078056 | PCTP | phosphatidylcholine transfer protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT078408 | DCAF7 | DDB1 and CUL4 associated factor 7 | ![]() |
![]() |
2 | 4 | ||||||
MIRT084059 | PPP1R3D | protein phosphatase 1 regulatory subunit 3D | ![]() |
![]() |
2 | 2 | ||||||
MIRT093537 | GALNT7 | polypeptide N-acetylgalactosaminyltransferase 7 | ![]() |
![]() |
2 | 6 | ||||||
MIRT096072 | SFXN1 | sideroflexin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT098316 | REV3L | REV3 like, DNA directed polymerase zeta catalytic subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT100493 | UHRF1BP1 | UHRF1 binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT102254 | HBP1 | HMG-box transcription factor 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT105318 | VPS37A | VPS37A, ESCRT-I subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT114143 | MZT1 | mitotic spindle organizing protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT114873 | DICER1 | dicer 1, ribonuclease III | ![]() |
![]() |
2 | 2 | ||||||
MIRT134683 | PNRC2 | proline rich nuclear receptor coactivator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT137640 | RCOR1 | REST corepressor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT155449 | CCNT2 | cyclin T2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT165656 | DCTN4 | dynactin subunit 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT177570 | CSTF2T | cleavage stimulation factor subunit 2 tau variant | ![]() |
![]() |
2 | 4 | ||||||
MIRT188514 | E2F7 | E2F transcription factor 7 | ![]() |
![]() |
2 | 10 | ||||||
MIRT193019 | TMOD3 | tropomodulin 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT195823 | GADD45A | growth arrest and DNA damage inducible alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT195885 | DEPDC1 | DEP domain containing 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT206029 | NUP50 | nucleoporin 50 | ![]() |
![]() |
2 | 6 | ||||||
MIRT212148 | CLCN3 | chloride voltage-gated channel 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT213999 | DCP2 | decapping mRNA 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT214650 | HNRNPA0 | heterogeneous nuclear ribonucleoprotein A0 | ![]() |
![]() |
2 | 2 | ||||||
MIRT221568 | CBX3 | chromobox 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT224544 | ZNF623 | zinc finger protein 623 | ![]() |
![]() |
2 | 2 | ||||||
MIRT227654 | SET | SET nuclear proto-oncogene | ![]() |
![]() |
2 | 2 | ||||||
MIRT229992 | CHIC1 | cysteine rich hydrophobic domain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT238968 | QKI | QKI, KH domain containing RNA binding | ![]() |
![]() |
2 | 2 | ||||||
MIRT239825 | ACTB | actin beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT241084 | ZXDA | zinc finger, X-linked, duplicated A | ![]() |
![]() |
2 | 4 | ||||||
MIRT244852 | ZBTB5 | zinc finger and BTB domain containing 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT264534 | TARDBP | TAR DNA binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT271438 | SKI | SKI proto-oncogene | ![]() |
![]() |
2 | 2 | ||||||
MIRT271597 | ENAH | ENAH, actin regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT294332 | ZNF264 | zinc finger protein 264 | ![]() |
![]() |
2 | 2 | ||||||
MIRT296341 | PARD6B | par-6 family cell polarity regulator beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT301715 | TEF | TEF, PAR bZIP transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT308549 | ZNF654 | zinc finger protein 654 | ![]() |
![]() |
2 | 2 | ||||||
MIRT313866 | DEPDC1B | DEP domain containing 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT315529 | MARCKS | myristoylated alanine rich protein kinase C substrate | ![]() |
![]() |
2 | 2 | ||||||
MIRT321066 | RABGEF1 | RAB guanine nucleotide exchange factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT343777 | NUTF2 | nuclear transport factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT359109 | MAP1B | microtubule associated protein 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT397393 | GOLGA3 | golgin A3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT400822 | CPEB2 | cytoplasmic polyadenylation element binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT442171 | DSEL | dermatan sulfate epimerase-like | ![]() |
![]() |
2 | 2 | ||||||
MIRT442777 | JAG1 | jagged 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT442862 | SCARF1 | scavenger receptor class F member 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT442919 | PCBD2 | pterin-4 alpha-carbinolamine dehydratase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT444567 | TRA2B | transformer 2 beta homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT444718 | CMSS1 | cms1 ribosomal small subunit homolog (yeast) | ![]() |
![]() |
2 | 2 | ||||||
MIRT445018 | RBMS3 | RNA binding motif single stranded interacting protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT445853 | LRRC1 | leucine rich repeat containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446242 | HELZ | helicase with zinc finger | ![]() |
![]() |
2 | 2 | ||||||
MIRT446542 | GOLGA8B | golgin A8 family member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT446643 | SPTY2D1 | SPT2 chromatin protein domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446948 | ZMAT3 | zinc finger matrin-type 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT447061 | KCNAB1 | potassium voltage-gated channel subfamily A member regulatory beta subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT447327 | ZSCAN21 | zinc finger and SCAN domain containing 21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT447995 | CDX1 | caudal type homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT448543 | RHEBP1 | RHEB pseudogene 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT448752 | HINT1 | histidine triad nucleotide binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT448772 | GOLGA8A | golgin A8 family member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT449342 | WDR26 | WD repeat domain 26 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450011 | SLC16A6 | solute carrier family 16 member 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT450229 | PCNX | pecanex homolog 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450340 | MRPL17 | mitochondrial ribosomal protein L17 | ![]() |
![]() |
2 | 4 | ||||||
MIRT450381 | MSI2 | musashi RNA binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450759 | PGGT1B | protein geranylgeranyltransferase type I subunit beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT450809 | NRCAM | neuronal cell adhesion molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT450947 | ATAD2 | ATPase family, AAA domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459095 | CCPG1 | cell cycle progression 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT462428 | TWISTNB | TWIST neighbor | ![]() |
![]() |
2 | 2 | ||||||
MIRT465200 | TROVE2 | TROVE domain family member 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT467382 | SON | SON DNA binding protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT468546 | SERP1 | stress associated endoplasmic reticulum protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471506 | PDE4D | phosphodiesterase 4D | ![]() |
![]() |
2 | 2 | ||||||
MIRT471981 | NR3C1 | nuclear receptor subfamily 3 group C member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT474478 | KLHL11 | kelch like family member 11 | ![]() |
![]() |
2 | 8 | ||||||
MIRT475011 | KANSL1 | KAT8 regulatory NSL complex subunit 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT480341 | C5orf51 | chromosome 5 open reading frame 51 | ![]() |
![]() |
2 | 2 | ||||||
MIRT482696 | TEX9 | testis expressed 9 | ![]() |
![]() |
2 | 6 | ||||||
MIRT483462 | YTHDF1 | YTH N6-methyladenosine RNA binding protein 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT485623 | FAM217B | family with sequence similarity 217 member B |