pre-miRNA Information
pre-miRNA hsa-mir-873   
Genomic Coordinates chr9: 28888879 - 28888955
Synonyms MIRN873, hsa-mir-873, MIR873
Description Homo sapiens miR-873 stem-loop
Comment This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-873-3p
Sequence 46| GGAGACUGAUGAGUUCCCGGGA |67
Evidence Not_experimental
Experiments
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs760528397 3 dbSNP
rs773403294 9 dbSNP
rs1273846238 13 dbSNP
rs1339396073 15 dbSNP
rs1247999695 18 dbSNP
rs377380148 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NKAPL   
Synonyms C6orf194, bA424I5.1
Description NFKB activating protein like
Transcript NM_001007531   
Expression
Putative miRNA Targets on NKAPL
3'UTR of NKAPL
(miRNA target sites are highlighted)
>NKAPL|NM_001007531|3'UTR
   1 GGACTTACTTGTTGCACAGCAGGAATTTTAACAACAAAAATTTTATGTGACCAAAAGTGTTAAAAGGCTTTACAGTGCTA
  81 CTGTACTTACCATATTAGTAAGTCCCTCAGGAAAAAGCTTCTTTTGAGATATCTTTAGCAGCTTATTTTTTGTTATTTTA
 161 ACTTTAAAAAGTAATATGTGCACATGGTTTTAAAAATATTCAACCATTATAGGAGGAGAGTTAGTAAAAAGTGAATCTTT
 241 CACTTTAGCCCCTGACACCTTTCCCCCAAAAATATATATTTTGGTGTCTTATATACAGAATATACATTCTGTGCATATAC
 321 AAGAGTATATGTTGCAGCATAAAGATTAAAAGCTATTAAAGTTTTTTTTCGCTCGTTAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' agggccCUUGAGUAGUCAGAgg 5'
                |||: :| || |||  
Target 5' tatacaGAATATA-CATTCTgt 3'
292 - 312 99.00 -9.20
2
miRNA  3' agggcccUUGAGUAGUCA-GAgg 5'
                 ::||:  |||| ||  
Target 5' gttaaaaGGCTTTACAGTGCTac 3'
59 - 81 95.00 -5.30
3
miRNA  3' agggCCCUUGAGUAGUCAGAgg 5'
              | |||: : ||| |:|  
Target 5' aaaaGTGAATCTTTCACTTTag 3'
227 - 248 90.00 -9.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31526731 15 COSMIC
COSN31574832 84 COSMIC
COSN14214851 122 COSMIC
COSN15625474 122 COSMIC
COSN30111998 134 COSMIC
COSN31599125 150 COSMIC
COSN31599794 158 COSMIC
COSN32063431 167 COSMIC
COSN31602586 184 COSMIC
COSN30141515 207 COSMIC
COSN30533464 207 COSMIC
COSN30142081 355 COSMIC
COSN30114189 359 COSMIC
COSN22030601 364 COSMIC
COSN30120380 367 COSMIC
COSN22785550 370 COSMIC
COSN15625475 371 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs753687717 3 dbSNP
rs753022676 4 dbSNP
rs528411964 15 dbSNP
rs754687793 18 dbSNP
rs764759346 18 dbSNP
rs778948262 19 dbSNP
rs112074048 20 dbSNP
rs1228420786 30 dbSNP
rs374658602 32 dbSNP
rs1310070674 46 dbSNP
rs745756653 50 dbSNP
rs1256351657 51 dbSNP
rs1391809882 53 dbSNP
rs1005732514 54 dbSNP
rs560023814 55 dbSNP
rs1398345344 60 dbSNP
rs1015269418 74 dbSNP
rs1428630647 81 dbSNP
rs1265193978 83 dbSNP
rs114643216 88 dbSNP
rs565170463 93 dbSNP
rs1453148620 94 dbSNP
rs1187013999 111 dbSNP
rs919001818 121 dbSNP
rs1183136949 122 dbSNP
rs929005218 129 dbSNP
rs1248779449 153 dbSNP
rs1049189312 163 dbSNP
rs908855812 168 dbSNP
rs948660739 180 dbSNP
rs188555654 183 dbSNP
rs1044286031 198 dbSNP
rs533211104 200 dbSNP
rs550146028 202 dbSNP
rs1239670658 211 dbSNP
rs1337312327 217 dbSNP
rs1002705275 221 dbSNP
rs1053228615 227 dbSNP
rs1355650880 232 dbSNP
rs1314298932 242 dbSNP
rs927924029 250 dbSNP
rs1432382051 251 dbSNP
rs1400868508 253 dbSNP
rs779615798 253 dbSNP
rs1455754443 257 dbSNP
rs959543603 268 dbSNP
rs764113675 270 dbSNP
rs1419723510 276 dbSNP
rs1181489579 279 dbSNP
rs1475723567 285 dbSNP
rs1259941871 287 dbSNP
rs1186064591 289 dbSNP
rs11558330 297 dbSNP
rs1159820335 303 dbSNP
rs569815827 316 dbSNP
rs1413451753 320 dbSNP
rs915038268 321 dbSNP
rs535512875 323 dbSNP
rs1205657817 327 dbSNP
rs549254021 330 dbSNP
rs1022061662 331 dbSNP
rs1258773332 332 dbSNP
rs1380349251 345 dbSNP
rs1227599503 354 dbSNP
rs765982306 356 dbSNP
rs549179284 359 dbSNP
rs1007559388 362 dbSNP
rs1339381069 362 dbSNP
rs1384454074 363 dbSNP
rs867116864 371 dbSNP
rs1019784589 372 dbSNP
rs965554332 374 dbSNP
rs151130565 375 dbSNP
rs1241012196 376 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048188. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_ptb_knockdown ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Cardiac Tissues
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM2202481. RNA binding protein: AGO2. Condition:S6_LV_61yo_Male_AGO2_bound_RNA HITS-CLIP data was present in GSM2202478. RNA binding protein: AGO2. Condition:S3_LV_36yo_Male_AGO2_bound_RNA HITS-CLIP data was present in GSM2202476. RNA binding protein: AGO2. Condition:S1_LV_54yo_Male_AGO2_bound_RNA HITS-CLIP data was present in GSM2202477. RNA binding protein: AGO2. Condition:S2_LV_25yo_Male_AGO2_bound_RNA ...

- Spengler RM; Zhang X; Cheng C; McLendon JM; et al., 2016, Nucleic acids research.

Article - Spengler RM; Zhang X; Cheng C; McLendon JM; et al.
- Nucleic acids research, 2016
MicroRNAs (miRs) have emerged as key biological effectors in human health and disease. These small noncoding RNAs are incorporated into Argonaute (Ago) proteins, where they direct post-transcriptional gene silencing via base-pairing with target transcripts. Although miRs have become intriguing biological entities and attractive therapeutic targets, the translational impacts of miR research remain limited by a paucity of empirical miR targeting data, particularly in human primary tissues. Here, to improve our understanding of the diverse roles miRs play in cardiovascular function and disease, we applied high-throughput methods to globally profile miR:target interactions in human heart tissues. We deciphered Ago2:RNA interactions using crosslinking immunoprecipitation coupled with high-throughput sequencing (HITS-CLIP) to generate the first transcriptome-wide map of miR targeting events in human myocardium, detecting 4000 cardiac Ago2 binding sites across >2200 target transcripts. Our initial exploration of this interactome revealed an abundance of miR target sites in gene coding regions, including several sites pointing to new miR-29 functions in regulating cardiomyocyte calcium, growth and metabolism. Also, we uncovered several clinically-relevant interactions involving common genetic variants that alter miR targeting events in cardiomyopathy-associated genes. Overall, these data provide a critical resource for bolstering translational miR research in heart, and likely beyond.
LinkOut: [PMID: 27418678]
CLIP-seq Support 1 for dataset GSM1048188
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_ptb_knockdown
Location of target site ENST00000343684.3 | 3UTR | GUCUCACACACACACACACACACAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000343684.3 | 3UTR | GUCUCACACACACACACACACACACACACACAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
108 hsa-miR-873-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT081178 MIDN midnolin 2 4
MIRT109809 ZFX zinc finger protein, X-linked 2 4
MIRT242383 TMC5 transmembrane channel like 5 2 4
MIRT444003 METRN meteorin, glial cell differentiation regulator 2 4
MIRT444097 SEPHS1 selenophosphate synthetase 1 2 2
MIRT446158 RPL12 ribosomal protein L12 2 2
MIRT446859 SAMD9L sterile alpha motif domain containing 9 like 2 2
MIRT447275 FZD5 frizzled class receptor 5 2 2
MIRT447391 TMPRSS15 transmembrane protease, serine 15 2 2
MIRT448817 FKBP1A FK506 binding protein 1A 2 4
MIRT450582 HIST1H2BG histone cluster 1 H2B family member g 2 2
MIRT451776 USP36 ubiquitin specific peptidase 36 2 2
MIRT457961 ABCC5 ATP binding cassette subfamily C member 5 2 4
MIRT458424 KLHL38 kelch like family member 38 2 4
MIRT461383 SLFN12L schlafen family member 12 like 2 2
MIRT467793 SLC2A14 solute carrier family 2 member 14 2 2
MIRT476517 GABRB1 gamma-aminobutyric acid type A receptor beta1 subunit 2 2
MIRT480290 C7orf73 short transmembrane mitochondrial protein 1 2 4
MIRT482745 HES7 hes family bHLH transcription factor 7 2 10
MIRT483189 HIST1H2AH histone cluster 1 H2A family member h 2 6
MIRT486545 DCTN4 dynactin subunit 4 2 2
MIRT486581 ZNF619 zinc finger protein 619 2 2
MIRT492604 POLR3E RNA polymerase III subunit E 2 2
MIRT494130 DCAF7 DDB1 and CUL4 associated factor 7 2 6
MIRT496023 ZBED3 zinc finger BED-type containing 3 2 2
MIRT497121 NBEAL1 neurobeachin like 1 2 2
MIRT497400 TMEM245 transmembrane protein 245 2 2
MIRT501410 RANBP10 RAN binding protein 10 2 2
MIRT510947 PPTC7 PTC7 protein phosphatase homolog 2 6
MIRT512494 ARID2 AT-rich interaction domain 2 2 2
MIRT512595 ZNF783 zinc finger family member 783 2 2
MIRT512612 CNTN4 contactin 4 2 2
MIRT517808 UGDH UDP-glucose 6-dehydrogenase 2 6
MIRT520686 TMED7 transmembrane p24 trafficking protein 7 2 4
MIRT526179 HEPH hephaestin 2 2
MIRT532568 CSTF1 cleavage stimulation factor subunit 1 2 2
MIRT533979 TADA2A transcriptional adaptor 2A 2 2
MIRT538622 CCSER2 coiled-coil serine rich protein 2 2 4
MIRT539703 EIF3H eukaryotic translation initiation factor 3 subunit H 2 2
MIRT539806 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT540422 FAM83F family with sequence similarity 83 member F 2 2
MIRT540506 CXCL10 C-X-C motif chemokine ligand 10 2 2
MIRT540619 F2RL2 coagulation factor II thrombin receptor like 2 2 2
MIRT542423 ZNF331 zinc finger protein 331 2 2
MIRT542454 AKR7A2 aldo-keto reductase family 7 member A2 2 2
MIRT543383 CC2D2A coiled-coil and C2 domain containing 2A 2 2
MIRT544777 CSTF2T cleavage stimulation factor subunit 2 tau variant 2 4
MIRT544923 ERCC4 ERCC excision repair 4, endonuclease catalytic subunit 2 2
MIRT549768 ZNF611 zinc finger protein 611 2 4
MIRT551242 COLEC10 collectin subfamily member 10 2 2
MIRT560474 ENSA endosulfine alpha 2 2
MIRT569738 GPR173 G protein-coupled receptor 173 2 2
MIRT571297 CHCHD4 coiled-coil-helix-coiled-coil-helix domain containing 4 2 2
MIRT572345 CKAP2L cytoskeleton associated protein 2 like 2 2
MIRT573112 ERBB2IP erbb2 interacting protein 2 2
MIRT607744 ANGPT4 angiopoietin 4 2 2
MIRT607903 SPRYD4 SPRY domain containing 4 2 2
MIRT611744 SERPING1 serpin family G member 1 2 4
MIRT615101 BNC2 basonuclin 2 2 2
MIRT619124 CD40LG CD40 ligand 2 2
MIRT625572 ANKRD42 ankyrin repeat domain 42 2 2
MIRT629038 KLLN killin, p53-regulated DNA replication inhibitor 2 2
MIRT633986 SLC35E2 solute carrier family 35 member E2 2 2
MIRT635675 COX18 COX18, cytochrome c oxidase assembly factor 2 4
MIRT637471 DEFB105B defensin beta 105B 2 4
MIRT637503 DEFB105A defensin beta 105A 2 4
MIRT639735 MAP2K2 mitogen-activated protein kinase kinase 2 2 2
MIRT640730 C9orf64 chromosome 9 open reading frame 64 2 2
MIRT645364 C9orf47 chromosome 9 open reading frame 47 2 2
MIRT647938 RNF152 ring finger protein 152 2 2
MIRT649400 SH2D4A SH2 domain containing 4A 2 2
MIRT656860 KIN Kin17 DNA and RNA binding protein 2 2
MIRT663470 POFUT2 protein O-fucosyltransferase 2 2 2
MIRT663507 NKAPL NFKB activating protein like 2 4
MIRT667690 KNSTRN kinetochore localized astrin/SPAG5 binding protein 2 2
MIRT677403 PCNP PEST proteolytic signal containing nuclear protein 2 2
MIRT678682 SCUBE3 signal peptide, CUB domain and EGF like domain containing 3 2 2
MIRT678789 NUPL2 nucleoporin like 2 2 2
MIRT680649 KIAA1456 KIAA1456 2 2
MIRT682450 MTX3 metaxin 3 2 2
MIRT682740 CA6 carbonic anhydrase 6 2 2
MIRT684421 TUFT1 tuftelin 1 2 2
MIRT690535 TRAPPC2 trafficking protein particle complex 2 2 2
MIRT690595 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT690771 PLA2G2C phospholipase A2 group IIC 2 2
MIRT692233 ALDH1B1 aldehyde dehydrogenase 1 family member B1 2 2
MIRT693667 MXRA7 matrix remodeling associated 7 2 2
MIRT695551 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 2 2
MIRT695870 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT696214 LYZ lysozyme 2 2
MIRT698368 TMED4 transmembrane p24 trafficking protein 4 2 2
MIRT700795 PHTF2 putative homeodomain transcription factor 2 2 2
MIRT701640 MYLK3 myosin light chain kinase 3 2 2
MIRT702989 HERPUD2 HERPUD family member 2 2 2
MIRT703627 FBXL3 F-box and leucine rich repeat protein 3 2 2
MIRT703783 FAM102B family with sequence similarity 102 member B 2 2
MIRT704293 DDX19B DEAD-box helicase 19B 2 2
MIRT704828 CDC73 cell division cycle 73 2 2
MIRT705014 CAMK2N1 calcium/calmodulin dependent protein kinase II inhibitor 1 2 2
MIRT708480 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT710770 PHF7 PHD finger protein 7 2 2
MIRT718918 TRIM66 tripartite motif containing 66 2 2
MIRT720390 ZNF549 zinc finger protein 549 2 2
MIRT720593 TTC39C tetratricopeptide repeat domain 39C 2 2
MIRT723515 SIGLEC8 sialic acid binding Ig like lectin 8 2 2
MIRT724458 PRKX protein kinase, X-linked 2 2
MIRT737267 UMAD1 UBAP1-MVB12-associated (UMA) domain containing 1 3 0
MIRT737356 ZIC2 Zic family member 2 4 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-873 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-873 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-873 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-873 Cisplatin 5460033 NSC119875 approved resistant cell line (OE19)
hsa-mir-873 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-873 Decitabine 451668 approved sensitive tissue (esopheageal cancer)
hsa-miR-873-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-873-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-873-3p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-873-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-873-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-873-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-873-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-873-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-873-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission