miRTarBase - #MIRT664417


—
pre-miRNA Information
pre-miRNA hsa-mir-122   
Genomic Coordinates chr18: 58451074 - 58451158
Synonyms MIR122A, MIRN122, MIRN122A, hsa-mir-122, miRNA122, miRNA122A, MIR122
Description Homo sapiens miR-122 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-122-5p
Sequence 15| UGGAGUGUGACAAUGGUGUUUG |36
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 18 + 58451091 29233923 MiREDiBase
C-to-U 11 18 + 58451098 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1258166649 1 dbSNP
rs1426570658 6 dbSNP
miRNA Oxidation Modification
Oxidation Position Sequence (5'-3') Target Gene Validation Method PMID
3 UGGAGUGUGACAAUGGUGUUUG AKT1S1; IL6ST; TMEM170B; NHLRC2 Luciferase reporter assay 37696949
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Plasma Microarrays; Real-time quantitative RT-PCR analysis
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Decrease Liver tissue Microarrays; Real-time quantitative RT-PCR analysis
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Decrease Liver tissue Quantitative real-time reverse transcription PCR
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Plasma Quantitative real-time reverse transcription PCR
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Plasma Quantitative reverse transcription PCR
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data expression Increase Serum Quantitative reverse transcription PCR
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression . Blood Polymerase chain reaction
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Serum Quantitative polymerase chain reaction
BOL4H5 miR-122 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Higher Blood Polymerase chain reaction
Gene Information
Gene Symbol TIGD6   
Synonyms -
Description tigger transposable element derived 6
Transcript NM_030953   
Expression
Putative miRNA Targets on TIGD6
3'UTR of TIGD6
(miRNA target sites are highlighted)		 
>TIGD6|NM_030953|3'UTR
   1 TGCAGGAATTTATTTCAGAAAATGTAGTTTACAAGAATAAAGATTTCTTTAGATAGGTTGTTGAGCCAATTTAAGTAAAG
  81 CAATGTTATTGTGACAACATTCCAGTACTCTGAAATAGCCAGGAAACTTCTTTGAATGGAATTTGACTAATATGTGTGTT
 161 TTCTTTTCTTTTGTTTTTGGCTGTCTCTGGTCCTTGATTCAAGATGTATTTTGATTCATCCAAGGGTTTCCAAACTTGTC
 241 TGCAAATTAGGATCACTTGAGAATCCTTTAAAAATTCCAAAGCTCAGGCCATATCCCAGGCCTATTAAATCACAATCTTT
 321 GGTGACGGGTCACAGGCATTGGTAGTTTTGAAGCTCTCCAGGTGATTCCAATGTGCAGACAAATTTGAAAACTGAACCAA
 401 CCACAGGAACATCAAGTACACTGTGGGCCTGGGTCCAGCTTCTTTCCAGTAAGTGTATCTCAGGGGCTTCCAAATTTAGC
 481 TTACATCAGAATCACTTGGAAGGCTTGTTAAAACCCAAGGCTGCTAGGCCCACCCCCAGAGTTTGATACAGTAGACCTCA
 561 GGTGGGACCCAAAAATTTGCATTTCTAACACATTCTCAGCTGATGCAGTCCAGGCTCCATGCTTTGAAAACCACTGGTCT
 641 AGCTTTAGATAGGATATTGAGCCAATTTAAATAAAGCAATATACTGGTCTAGCTGAGTTCTAGAACTTCTCTCTTTAGCT
 721 GGCCATCTGAATACTCCCCCATCACTAATTGTTAAAAAAAGAATCAACTGTTCTTACTCTAGAGCTCTTTTTTCCTTTCT
 801 GCTGATTTGCTGGAAGCACTACAAGACTTCTGTTTGTTCGTTCGTTTGTTTGTTTGTTTGTTTTTAAAGATGGGGTCTTG
 881 TTATATTGCCTAGGCTGGAATGCAGTGGTTATTCACAGGCATGATTATAACACACTACTCTCTCTAACTCCTGGCCTCAA
 961 GCCATCCTCCCAAATAGATGGGACTACTGATGCACACTGCCATGCTGGCCTTACGAAATGTTTTAATAGGCATTTCACTA
1041 ATAGGGATCTGGAGTACAAGGAAATACAGTGCATTTAAGACATAGGCTGGGCATGGTGGCTCATGCCTGTAATCCCAGCA
1121 CATTGGGAAGATCACTTGAGGCAAGGAGTTTGAGACCAGACTGGCCAACACAGCGAGACCCCCATCTCTAAAAAAAAAAA
1201 AATTAATAAGACATGGATACAACCAGGGAGGGAGGTTATAATAATAGAGCATCCTGTTAATCAGAATCATGGGGGAGAAC
1281 ATACAGCCCAGCGTGCCTCTCACTTTCCAGAAAGGGTGAGAGGATCATTAGAGAGTTCATTAGAGAGTATTTATTCCTAA
1361 TAAGTCAGATAAATGTCAGTTTCATTTTTAGAAGTTTCACACAATACCTGCTAATGGTGTGATGTCATTTTTCCCCCTGC
1441 TTCAGGTTAATTTTTTGGATATTTCAGAAACCCATAGCAATTCAGTGATTTTTCTTTTTGTAGTAGCTCAGTCAAAACAG
1521 GTAACAGCAGATTAATCATAGAAAATGTTGCTTCCACATTAACAAAACAATCACTGAAAAACAGCAGATGTTTAAATAGA
1601 TTATTTTATAGCTTATTTTGGATATTTTTTCTTTTAATAAACTAATATGATCATTTGAAT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guUUGUGGUAACA--G-UGUGAGGu 5'
            ||::::|||||  | |||:||| 
Target 5' gcAATGTTATTGTGACAACATTCCa 3'
 80 - 104 150.00 -17.90
2 
miRNA  3' guUUG--UGGUA-ACAGUGUGAGGu 5'
            |:|  :|||| ||  |:||||| 
Target 5' ttAGCTGGCCATCTG-AATACTCCc 3'
 715 - 738 137.00 -13.00
3 
miRNA  3' guUUGUGGUAACA--GUGUGAGGu 5'
            ::||: ||| |  |||||| | 
Target 5' caGGCATGATTATAACACACTACt 3'
 916 - 939 130.00 -13.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN5853527 12 COSMIC
COSN31582138 42 COSMIC
COSN30136423 47 COSMIC
COSN19691883 55 COSMIC
COSN31545057 81 COSMIC
COSN30112371 86 COSMIC
COSN31567004 86 COSMIC
COSN30115122 168 COSMIC
COSN19125364 177 COSMIC
COSN9011640 190 COSMIC
COSN20711654 375 COSMIC
COSN9928591 420 COSMIC
COSN29178395 452 COSMIC
COSN14708464 606 COSMIC
COSN9928590 808 COSMIC
COSN16518985 843 COSMIC
COSN26433030 920 COSMIC
COSN27598970 1189 COSMIC
COSN20102039 1190 COSMIC
COSN23777859 1301 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs751167199 2 dbSNP
rs776519740 6 dbSNP
rs763609468 11 dbSNP
rs764069232 20 dbSNP
rs1277206063 26 dbSNP
rs1314280822 33 dbSNP
rs569181701 50 dbSNP
rs1214820500 52 dbSNP
rs1487408278 56 dbSNP
rs1196123491 65 dbSNP
rs996390722 84 dbSNP
rs969764282 85 dbSNP
rs750089624 89 dbSNP
rs558364259 103 dbSNP
rs1171921730 106 dbSNP
rs1286295542 120 dbSNP
rs1415939315 122 dbSNP
rs1173979917 131 dbSNP
rs1228419456 133 dbSNP
rs902082280 153 dbSNP
rs1019084972 158 dbSNP
rs1005039374 162 dbSNP
rs143570415 163 dbSNP
rs1416236197 173 dbSNP
rs1046849977 176 dbSNP
rs1235709524 183 dbSNP
rs958499803 185 dbSNP
rs148901577 187 dbSNP
rs1351983029 192 dbSNP
rs1355758322 193 dbSNP
rs898168747 206 dbSNP
rs1451074961 215 dbSNP
rs764425339 220 dbSNP
rs1248547201 222 dbSNP
rs1429101523 234 dbSNP
rs1044713346 260 dbSNP
rs1319535089 279 dbSNP
rs1379390744 280 dbSNP
rs947969282 294 dbSNP
rs917810651 297 dbSNP
rs1385283459 300 dbSNP
rs902675550 306 dbSNP
rs1051808884 315 dbSNP
rs73798340 324 dbSNP
rs191395649 326 dbSNP
rs10041944 327 dbSNP
rs1475623965 328 dbSNP
rs374047127 328 dbSNP
rs10036377 330 dbSNP
rs1242814397 338 dbSNP
rs1355841990 347 dbSNP
rs968501993 347 dbSNP
rs1208313628 350 dbSNP
rs750295950 371 dbSNP
rs1484781633 373 dbSNP
rs1243682464 376 dbSNP
rs531565415 377 dbSNP
rs1214229862 398 dbSNP
rs147857620 413 dbSNP
rs1019181016 414 dbSNP
rs577931817 429 dbSNP
rs1364196623 431 dbSNP
rs1472224332 434 dbSNP
rs1270713072 435 dbSNP
rs1005089994 443 dbSNP
rs950946863 446 dbSNP
rs929153529 447 dbSNP
rs1461572199 451 dbSNP
rs1331224449 461 dbSNP
rs767228734 462 dbSNP
rs1028204865 465 dbSNP
rs766853277 467 dbSNP
rs928423965 468 dbSNP
rs1340253892 485 dbSNP
rs1242807983 496 dbSNP
rs532723717 498 dbSNP
rs868016821 503 dbSNP
rs553407742 514 dbSNP
rs770967190 515 dbSNP
rs760939396 517 dbSNP
rs1364489947 529 dbSNP
rs1456354774 530 dbSNP
rs898215395 533 dbSNP
rs773374090 539 dbSNP
rs1441692792 550 dbSNP
rs1184959557 551 dbSNP
rs1392940462 554 dbSNP
rs1169277887 556 dbSNP
rs915589254 571 dbSNP
rs1011947954 579 dbSNP
rs907264048 580 dbSNP
rs957059233 587 dbSNP
rs1056432295 588 dbSNP
rs762651458 590 dbSNP
rs541705144 602 dbSNP
rs73798339 606 dbSNP
rs1399663576 607 dbSNP
rs1276312565 608 dbSNP
rs966865565 611 dbSNP
rs1030417574 612 dbSNP
rs1229506201 612 dbSNP
rs185905809 615 dbSNP
rs1168568982 617 dbSNP
rs1259379816 618 dbSNP
rs537231742 620 dbSNP
rs570246230 625 dbSNP
rs1006659371 631 dbSNP
rs1171727011 634 dbSNP
rs1453660692 637 dbSNP
rs778944463 640 dbSNP
rs946836023 643 dbSNP
rs1175878201 692 dbSNP
rs377095661 694 dbSNP
rs1376450888 695 dbSNP
rs181850661 700 dbSNP
rs1047691231 702 dbSNP
rs1364171196 703 dbSNP
rs1382891433 706 dbSNP
rs1296184292 708 dbSNP
rs1214962883 717 dbSNP
rs539520583 718 dbSNP
rs966058161 724 dbSNP
rs565294482 727 dbSNP
rs911885847 732 dbSNP
rs1250312971 734 dbSNP
rs907040595 741 dbSNP
rs1045558593 743 dbSNP
rs768743861 747 dbSNP
rs1186646576 749 dbSNP
rs1266094237 751 dbSNP
rs1202003183 761 dbSNP
rs983729579 761 dbSNP
rs547174595 764 dbSNP
rs1396060718 765 dbSNP
rs1419556346 770 dbSNP
rs950994982 778 dbSNP
rs1157052237 779 dbSNP
rs989901270 784 dbSNP
rs1454520881 794 dbSNP
rs1292971186 799 dbSNP
rs1308954069 801 dbSNP
rs1388668577 802 dbSNP
rs1438546539 805 dbSNP
rs1305608559 835 dbSNP
rs1371455231 839 dbSNP
rs199799944 839 dbSNP
rs546976505 840 dbSNP
rs973078 843 dbSNP
rs1023412998 844 dbSNP
rs1264290912 845 dbSNP
rs1254228483 847 dbSNP
rs138254666 847 dbSNP
rs567994865 847 dbSNP
rs1439451177 848 dbSNP
rs1419823610 851 dbSNP
rs966899721 851 dbSNP
rs896186043 861 dbSNP
rs1366779716 864 dbSNP
rs200603546 864 dbSNP
rs776554874 864 dbSNP
rs1372660604 877 dbSNP
rs1445980088 880 dbSNP
rs1296172652 883 dbSNP
rs1375275824 895 dbSNP
rs1296591294 912 dbSNP
rs1311657606 914 dbSNP
rs755635020 922 dbSNP
rs976694635 923 dbSNP
rs1168950244 926 dbSNP
rs549700247 930 dbSNP
rs554422822 935 dbSNP
rs1433894106 936 dbSNP
rs1056106124 940 dbSNP
rs531372914 941 dbSNP
rs1234896972 943 dbSNP
rs1433773006 946 dbSNP
rs999450477 946 dbSNP
rs750082929 949 dbSNP
rs1476214160 957 dbSNP
rs1174990621 958 dbSNP
rs766969974 964 dbSNP
rs1165683881 973 dbSNP
rs1006277241 974 dbSNP
rs902403977 984 dbSNP
rs1274946374 986 dbSNP
rs1168310719 991 dbSNP
rs887797413 993 dbSNP
rs1442714750 999 dbSNP
rs1043639073 1005 dbSNP
rs1210549530 1014 dbSNP
rs1346137349 1015 dbSNP
rs1353131031 1017 dbSNP
rs1416281386 1025 dbSNP
rs946567985 1026 dbSNP
rs900343269 1027 dbSNP
rs1039129190 1031 dbSNP
rs944758972 1043 dbSNP
rs564328653 1044 dbSNP
rs993424324 1054 dbSNP
rs1316901051 1057 dbSNP
rs1308414720 1067 dbSNP
rs907155202 1071 dbSNP
rs1045650202 1072 dbSNP
rs1486753033 1077 dbSNP
rs1189694220 1083 dbSNP
rs983834195 1091 dbSNP
rs929586695 1093 dbSNP
rs948585515 1100 dbSNP
rs1184677001 1102 dbSNP
rs1304889001 1104 dbSNP
rs761084071 1108 dbSNP
rs1393217785 1113 dbSNP
rs1175044589 1123 dbSNP
rs6868575 1124 dbSNP
rs1054629730 1129 dbSNP
rs533476435 1138 dbSNP
rs935721876 1138 dbSNP
rs1312477032 1141 dbSNP
rs924287453 1149 dbSNP
rs879449611 1161 dbSNP
rs970253391 1170 dbSNP
rs559926391 1174 dbSNP
rs977090734 1175 dbSNP
rs6868947 1180 dbSNP
rs923547076 1184 dbSNP
rs1363163916 1187 dbSNP
rs1242810379 1189 dbSNP
rs1475664305 1191 dbSNP
rs1156261191 1192 dbSNP
rs990573968 1197 dbSNP
rs1393021556 1198 dbSNP
rs76458159 1202 dbSNP
rs1173837902 1203 dbSNP
rs1398617558 1203 dbSNP
rs1455471186 1203 dbSNP
rs796784687 1203 dbSNP
rs965260230 1203 dbSNP
rs1251964929 1205 dbSNP
rs1436374837 1205 dbSNP
rs772934812 1205 dbSNP
rs973077 1206 dbSNP
rs985283146 1207 dbSNP
rs747833617 1208 dbSNP
rs1309018703 1228 dbSNP
rs1034708545 1235 dbSNP
rs1207128841 1239 dbSNP
rs562333467 1249 dbSNP
rs753095514 1260 dbSNP
rs1212983910 1267 dbSNP
rs546820514 1276 dbSNP
rs78580100 1277 dbSNP
rs993538637 1284 dbSNP
rs1363043060 1291 dbSNP
rs1468224442 1292 dbSNP
rs563556643 1293 dbSNP
rs900352906 1311 dbSNP
rs1324448096 1319 dbSNP
rs1397268884 1328 dbSNP
rs1038804293 1330 dbSNP
rs1331025487 1339 dbSNP
rs1334370383 1347 dbSNP
rs1241432750 1349 dbSNP
rs1280422188 1350 dbSNP
rs147031762 1365 dbSNP
rs890513158 1377 dbSNP
rs1047794059 1380 dbSNP
rs1292821066 1400 dbSNP
rs1249484779 1401 dbSNP
rs1054259258 1402 dbSNP
rs929320754 1404 dbSNP
rs1231677203 1407 dbSNP
rs754362630 1413 dbSNP
rs999977624 1417 dbSNP
rs1162126519 1428 dbSNP
rs370171005 1429 dbSNP
rs796860335 1429 dbSNP
rs748885513 1430 dbSNP
rs1396424714 1432 dbSNP
rs1384095455 1433 dbSNP
rs1393538808 1433 dbSNP
rs933686426 1433 dbSNP
rs1329761158 1434 dbSNP
rs1340043094 1435 dbSNP
rs1295133254 1439 dbSNP
rs568717710 1439 dbSNP
rs1335563497 1445 dbSNP
rs766477649 1451 dbSNP
rs184990269 1455 dbSNP
rs779422764 1468 dbSNP
rs1337179237 1474 dbSNP
rs1412053606 1476 dbSNP
rs943595309 1478 dbSNP
rs1163657050 1502 dbSNP
rs992971292 1511 dbSNP
rs535180777 1518 dbSNP
rs1185368481 1522 dbSNP
rs1258994839 1526 dbSNP
rs571802707 1539 dbSNP
rs545366025 1540 dbSNP
rs1371898194 1559 dbSNP
rs985012874 1561 dbSNP
rs566365114 1571 dbSNP
rs1375225206 1582 dbSNP
rs919366821 1585 dbSNP
rs181008432 1596 dbSNP
rs1356137773 1599 dbSNP
rs1381771364 1607 dbSNP
rs1293554046 1608 dbSNP
rs1035207324 1615 dbSNP
rs1324577053 1631 dbSNP
rs1229529540 1632 dbSNP
rs141559913 1635 dbSNP
rs1346958952 1636 dbSNP
rs1208269248 1641 dbSNP
rs1282065614 1643 dbSNP
rs1485698749 1648 dbSNP
rs1203983535 1649 dbSNP
rs1260137718 1652 dbSNP
rs761359170 1652 dbSNP
rs971404549 1652 dbSNP
rs1207403655 1653 dbSNP
rs966815794 1659 dbSNP
rs1021927622 1662 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' guuuGUGGUAACAGUGUGAGGu 5'
              ::||| |   :|||||| 
Target 5' agguUGCCACU---GCACUCCa 3'
 		4 - 22
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000296736.3 | 3UTR | UGGAGGUUGCCACUGCACUCCAGCCUGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.801 1.3e-6 0.818 5.2e-7 24 Click to see details
GSE17498 Multiple myeloma 0.333 1.8e-2 0.039 4.1e-1 40 Click to see details
GSE21849 B cell lymphoma -0.32 4.5e-2 -0.394 1.7e-2 29 Click to see details
GSE32688 Pancreatic cancer 0.274 6.5e-2 0.195 1.4e-1 32 Click to see details
GSE19350 CNS germ cell tumors -0.398 1.0e-1 -0.304 1.7e-1 12 Click to see details
GSE42095 Differentiated embryonic stem cells -0.254 1.2e-1 -0.098 3.3e-1 23 Click to see details
GSE26953 Aortic valvular endothelial cells 0.232 1.4e-1 0.311 7.0e-2 24 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.213 1.5e-1 -0.101 3.2e-1 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.179 2.3e-1 0.134 2.9e-1 20 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.366 2.4e-1 0.257 3.1e-1 6 Click to see details
GSE28260 Renal cortex and medulla 0.116 3.5e-1 0.022 4.7e-1 13 Click to see details
GSE17306 Multiple myeloma 0.051 3.6e-1 0.191 9.4e-2 49 Click to see details
GSE38226 Liver fibrosis 0.079 3.7e-1 0.146 2.6e-1 21 Click to see details
GSE14794 Lymphoblastoid cells 0.035 3.7e-1 0.107 1.6e-1 90 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.062 3.8e-1 -0.038 4.3e-1 25 Click to see details
GSE27834 Pluripotent stem cells -0.073 3.9e-1 -0.147 2.9e-1 16 Click to see details
GSE21687 Ependynoma primary tumors -0.021 4.3e-1 0.043 3.7e-1 64 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
CHOL 0.654 0.03 0.633 0.03 9 Click to see details
KIRP -0.296 0.22 -0.367 0.17 9 Click to see details
KIRC -0.122 0.26 -0.051 0.4 29 Click to see details
KICH -0.161 0.35 -0.071 0.43 8 Click to see details
STAD 0.146 0.37 0.214 0.31 8 Click to see details
LIHC 0.031 0.42 -0.040 0.39 49 Click to see details
ESCA 0.113 0.43 -0.100 0.44 5 Click to see details
HNSC 0.093 0.47 -0.500 0.33 3 Click to see details
THCA 0.01 0.49 -0.400 0.25 5 Click to see details
THCA 0.01 0.49 -0.400 0.25 5 Click to see details
THCA 0.01 0.49 -0.400 0.25 5 Click to see details
THCA 0.01 0.49 -0.400 0.25 5 Click to see details
THCA 0.01 0.49 -0.400 0.25 5 Click to see details
THCA 0.01 0.49 -0.400 0.25 5 Click to see details
548 hsa-miR-122-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000012 CYP7A1 cytochrome P450 family 7 subfamily A member 1 3 1
MIRT000364 IGF1R insulin like growth factor 1 receptor 4 3
MIRT000365 SRF serum response factor 4 1
MIRT000663 RAC1 Rac family small GTPase 1 5 2
MIRT000717 RHOA ras homolog family member A 2 2
MIRT003006 CCNG1 cyclin G1 7 5
MIRT003079 GTF2B general transcription factor IIB 2 1
MIRT003080 GYS1 glycogen synthase 1 4 2
MIRT003081 ANK2 ankyrin 2 3 1
MIRT003082 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 3 1
MIRT003083 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 4 2
MIRT003084 ANXA11 annexin A11 4 2
MIRT003085 ALDOA aldolase, fructose-bisphosphate A 3 2
MIRT003086 RAB6B RAB6B, member RAS oncogene family 3 1
MIRT003087 RAB11FIP1 RAB11 family interacting protein 1 5 3
MIRT003088 FOXP1 forkhead box P1 3 1
MIRT003089 MECP2 methyl-CpG binding protein 2 3 2
MIRT003090 NCAM1 neural cell adhesion molecule 1 4 3
MIRT003091 UBAP2 ubiquitin associated protein 2 3 1
MIRT003092 TBX19 T-box 19 3 1
MIRT003093 AACS acetoacetyl-CoA synthetase 3 1
MIRT003094 DUSP2 dual specificity phosphatase 2 3 1
MIRT003095 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 3 1
MIRT003097 MAPK11 mitogen-activated protein kinase 11 3 1
MIRT003098 FUNDC2 FUN14 domain containing 2 3 1
MIRT003099 AKT3 AKT serine/threonine kinase 3 3 3
MIRT003100 TPD52L2 tumor protein D52 like 2 4 3
MIRT003102 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 4 2
MIRT003103 G6PC3 glucose-6-phosphatase catalytic subunit 3 4 2
MIRT003104 AP3M2 adaptor related protein complex 3 mu 2 subunit 3 1
MIRT003105 SLC7A1 solute carrier family 7 member 1 4 4
MIRT003106 XPO6 exportin 6 3 1
MIRT003107 FOXJ3 forkhead box J3 3 1
MIRT003108 SLC7A11 solute carrier family 7 member 11 3 1
MIRT003109 TRIB1 tribbles pseudokinase 1 3 1
MIRT003110 EGLN3 egl-9 family hypoxia inducible factor 3 3 1
MIRT003111 NUMBL NUMB like, endocytic adaptor protein 3 1
MIRT003112 ADAM17 ADAM metallopeptidase domain 17 3 5
MIRT003727 DSTYK dual serine/threonine and tyrosine protein kinase 3 2
MIRT003728 FAM117B family with sequence similarity 117 member B 3 1
MIRT004364 BCL2L2 BCL2 like 2 4 2
MIRT004527 PRKAB1 protein kinase AMP-activated non-catalytic subunit beta 1 2 1
MIRT004879 ADAM10 ADAM metallopeptidase domain 10 5 1
MIRT005782 ACVR1C activin A receptor type 1C 1 1
MIRT006123 PRKRA protein activator of interferon induced protein kinase EIF2AK2 4 1
MIRT006421 WNT1 Wnt family member 1 3 1
MIRT007007 PTPN1 protein tyrosine phosphatase, non-receptor type 1 1 1
MIRT007081 NT5C3A 5'-nucleotidase, cytosolic IIIA 1 1
MIRT007082 P4HA1 prolyl 4-hydroxylase subunit alpha 1 1 1
MIRT007083 ZNF395 zinc finger protein 395 1 1
MIRT007084 SOCS1 suppressor of cytokine signaling 1 1 1
MIRT023217 SSR3 signal sequence receptor subunit 3 1 1
MIRT023218 PHOX2A paired like homeobox 2a 1 1
MIRT023219 DZIP1L DAZ interacting zinc finger protein 1 like 1 1
MIRT023220 GSTM2 glutathione S-transferase mu 2 1 1
MIRT023221 RAI14 retinoic acid induced 14 1 1
MIRT023222 STARD13 StAR related lipid transfer domain containing 13 1 1
MIRT023223 CNN3 calponin 3 1 1
MIRT023224 A2M alpha-2-macroglobulin 1 1
MIRT023225 EFCAB6 EF-hand calcium binding domain 6 1 1
MIRT023226 GLOD4 glyoxalase domain containing 4 1 1
MIRT023227 CALR calreticulin 1 1
MIRT023228 POFUT1 protein O-fucosyltransferase 1 1 1
MIRT023229 PYGO1 pygopus family PHD finger 1 1 1
MIRT023230 CDY2B chromodomain Y-linked 2B 1 1
MIRT023231 CDC42EP3 CDC42 effector protein 3 1 1
MIRT023232 CS citrate synthase 3 3
MIRT023233 RNF170 ring finger protein 170 3 3
MIRT023234 GTF3C6 general transcription factor IIIC subunit 6 1 1
MIRT023235 ZNF321P zinc finger protein 321, pseudogene 1 1
MIRT023236 LAMP1 lysosomal associated membrane protein 1 1 1
MIRT023237 SLC52A2 solute carrier family 52 member 2 1 1
MIRT023238 ZNF658 zinc finger protein 658 1 1
MIRT023239 ATP13A3 ATPase 13A3 1 1
MIRT023240 CPNE5 copine 5 1 1
MIRT023241 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT023242 TMEM136 transmembrane protein 136 1 1
MIRT023243 ATP11A ATPase phospholipid transporting 11A 1 1
MIRT023244 TMEM74 transmembrane protein 74 1 1
MIRT023245 ANKRD10 ankyrin repeat domain 10 1 1
MIRT023246 TBL1XR1 transducin beta like 1 X-linked receptor 1 1 1
MIRT023247 USP10 ubiquitin specific peptidase 10 1 1
MIRT023248 AKAP11 A-kinase anchoring protein 11 1 1
MIRT023249 BACH2 BTB domain and CNC homolog 2 1 1
MIRT023250 HCCS holocytochrome c synthase 1 1
MIRT023251 Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 1 1
MIRT023252 GTDC2 protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-) 1 1
MIRT023253 CTPS1 CTP synthase 1 1 1
MIRT023254 SLC44A1 solute carrier family 44 member 1 1 1
MIRT023255 CLSPN claspin 1 1
MIRT023256 RABGEF1 RAB guanine nucleotide exchange factor 1 1 1
MIRT023257 FBXO7 F-box protein 7 1 1
MIRT023258 NCDN neurochondrin 1 1
MIRT023259 SOX2 SRY-box 2 1 1
MIRT023260 ZNF618 zinc finger protein 618 1 1
MIRT023261 ABLIM1 actin binding LIM protein 1 1 1
MIRT023262 ZBTB4 zinc finger and BTB domain containing 4 1 1
MIRT023263 LUZP1 leucine zipper protein 1 1 1
MIRT023264 NLGN3 neuroligin 3 1 1
MIRT023265 PRR11 proline rich 11 1 1
MIRT023266 HHAT hedgehog acyltransferase 1 1
MIRT023267 UBE2L3 ubiquitin conjugating enzyme E2 L3 1 1
MIRT023268 DNAJC18 DnaJ heat shock protein family (Hsp40) member C18 1 1
MIRT023269 FAM102A family with sequence similarity 102 member A 1 1
MIRT023270 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT023271 DENND2C DENN domain containing 2C 1 1
MIRT023272 HMOX1 heme oxygenase 1 3 2
MIRT023273 USP28 ubiquitin specific peptidase 28 1 1
MIRT023274 KRT18 keratin 18 1 1
MIRT023275 BPGM bisphosphoglycerate mutase 1 1
MIRT023276 ZNF233 zinc finger protein 233 1 1
MIRT023277 SLC25A30 solute carrier family 25 member 30 1 1
MIRT023278 ANKRD9 ankyrin repeat domain 9 3 3
MIRT023279 RLN1 relaxin 1 1 1
MIRT023280 DDIT3 DNA damage inducible transcript 3 1 1
MIRT023281 TRIM65 tripartite motif containing 65 1 1
MIRT023282 B4GALT1 beta-1,4-galactosyltransferase 1 1 1
MIRT023283 ANXA7 annexin A7 1 1
MIRT023284 SLC19A2 solute carrier family 19 member 2 1 1
MIRT023285 MARCKS myristoylated alanine rich protein kinase C substrate 1 1
MIRT023286 CLEC11A C-type lectin domain containing 11A 1 1
MIRT023287 CENPF centromere protein F 1 1
MIRT023288 CLDN18 claudin 18 1 1
MIRT023289 PFDN1 prefoldin subunit 1 1 1
MIRT023290 SPAG9 sperm associated antigen 9 1 1
MIRT023291 CEACAM8 carcinoembryonic antigen related cell adhesion molecule 8 1 1
MIRT023292 KRT10 keratin 10 1 1
MIRT023293 SET SET nuclear proto-oncogene 1 1
MIRT023294 SLC11A2 solute carrier family 11 member 2 1 1
MIRT023295 MYCBP MYC binding protein 3 3
MIRT023296 GPHB5 glycoprotein hormone beta 5 1 1
MIRT023297 STAU2 staufen double-stranded RNA binding protein 2 1 1
MIRT023298 NFATC1 nuclear factor of activated T-cells 1 1 1
MIRT023299 ERP29 endoplasmic reticulum protein 29 1 1
MIRT023300 MEP1A meprin A subunit alpha 1 1
MIRT023301 SPTLC1 serine palmitoyltransferase long chain base subunit 1 1 1
MIRT023302 GTF2H2 general transcription factor IIH subunit 2 1 1
MIRT023303 C14orf39 chromosome 14 open reading frame 39 1 1
MIRT023304 UBE2K ubiquitin conjugating enzyme E2 K 1 1
MIRT023305 PPP1R9B protein phosphatase 1 regulatory subunit 9B 1 1
MIRT023306 PSMD10 proteasome 26S subunit, non-ATPase 10 1 1
MIRT023307 CALD1 caldesmon 1 1 1
MIRT023308 TTYH3 tweety family member 3 1 1
MIRT023309 NMNAT2 nicotinamide nucleotide adenylyltransferase 2 1 1
MIRT023310 SCN4B sodium voltage-gated channel beta subunit 4 1 1
MIRT023311 C1orf122 chromosome 1 open reading frame 122 1 1
MIRT023312 PAK1 p21 (RAC1) activated kinase 1 1 1
MIRT023313 DNAJB1 DnaJ heat shock protein family (Hsp40) member B1 1 1
MIRT023314 DMXL1 Dmx like 1 1 1
MIRT023315 ZNF160 zinc finger protein 160 1 1
MIRT023316 CSRP1 cysteine and glycine rich protein 1 1 1
MIRT023317 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT023318 RBBP5 RB binding protein 5, histone lysine methyltransferase complex subunit 1 1
MIRT023319 ANKRD13C ankyrin repeat domain 13C 1 1
MIRT023320 SUCLA2 succinate-CoA ligase ADP-forming beta subunit 1 1
MIRT023321 PEA15 phosphoprotein enriched in astrocytes 15 1 1
MIRT023322 MTPN myotrophin 1 1
MIRT023323 YKT6 YKT6 v-SNARE homolog 1 1
MIRT023324 MOB3B MOB kinase activator 3B 1 1
MIRT023325 FAM118A family with sequence similarity 118 member A 1 1
MIRT023326 ZNF264 zinc finger protein 264 1 1
MIRT023327 HECTD3 HECT domain E3 ubiquitin protein ligase 3 1 1
MIRT023328 BATF2 basic leucine zipper ATF-like transcription factor 2 1 1
MIRT023329 PIP4K2A phosphatidylinositol-5-phosphate 4-kinase type 2 alpha 1 1
MIRT023330 MAPRE1 microtubule associated protein RP/EB family member 1 1 1
MIRT023331 TBC1D22B TBC1 domain family member 22B 1 1
MIRT023332 SLC9A1 solute carrier family 9 member A1 3 3
MIRT023333 NPEPPS aminopeptidase puromycin sensitive 1 1
MIRT023334 BCL2L1 BCL2 like 1 2 1
MIRT023335 OSMR oncostatin M receptor 1 1
MIRT023336 CALU calumenin 1 1
MIRT023337 BRI3BP BRI3 binding protein 1 1
MIRT023338 PSPH phosphoserine phosphatase 1 1
MIRT023339 APMAP adipocyte plasma membrane associated protein 1 1
MIRT023340 WASF1 WAS protein family member 1 1 1
MIRT023341 LCA5 LCA5, lebercilin 1 1
MIRT023342 NODAL nodal growth differentiation factor 1 1
MIRT023343 CASP7 caspase 7 1 1
MIRT023344 CPA3 carboxypeptidase A3 1 1
MIRT023345 PALM paralemmin 1 1
MIRT023346 TCP11 t-complex 11 1 1
MIRT023347 NALCN sodium leak channel, non-selective 1 1
MIRT023348 PLAGL2 PLAG1 like zinc finger 2 1 1
MIRT023349 IDS iduronate 2-sulfatase 3 3
MIRT023350 PARP11 poly(ADP-ribose) polymerase family member 11 1 1
MIRT023351 MAZ MYC associated zinc finger protein 1 1
MIRT023352 CPNE4 copine 4 1 1
MIRT023353 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 1 1
MIRT023354 KRT14 keratin 14 1 1
MIRT023355 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT023356 GNL3L G protein nucleolar 3 like 1 1
MIRT023357 HLA-DQA1 major histocompatibility complex, class II, DQ alpha 1 1 1
MIRT023358 EYA4 EYA transcriptional coactivator and phosphatase 4 1 1
MIRT023359 GNPDA2 glucosamine-6-phosphate deaminase 2 1 1
MIRT023360 BRCA2 BRCA2, DNA repair associated 1 1
MIRT023361 ZSCAN4 zinc finger and SCAN domain containing 4 1 1
MIRT023362 HSPA5 heat shock protein family A (Hsp70) member 5 1 1
MIRT023363 SERAC1 serine active site containing 1 1 1
MIRT023364 SLC15A2 solute carrier family 15 member 2 1 1
MIRT023365 RABIF RAB interacting factor 1 1
MIRT023366 ART3 ADP-ribosyltransferase 3 1 1
MIRT023367 EP400 E1A binding protein p400 1 1
MIRT023368 MT4 metallothionein 4 1 1
MIRT023369 TRAM2 translocation associated membrane protein 2 1 1
MIRT023370 PHPT1 phosphohistidine phosphatase 1 1 1
MIRT023371 KIAA0101 PCNA clamp associated factor 1 1
MIRT023372 VHL von Hippel-Lindau tumor suppressor 1 1
MIRT023373 IFNA1 interferon alpha 1 1 1
MIRT023374 FSTL3 follistatin like 3 1 1
MIRT023375 PHF14 PHD finger protein 14 1 1
MIRT023376 ZCCHC2 zinc finger CCHC-type containing 2 1 1
MIRT023377 GSTM3 glutathione S-transferase mu 3 1 1
MIRT023378 DCTN5 dynactin subunit 5 1 1
MIRT023379 CHST3 carbohydrate sulfotransferase 3 1 1
MIRT023380 HECW2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 1 1
MIRT023381 ADO 2-aminoethanethiol dioxygenase 1 1
MIRT023382 POMZP3 POM121 and ZP3 fusion 1 1
MIRT023383 CHST12 carbohydrate sulfotransferase 12 1 1
MIRT023384 ARSB arylsulfatase B 1 1
MIRT023385 ATP7A ATPase copper transporting alpha 1 1
MIRT023386 PMP22 peripheral myelin protein 22 1 1
MIRT023387 TGFBRAP1 transforming growth factor beta receptor associated protein 1 1 1
MIRT023388 ORC2 origin recognition complex subunit 2 1 1
MIRT023389 CREB1 cAMP responsive element binding protein 1 1 1
MIRT023390 CD83 CD83 molecule 1 1
MIRT023391 TOB2 transducer of ERBB2, 2 3 5
MIRT023392 LRP11 LDL receptor related protein 11 1 1
MIRT023393 MPV17 MPV17, mitochondrial inner membrane protein 1 1
MIRT023394 TRIM29 tripartite motif containing 29 1 1
MIRT023395 OSBP2 oxysterol binding protein 2 1 1
MIRT023396 PKM pyruvate kinase, muscle 6 4
MIRT023397 FOXK2 forkhead box K2 3 3
MIRT023398 CLIC4 chloride intracellular channel 4 5 6
MIRT023399 ST6GALNAC4 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 1 1
MIRT023400 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 1 1
MIRT023401 LMNB2 lamin B2 3 5
MIRT023402 BAX BCL2 associated X, apoptosis regulator 4 3
MIRT023403 CDK4 cyclin dependent kinase 4 3 3
MIRT054362 Cux1 cut-like homeobox 1 1 1
MIRT074336 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT109185 VMA21 VMA21, vacuolar ATPase assembly factor 2 4
MIRT324745 ACER2 alkaline ceramidase 2 2 2
MIRT325564 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT438005 MEF2D myocyte enhancer factor 2D 1 2
MIRT438206 TGFB1 transforming growth factor beta 1 1 1
MIRT438639 AXL AXL receptor tyrosine kinase 1 1
MIRT438655 NOD2 nucleotide binding oligomerization domain containing 2 3 1
MIRT438734 FUT8 fucosyltransferase 8 3 1
MIRT449879 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 2
MIRT451716 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT453274 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT454113 MRPL52 mitochondrial ribosomal protein L52 2 2
MIRT454232 OSBPL10 oxysterol binding protein like 10 2 15
MIRT454344 CDKL1 cyclin dependent kinase like 1 2 2
MIRT455826 ZSWIM1 zinc finger SWIM-type containing 1 2 3
MIRT459903 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 12
MIRT461654 G6PC glucose-6-phosphatase catalytic subunit 2 2
MIRT461934 TNFSF14 TNF superfamily member 14 2 2
MIRT463834 WSB1 WD repeat and SOCS box containing 1 2 2
MIRT468615 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT469456 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT469637 RAD21 RAD21 cohesin complex component 2 6
MIRT473432 MDM4 MDM4, p53 regulator 2 2
MIRT473872 MAFK MAF bZIP transcription factor K 2 6
MIRT476861 FHL2 four and a half LIM domains 2 2 4
MIRT476893 FBXO21 F-box protein 21 2 2
MIRT479880 CCDC43 coiled-coil domain containing 43 2 2
MIRT488848 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT491164 LRP3 LDL receptor related protein 3 2 2
MIRT497662 PRMT3 protein arginine methyltransferase 3 2 2
MIRT499314 ZNF485 zinc finger protein 485 2 10
MIRT499759 CIRH1A UTP4, small subunit processome component 2 10
MIRT500014 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501090 SLC7A5 solute carrier family 7 member 5 2 4
MIRT509646 ZNF354B zinc finger protein 354B 2 10
MIRT509945 TOMM70A translocase of outer mitochondrial membrane 70 2 6
MIRT510320 SLC2A3 solute carrier family 2 member 3 2 4
MIRT515505 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT516410 COPA coatomer protein complex subunit alpha 2 2
MIRT517861 NCAPD2 non-SMC condensin I complex subunit D2 2 4
MIRT522558 MCAM melanoma cell adhesion molecule 2 4
MIRT523525 GLUL glutamate-ammonia ligase 2 2
MIRT523764 FBXO27 F-box protein 27 2 4
MIRT524517 CDK19 cyclin dependent kinase 19 2 2
MIRT524753 BIRC5 baculoviral IAP repeat containing 5 2 6
MIRT529366 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 4
MIRT531189 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 2 2
MIRT531639 C19orf52 translocase of inner mitochondrial membrane 29 2 4
MIRT531913 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT532678 PATZ1 POZ/BTB and AT hook containing zinc finger 1 2 2
MIRT533115 YIPF4 Yip1 domain family member 4 2 4
MIRT534740 RBM47 RNA binding motif protein 47 2 2
MIRT535471 PARVB parvin beta 2 4
MIRT536742 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT537237 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 2 2
MIRT539523 ABCF1 ATP binding cassette subfamily F member 1 2 4
MIRT540438 RBM43 RNA binding motif protein 43 2 2
MIRT542982 ERC1 ELKS/RAB6-interacting/CAST family member 1 2 2
MIRT544674 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT549514 HDDC2 HD domain containing 2 2 2
MIRT549663 ORC6 origin recognition complex subunit 6 2 4
MIRT555420 PPIC peptidylprolyl isomerase C 2 2
MIRT564701 ZNF322P1 zinc finger protein 322 pseudogene 1 2 2
MIRT570046 PKNOX1 PBX/knotted 1 homeobox 1 2 2
MIRT570257 PRSS16 protease, serine 16 2 2
MIRT571143 HM13 histocompatibility minor 13 2 2
MIRT575202 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT575282 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 2 2
MIRT575302 Osbpl10 oxysterol binding protein-like 10 2 9
MIRT575323 Fbxo6 F-box protein 6 2 2
MIRT575377 Ang angiogenin, ribonuclease, RNase A family, 5 2 3
MIRT575614 Zswim1 zinc finger SWIM-type containing 1 2 3
MIRT575671 Map1b microtubule-associated protein 1B 2 2
MIRT607065 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 2 2
MIRT607490 HEBP2 heme binding protein 2 2 2
MIRT607522 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT607655 BTN3A2 butyrophilin subfamily 3 member A2 2 2
MIRT607795 RHBDL2 rhomboid like 2 2 2
MIRT607842 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT607927 ANG angiogenin 2 3
MIRT607966 SNX22 sorting nexin 22 2 2
MIRT608074 ZFP14 ZFP14 zinc finger protein 2 2
MIRT608141 SYAP1 synapse associated protein 1 2 2
MIRT612620 RABL3 RAB, member of RAS oncogene family like 3 2 2
MIRT617444 CCS copper chaperone for superoxide dismutase 2 2
MIRT617552 MTO1 mitochondrial tRNA translation optimization 1 2 2
MIRT618772 HLA-E major histocompatibility complex, class I, E 2 2
MIRT618926 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT619247 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT620091 YME1L1 YME1 like 1 ATPase 2 2
MIRT620483 XKR6 XK related 6 2 2
MIRT620570 WBSCR27 methyltransferase like 27 2 4
MIRT622977 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT623169 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT624165 DGKE diacylglycerol kinase epsilon 2 2
MIRT625268 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 2 2
MIRT625396 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 2 2
MIRT625694 OPTN optineurin 2 2
MIRT626093 MKLN1 muskelin 1 2 2
MIRT626431 CHDH choline dehydrogenase 2 2
MIRT627013 FIG4 FIG4 phosphoinositide 5-phosphatase 2 2
MIRT627077 SF3A1 splicing factor 3a subunit 1 2 2
MIRT627140 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT627347 TSHZ2 teashirt zinc finger homeobox 2 2 2
MIRT627420 THAP2 THAP domain containing 2 2 2
MIRT627441 TAS2R5 taste 2 receptor member 5 2 2
MIRT628078 KAT7 lysine acetyltransferase 7 2 4
MIRT628276 CYB5D1 cytochrome b5 domain containing 1 2 2
MIRT629094 F2RL1 F2R like trypsin receptor 1 2 2
MIRT629236 CINP cyclin dependent kinase 2 interacting protein 2 2
MIRT629286 UNC13A unc-13 homolog A 2 2
MIRT629407 ADM2 adrenomedullin 2 2 2
MIRT629584 RFC2 replication factor C subunit 2 2 2
MIRT629635 WDR31 WD repeat domain 31 2 2
MIRT629874 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT629984 NARS asparaginyl-tRNA synthetase 2 2
MIRT630043 TERF2 telomeric repeat binding factor 2 2 2
MIRT630061 NIP7 NIP7, nucleolar pre-rRNA processing protein 2 2
MIRT630127 ARHGEF5 Rho guanine nucleotide exchange factor 5 2 2
MIRT630155 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT630252 SMTNL2 smoothelin like 2 2 2
MIRT630278 PSMB5 proteasome subunit beta 5 2 2
MIRT630347 NKAP NFKB activating protein 2 2
MIRT630497 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT631264 CENPM centromere protein M 2 2
MIRT631403 IL2RA interleukin 2 receptor subunit alpha 2 2
MIRT632470 RPS15A ribosomal protein S15a 2 2
MIRT632596 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT632994 DUSP18 dual specificity phosphatase 18 2 2
MIRT633082 CXorf21 chromosome X open reading frame 21 2 2
MIRT633239 ZNF573 zinc finger protein 573 2 2
MIRT633286 SLC1A5 solute carrier family 1 member 5 2 2
MIRT633536 PGBD5 piggyBac transposable element derived 5 2 2
MIRT634338 SGOL1 shugoshin 1 2 2
MIRT634600 KIAA1919 major facilitator superfamily domain containing 4B 2 2
MIRT635050 MYH11 myosin heavy chain 11 2 2
MIRT635236 QPRT quinolinate phosphoribosyltransferase 2 2
MIRT635322 BMS1 BMS1, ribosome biogenesis factor 2 2
MIRT636268 RNF157 ring finger protein 157 2 2
MIRT636450 LRCH3 leucine rich repeats and calponin homology domain containing 3 2 2
MIRT636516 FMN1 formin 1 2 2
MIRT636755 SLC16A5 solute carrier family 16 member 5 2 2
MIRT637134 BAMBI BMP and activin membrane bound inhibitor 2 2
MIRT637188 ROMO1 reactive oxygen species modulator 1 2 2
MIRT637287 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT637532 RGS9BP regulator of G protein signaling 9 binding protein 2 2
MIRT637693 CEP89 centrosomal protein 89 2 2
MIRT637788 OLA1 Obg like ATPase 1 2 2
MIRT637925 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT638449 PLXDC2 plexin domain containing 2 2 2
MIRT640871 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT642643 PTGR2 prostaglandin reductase 2 2 2
MIRT643082 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643123 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT644236 SLC35E3 solute carrier family 35 member E3 2 2
MIRT644665 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT645092 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT645993 ACP6 acid phosphatase 6, lysophosphatidic 2 2
MIRT646508 FAM217B family with sequence similarity 217 member B 2 2
MIRT647013 ADCY2 adenylate cyclase 2 2 2
MIRT647095 SEC23B Sec23 homolog B, coat complex II component 2 2
MIRT647714 NFX1 nuclear transcription factor, X-box binding 1 2 4
MIRT648040 FADS6 fatty acid desaturase 6 2 2
MIRT648510 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT648865 ABCA6 ATP binding cassette subfamily A member 6 2 2
MIRT649182 DNPEP aspartyl aminopeptidase 2 2
MIRT649660 TEP1 telomerase associated protein 1 2 2
MIRT651465 XIAP X-linked inhibitor of apoptosis 2 2
MIRT652398 TMEM40 transmembrane protein 40 2 2
MIRT653691 SLC25A33 solute carrier family 25 member 33 2 2
MIRT654122 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT654577 PXMP4 peroxisomal membrane protein 4 2 2
MIRT656470 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 2
MIRT658905 DPY19L4 dpy-19 like 4 2 2
MIRT660878 ADRBK2 G protein-coupled receptor kinase 3 2 4
MIRT661101 SPIB Spi-B transcription factor 2 2
MIRT661238 ARL17B ADP ribosylation factor like GTPase 17B 2 2
MIRT661291 LIN52 lin-52 DREAM MuvB core complex component 2 2
MIRT662235 PGBD4 piggyBac transposable element derived 4 2 2
MIRT662544 MTAP methylthioadenosine phosphorylase 2 2
MIRT662736 LRRC3C leucine rich repeat containing 3C 2 2
MIRT662844 OMD osteomodulin 2 2
MIRT662907 MED18 mediator complex subunit 18 2 2
MIRT662956 JPH2 junctophilin 2 2 2
MIRT663340 ZNF74 zinc finger protein 74 2 2
MIRT663496 IYD iodotyrosine deiodinase 2 2
MIRT663523 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT663542 CCR6 C-C motif chemokine receptor 6 2 2
MIRT663903 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT663973 ZNF786 zinc finger protein 786 2 2
MIRT664350 C16orf45 chromosome 16 open reading frame 45 2 2
MIRT664417 TIGD6 tigger transposable element derived 6 2 2
MIRT664468 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT664957 PTCD3 pentatricopeptide repeat domain 3 2 2
MIRT664970 TDRD1 tudor domain containing 1 2 2
MIRT665199 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 2 2
MIRT665359 XKR4 XK related 4 2 2
MIRT665454 WDR17 WD repeat domain 17 2 2
MIRT665486 VPS53 VPS53, GARP complex subunit 2 2
MIRT666078 SSTR2 somatostatin receptor 2 2 2
MIRT666258 SLC31A1 solute carrier family 31 member 1 2 2
MIRT666324 SLC16A10 solute carrier family 16 member 10 2 2
MIRT666486 SBNO1 strawberry notch homolog 1 2 2
MIRT666696 RBM23 RNA binding motif protein 23 2 2
MIRT666712 RBL1 RB transcriptional corepressor like 1 2 2
MIRT666762 RAB10 RAB10, member RAS oncogene family 2 2
MIRT666931 PNRC1 proline rich nuclear receptor coactivator 1 2 2
MIRT667226 NFE2L1 nuclear factor, erythroid 2 like 1 2 2
MIRT667359 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT667474 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT667558 LRAT lecithin retinol acyltransferase 2 2
MIRT667748 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT668088 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT668119 GK5 glycerol kinase 5 (putative) 2 2
MIRT668166 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT668346 STXBP2 syntaxin binding protein 2 2 2
MIRT668509 ESYT2 extended synaptotagmin 2 2 2
MIRT669291 C17orf85 nuclear cap binding subunit 3 2 2
MIRT669547 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT669778 CNDP1 carnosine dipeptidase 1 2 2
MIRT669858 BROX BRO1 domain and CAAX motif containing 2 4
MIRT670017 TECPR1 tectonin beta-propeller repeat containing 1 2 2
MIRT670177 CCDC142 coiled-coil domain containing 142 2 2
MIRT671107 ZNF841 zinc finger protein 841 2 2
MIRT671351 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 2
MIRT671476 FLYWCH2 FLYWCH family member 2 2 2
MIRT671492 SLC38A9 solute carrier family 38 member 9 2 2
MIRT671554 LIMS1 LIM zinc finger domain containing 1 2 2
MIRT671925 PLEKHS1 pleckstrin homology domain containing S1 2 4
MIRT672196 F2 coagulation factor II, thrombin 2 2
MIRT672217 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT672252 SIK2 salt inducible kinase 2 2 2
MIRT672290 GP2 glycoprotein 2 2 2
MIRT672430 POLR2D RNA polymerase II subunit D 2 2
MIRT672597 NKPD1 NTPase KAP family P-loop domain containing 1 2 2
MIRT672901 KRBA2 KRAB-A domain containing 2 2 2
MIRT672958 ZNF655 zinc finger protein 655 2 2
MIRT673096 SYNPO2L synaptopodin 2 like 2 2
MIRT673171 TMEM56 transmembrane protein 56 2 2
MIRT673251 INO80 INO80 complex subunit 2 2
MIRT673296 RNF19B ring finger protein 19B 2 2
MIRT673574 KDELC2 KDEL motif containing 2 2 2
MIRT673586 KIF1C kinesin family member 1C 2 2
MIRT673737 TCF23 transcription factor 23 2 2
MIRT673767 MRPL17 mitochondrial ribosomal protein L17 2 2
MIRT674215 FAM120AOS family with sequence similarity 120A opposite strand 2 2
MIRT674283 NAGK N-acetylglucosamine kinase 2 2
MIRT674338 KCMF1 potassium channel modulatory factor 1 2 2
MIRT674517 PRR23A proline rich 23A 2 2
MIRT675100 SNTB2 syntrophin beta 2 2 2
MIRT675144 MOGAT1 monoacylglycerol O-acyltransferase 1 2 4
MIRT675223 CLK4 CDC like kinase 4 2 2
MIRT675263 ZNF431 zinc finger protein 431 2 2
MIRT675577 WWC1 WW and C2 domain containing 1 2 2
MIRT676025 C9orf69 transmembrane protein 250 2 2
MIRT676430 PLEKHM3 pleckstrin homology domain containing M3 2 2
MIRT676560 VSIG1 V-set and immunoglobulin domain containing 1 2 2
MIRT676596 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 2 2
MIRT678576 TMEM168 transmembrane protein 168 2 2
MIRT678756 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 2
MIRT680344 ZNF281 zinc finger protein 281 2 2
MIRT680467 C3 complement C3 2 2
MIRT682826 FLG2 filaggrin family member 2 2 2
MIRT682881 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT684404 TMEM180 major facilitator superfamily domain containing 13A 2 2
MIRT685275 KIAA1143 KIAA1143 2 2
MIRT686061 KCNA7 potassium voltage-gated channel subfamily A member 7 2 2
MIRT687526 NASP nuclear autoantigenic sperm protein 2 2
MIRT691760 BCL2L15 BCL2 like 15 2 2
MIRT693890 C3orf62 chromosome 3 open reading frame 62 2 2
MIRT699342 SLC35E1 solute carrier family 35 member E1 2 2
MIRT699909 RUNDC1 RUN domain containing 1 2 2
MIRT700536 PTPDC1 protein tyrosine phosphatase domain containing 1 2 2
MIRT701807 MRPS25 mitochondrial ribosomal protein S25 2 2
MIRT702174 LYRM4 LYR motif containing 4 2 2
MIRT706205 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT706659 RNF216 ring finger protein 216 2 2
MIRT706682 COL13A1 collagen type XIII alpha 1 chain 2 2
MIRT706705 GPR155 G protein-coupled receptor 155 2 2
MIRT706777 ANKRD36 ankyrin repeat domain 36 2 2
MIRT706844 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 2 2
MIRT706863 MAFF MAF bZIP transcription factor F 2 2
MIRT706896 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 2 2
MIRT706916 THAP6 THAP domain containing 6 2 2
MIRT706962 FANCC Fanconi anemia complementation group C 2 2
MIRT706980 XPO5 exportin 5 2 2
MIRT707015 RRP36 ribosomal RNA processing 36 2 2
MIRT707032 ACTR5 ARP5 actin related protein 5 homolog 2 2
MIRT707072 MED29 mediator complex subunit 29 2 2
MIRT709368 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 2 2
MIRT720092 SPTLC3 serine palmitoyltransferase long chain base subunit 3 2 2
MIRT721330 IFNAR2 interferon alpha and beta receptor subunit 2 2 2
MIRT724198 MED7 mediator complex subunit 7 2 2
MIRT725403 KIF6 kinesin family member 6 2 2
MIRT733035 COL4A2 collagen type IV alpha 2 chain 1 0
MIRT733036 COL26A1 collagen type XXVI alpha 1 chain 1 0
MIRT733426 PLK1 polo like kinase 1 3 0
MIRT734484 PLD1 phospholipase D1 3 0
MIRT736044 CBL Cbl proto-oncogene 3 0
MIRT755352 IGFBP4 insulin like growth factor binding protein 4 6 1
MIRT755559 DLAT dihydrolipoamide S-acetyltransferase 1 1
MIRT755560 RIMS1 regulating synaptic membrane exocytosis 1 1 1
MIRT756173 AGPAT1 1-acylglycerol-3-phosphate O-acyltransferase 1 4 1
MIRT756174 DGAT1 diacylglycerol O-acyltransferase 1 4 1
MIRT756175 TG thyroglobulin 4 1
MIRT756400 SMAD3 SMAD family member 3 3 1
MIRT756415 MUC1 mucin 1, cell surface associated 3 1
MIRT756436 BCL9 B-cell CLL/lymphoma 9 2 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-122 Quercetin NULL 5280343 Quantitative real-time PCR liver 22402395 2012 up-regulated
miR-122 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Quantitative real-time PCR thymus 23024791 2012 up-regulated
miR-122 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-122 Streptozotocin (STZ) NULL 29327 Microarray streptozotocin (STZ)-induced type 1 diabetic mice 19372595 2009 down-regulated
miR-122 Streptozotocin (STZ) NULL 29327 Quantitative real-time PCR streptozotocin (STZ)-induced type 1 diabetic mice 19372595 2009 down-regulated
miR-122 Tert-butyl hydroperoxide (t-BHP) NULL 6410 Microarray mouse auditory cells 20510889 2010 down-regulated
miR-122 Benzo(a)pyrene NULL 2336 Microarray Adult male B6C3F1 mice 21569818 2011 down-regulated
miR-122 Glucose NULL 5793 Microarray endothelial cells 24394957 2014 up-regulated
miR-122 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-122 Bortezomib approved 387447 Quantitative real-time PCR SeAx and MyLa2000 cells 22235305 2012 up-regulated
miR-122 Doxorubicin approved 31703 Quantitative real-time PCR SeAx and MyLa2000 cells 22235305 2012 up-regulated
miR-122 MG132 NULL 462382 Quantitative real-time PCR SeAx and MyLa2000 cells 22235305 2012 up-regulated
miR-122 Microcystin-LR (MC-LR) NULL 445434 Quantitative real-time PCR WRL-68 Cells 22265967 2012 down-regulated
miR-122 Furan NULL 8029 Quantitative real-time PCR liver 22079235 2011 down-regulated
miR-122 Proanthocyanidins approved 108065 Quantitative real-time PCR liver cells 23922812 2013 down-regualted
miR-122 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 down-regulated
miR-122 Dexamethasone approved 5743 Quantitative real-time PCR adrenals and granulosa cells 24205079 2014 down-regulated
miR-122 Proanthocyanidins approved 108065 Quantitative real-time PCR postprandial lipemia and liver 24445039 2014 down-regulated
miR-122 Aristolochic acid NULL 2236 Microarray kidney 25106556 2014 down-regualted
miR-122 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-122 Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-122 Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-mir-122 Fluorouracil 3385 NSC19893 approved resistant cell line (OE19)
hsa-mir-122 Decitabine 451668 approved resistant tissue (esopheageal cancer)
hsa-miR-122-5p Doxorubicin 31703 NSC123127 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-122-5p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2, Hep3B, SK-Hep-1)
hsa-miR-122-5p Cisplatin 5460033 NSC119875 approved sensitive Low Hepatocellular Carcinoma tissue and cell line (Huh-7)
hsa-miR-122-5p Doxorubicin 31703 NSC123127 approved sensitive Low Hepatocellular Carcinoma tissue and cell line (Huh-7)
hsa-miR-122-5p Doxorubicin 31703 NSC123127 approved sensitive Low Hepatocellular Carcinoma cell line (Hep3B, HepG2, Huh7, PLC/PRF/5, HEK293)
hsa-miR-122-5p Vincristine 5978 approved sensitive Low Hepatocellular Carcinoma cell line (Hep3B, HepG2, Huh7, PLC/PRF/5, HEK293)
hsa-miR-122-5p Bortezomib 387447 NSC681239 approved resistant Low Cutaneous T-Cell Lymphoma cell line (SeAx, MyLa2000)
hsa-miR-122-5p Doxorubicin 31703 NSC123127 approved resistant Low Cutaneous T-Cell Lymphoma cell line (SeAx, MyLa2000)
hsa-miR-122-5p Fluorouracil 3385 NSC19893 approved sensitive Low Hepatoblastoma cell line (BEL-7402)
hsa-miR-122-5p Pegifn/Rbv Therapy sensitive Low Chronic Hepatitis C tissue
hsa-miR-122-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-122-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-122-5p Fluorouracil 3385 NSC19893 approved resistant High Colorectal Cancer tissue
hsa-miR-122-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer tissue
hsa-miR-122-5p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-122-5p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-122-5p Fluorouracil 3385 NSC19893 approved sensitive Low Colon Cancer tissue and cell line (HCT-116, HCT-29)
hsa-miR-122-5p Gefitinib 123631 NSC715055 approved sensitive High Lung Adenocarcinoma cell line (A549)
hsa-miR-122-5p Pegylated Alpha Interferon + Ribavirin sensitive Low Hepatitis C Virus Injection tissue
hsa-miR-122-5p Fluorouracil 3385 NSC19893 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2, Huh-7)
hsa-miR-122-5p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2, Huh-7)
hsa-miR-122-5p Sorafenib 216239 NSC747971 approved resistant Low Hepatocellular Carcinoma cell line (PLC, Huh7)
hsa-miR-122-5p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-122-5p Fluorouracil 3385 NSC19893 approved resistant Low Hepatocellular Carcinoma cell line (SNU-449, MHCC97, HepG2, SMMC-7721)
hsa-miR-122-5p Taxol 36314 NSC125973 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-122-5p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-122-5p Cisplatin 5460033 NSC119875 approved resistant Low Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-122-5p Doxorubicin 31703 NSC123127 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-122-5p Cyclophosphamide + Doxorubicin + Vincristine + Prednisone + Rituximab sensitive High Diffuse Large B-Cell Lymphoma cell line (SU-DHL-2)
hsa-miR-122-5p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer cell line (SW480, HT-29)
hsa-miR-122-5p Oxaliplatin 6857599 NSC266046 approved sensitive Low Hepatocellular Carcinoma cell line (Bel-7402, SMMC-7721)
hsa-miR-122-5p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (HepG2, Hep3B, Huh-7)
hsa-miR-122-5p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7, MCF-7-TT)
hsa-miR-122-5p Cetuximab + Folfox(Fluorouracil + Leucovorin + Oxaliplatin) resistant High Metastatic Colorectal Cancer tissue
hsa-miR-122-5p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (MGC-803)
hsa-miR-122-5p Bromocriptine 31101 NSC169774 approved sensitive High Prolactinoma tissue
hsa-miR-122-5p Bortezomib 387447 NSC681239 approved resistant Low Multiple Myeloma tissue
hsa-miR-122-5p Sorafenib 216239 NSC747971 approved sensitive High Hepatocellular Carcinoma cell line (Huh-7, PLC)
hsa-miR-122-5p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-122-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-122-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-122-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM43)
hsa-miR-122-5p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-122-5p Ribavirin+Pegylated IFNa-2b sensitive tissue (chronic hepatitis C)
hsa-miR-122-5p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-122-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-122-5p Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-122-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-122-5p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-122-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-122-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-122-5p Cetuximab resistant tissue (colorectal carcinoma)

Error report submission