pre-miRNA Information
pre-miRNA hsa-mir-4707   
Genomic Coordinates chr14: 22956950 - 22957029
Description Homo sapiens miR-4707 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4707-3p
Sequence 52| AGCCCGCCCCAGCCGAGGUUCU |73
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1180125593 2 dbSNP
rs1390998288 5 dbSNP
rs2273626 6 dbSNP
rs765507627 7 dbSNP
rs1299611135 9 dbSNP
rs1158707105 11 dbSNP
rs535691977 15 dbSNP
rs952013388 17 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MFAP2   
Synonyms MAGP, MAGP-1, MAGP1
Description microfibril associated protein 2
Transcript NM_001135247   
Other Transcripts NM_001135248 , NM_002403 , NM_017459   
Expression
Putative miRNA Targets on MFAP2
3'UTR of MFAP2
(miRNA target sites are highlighted)
>MFAP2|NM_001135247|3'UTR
   1 GGTGGTGCTGGCATCCTGAGTCCTGGCCCTCCTGGGATCTGGGGCCCTCGGGCCCTGCCTGACCTGGTGCTTTTTTCCCC
  81 ATCCCCATGTTCCTTTTATTCTGTAAAAAGTTAGTGGACTGCAGCCCTGGGGGTTGCAGGCTGCGGTGCCTCAGGCCCCT
 161 CCTTCAGCCTGTGGCCACCTCTGGGGCACAATGGGGGCTCCCCACTGCCCAGTCTGCCCCTCGGGTTGGGGGAGTATCCC
 241 AGGCCTCTCTGTGGGACCTGGGCCCCTGACGGGCCTTCTCAGCCCGTTTTGAGGACAGACAGTCCCCCGAGGTAGGCTAC
 321 ATCCCCCCACCCCAGCTGGTCTGCTTGGATTTCCTACAGCCCCCGTGGGCATGGACCACCTTTATTTTATACAAAATTAA
 401 AAACAAGTTTTTACAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ucUUGGAGCC-GACCCCGCCCGa 5'
            :|||| || |   | ||||| 
Target 5' ggGACCTGGGCCCCTGACGGGCc 3'
253 - 275 124.00 -23.00
2
miRNA  3' ucuuGGAGCC--GACCCC----GCCCGa 5'
              ||| ||  ||||||    ||||| 
Target 5' ccctCCTGGGATCTGGGGCCCTCGGGCc 3'
27 - 54 116.00 -26.80
3
miRNA  3' ucuuggagccgacccCGCCCGa 5'
                         |:|||| 
Target 5' tttcctacagcccccGTGGGCa 3'
350 - 371 104.00 -12.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31587671 20 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1276520058 2 dbSNP
rs892629282 5 dbSNP
rs1341052989 10 dbSNP
rs1272084089 12 dbSNP
rs1376109386 15 dbSNP
rs755139084 21 dbSNP
rs1379332831 22 dbSNP
rs1283082019 29 dbSNP
rs1236126389 33 dbSNP
rs1447947622 34 dbSNP
rs1283117939 36 dbSNP
rs1354047337 39 dbSNP
rs1310262377 45 dbSNP
rs558016097 49 dbSNP
rs1370306635 50 dbSNP
rs1390882147 53 dbSNP
rs936874783 57 dbSNP
rs1431389724 69 dbSNP
rs1400325621 80 dbSNP
rs921321459 89 dbSNP
rs1438607805 92 dbSNP
rs1039821054 103 dbSNP
rs538806350 115 dbSNP
rs1461460815 116 dbSNP
rs1191484454 132 dbSNP
rs1455445029 133 dbSNP
rs1208529055 135 dbSNP
rs1308423467 140 dbSNP
rs944018745 144 dbSNP
rs1374784992 153 dbSNP
rs1317167818 156 dbSNP
rs912603620 158 dbSNP
rs1453693182 161 dbSNP
rs1405560089 174 dbSNP
rs1301292679 186 dbSNP
rs1051225 190 dbSNP
rs950603433 196 dbSNP
rs1414926226 205 dbSNP
rs1346738568 210 dbSNP
rs1465320682 217 dbSNP
rs1418955426 222 dbSNP
rs1377986853 247 dbSNP
rs1184856168 271 dbSNP
rs919178393 283 dbSNP
rs973620556 284 dbSNP
rs1179752286 285 dbSNP
rs1487088878 286 dbSNP
rs1261624533 295 dbSNP
rs1261968675 298 dbSNP
rs1352097096 300 dbSNP
rs1294070824 320 dbSNP
rs963255213 322 dbSNP
rs1246864420 328 dbSNP
rs1339912387 336 dbSNP
rs1310930225 370 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' ucuuggagCCGACCCCGCCCGa 5'
                  ||||| ||||||| 
Target 5' cuuagggaGGCUGAGGCGGGC- 3'
1 - 21
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000375534.3 | 3UTR | CUUAGGGAGGCUGAGGCGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
91 hsa-miR-4707-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT442514 SYT7 synaptotagmin 7 2 4
MIRT457799 NQO2 N-ribosyldihydronicotinamide:quinone reductase 2 2 2
MIRT466318 THRA thyroid hormone receptor, alpha 2 2
MIRT486129 TRAF3 TNF receptor associated factor 3 2 2
MIRT492341 SEPT8 septin 8 2 2
MIRT495690 KCNC3 potassium voltage-gated channel subfamily C member 3 2 2
MIRT496928 DPYSL5 dihydropyrimidinase like 5 2 2
MIRT499518 MAFK MAF bZIP transcription factor K 2 2
MIRT501367 REXO1 RNA exonuclease 1 homolog 2 4
MIRT501636 PIAS4 protein inhibitor of activated STAT 4 2 4
MIRT521071 SLC25A16 solute carrier family 25 member 16 2 2
MIRT525700 PCYT2 phosphate cytidylyltransferase 2, ethanolamine 2 2
MIRT532722 DDTL D-dopachrome tautomerase like 2 2
MIRT533137 WWC1 WW and C2 domain containing 1 2 4
MIRT537288 G3BP1 G3BP stress granule assembly factor 1 2 4
MIRT570555 PHF21B PHD finger protein 21B 2 2
MIRT573469 MTRNR2L9 MT-RNR2-like 9 2 2
MIRT576750 Tmem127 transmembrane protein 127 2 2
MIRT609342 DAAM2 dishevelled associated activator of morphogenesis 2 2 2
MIRT610638 PIGM phosphatidylinositol glycan anchor biosynthesis class M 2 2
MIRT612591 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT614237 WDR53 WD repeat domain 53 2 4
MIRT622784 PGK1 phosphoglycerate kinase 1 2 2
MIRT628880 MED16 mediator complex subunit 16 2 2
MIRT629550 SPN sialophorin 2 2
MIRT634714 DDX19B DEAD-box helicase 19B 2 2
MIRT634932 GTF2H2C GTF2H2 family member C 2 4
MIRT635341 RBL1 RB transcriptional corepressor like 1 2 2
MIRT637838 CPT1A carnitine palmitoyltransferase 1A 2 2
MIRT644311 NFKBID NFKB inhibitor delta 2 2
MIRT649206 KIAA1715 lunapark, ER junction formation factor 2 2
MIRT657262 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT658919 DPY19L4 dpy-19 like 4 2 2
MIRT663608 SEC23B Sec23 homolog B, coat complex II component 2 2
MIRT667425 MFAP2 microfibril associated protein 2 2 2
MIRT667667 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT668144 GDPD1 glycerophosphodiester phosphodiesterase domain containing 1 2 2
MIRT668540 ERGIC1 endoplasmic reticulum-golgi intermediate compartment 1 2 2
MIRT670039 NFRKB nuclear factor related to kappaB binding protein 2 2
MIRT670875 RAB10 RAB10, member RAS oncogene family 2 2
MIRT672694 ZNF677 zinc finger protein 677 2 2
MIRT673107 MFSD2A major facilitator superfamily domain containing 2A 2 2
MIRT673508 TNFAIP8L1 TNF alpha induced protein 8 like 1 2 4
MIRT674244 NUP62 nucleoporin 62 2 4
MIRT676541 IRGQ immunity related GTPase Q 2 2
MIRT676787 CXorf38 chromosome X open reading frame 38 2 4
MIRT677600 PRKX protein kinase, X-linked 2 2
MIRT678607 MRPL17 mitochondrial ribosomal protein L17 2 2
MIRT678940 MYADM myeloid associated differentiation marker 2 2
MIRT679104 CD99 CD99 molecule (Xg blood group) 2 2
MIRT679196 WNT2B Wnt family member 2B 2 2
MIRT679325 ZMYM4 zinc finger MYM-type containing 4 2 2
MIRT679634 BRMS1L breast cancer metastasis-suppressor 1 like 2 2
MIRT679819 TMEM106B transmembrane protein 106B 2 2
MIRT679898 FBXO48 F-box protein 48 2 2
MIRT680579 ZNF784 zinc finger protein 784 2 2
MIRT680600 SZT2 SZT2, KICSTOR complex subunit 2 2
MIRT682991 RNF40 ring finger protein 40 2 4
MIRT683483 ZNF7 zinc finger protein 7 2 2
MIRT683681 MICA MHC class I polypeptide-related sequence A 2 2
MIRT684122 CEP104 centrosomal protein 104 2 2
MIRT684774 MYO1F myosin IF 2 2
MIRT685698 BHMT2 betaine--homocysteine S-methyltransferase 2 2 2
MIRT686471 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT687940 HMGB1 high mobility group box 1 2 2
MIRT688627 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT689110 ZBTB25 zinc finger and BTB domain containing 25 2 2
MIRT690063 MBD1 methyl-CpG binding domain protein 1 2 2
MIRT691067 NUGGC nuclear GTPase, germinal center associated 2 2
MIRT691317 KIAA1841 KIAA1841 2 2
MIRT692778 SYNPO2L synaptopodin 2 like 2 2
MIRT694087 KIAA0930 KIAA0930 2 2
MIRT696148 WDR59 WD repeat domain 59 2 2
MIRT696176 GNB5 G protein subunit beta 5 2 2
MIRT696434 SUGP1 SURP and G-patch domain containing 1 2 2
MIRT697974 TSPAN6 tetraspanin 6 2 2
MIRT698917 SPEM1 spermatid maturation 1 2 2
MIRT699312 SLC35F5 solute carrier family 35 member F5 2 4
MIRT700500 PTPN4 protein tyrosine phosphatase, non-receptor type 4 2 2
MIRT700557 PTBP1 polypyrimidine tract binding protein 1 2 2
MIRT701817 MRPL37 mitochondrial ribosomal protein L37 2 2
MIRT702045 METTL21A methyltransferase like 21A 2 2
MIRT702215 LPCAT1 lysophosphatidylcholine acyltransferase 1 2 2
MIRT702337 KLHL7 kelch like family member 7 2 2
MIRT704139 DNAL1 dynein axonemal light chain 1 2 2
MIRT704189 LDHD lactate dehydrogenase D 2 2
MIRT705344 ATP1B3 ATPase Na+/K+ transporting subunit beta 3 2 2
MIRT706097 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT709068 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT717579 VTA1 vesicle trafficking 1 2 2
MIRT722440 ZBTB7B zinc finger and BTB domain containing 7B 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4707 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-mir-4707 Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-mir-4707 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-4707 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-4707-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-4707-3p Tripterygium wilfordii Hook F sensitive tissue
hsa-miR-4707-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-4707-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (LCC2)
hsa-miR-4707-3p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-4707-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission