pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-873 |
Genomic Coordinates | chr9: 28888879 - 28888955 |
Synonyms | MIRN873, hsa-mir-873, MIR873 |
Description | Homo sapiens miR-873 stem-loop |
Comment | This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques . |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | ||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-873-3p | |||||||||||||||||||||
Sequence | 46| GGAGACUGAUGAGUUCCCGGGA |67 | |||||||||||||||||||||
Evidence | Not_experimental | |||||||||||||||||||||
Experiments | ||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | KNSTRN | ||||||||||||||||||||
Synonyms | C15orf23, HSD11, SKAP, TRAF4AF1 | ||||||||||||||||||||
Description | kinetochore localized astrin/SPAG5 binding protein | ||||||||||||||||||||
Transcript | NM_001142761 | ||||||||||||||||||||
Other Transcripts | NM_001142762 , NM_033286 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on KNSTRN | |||||||||||||||||||||
3'UTR of KNSTRN (miRNA target sites are highlighted) |
>KNSTRN|NM_001142761|3'UTR
1 AGGATTTCATCGTTCCAGTTTAGATACAGGAGTCTAGTCCCTCTCTACTACTAGAGGGACAATTCCTAAAACCAGTGCAT
81 AGAAATAAAATCTAAAATAGAAGATACAGTCTGTTGATACTCCAGTGGTCTTCCTTAGTGGAATAGGAGCATAATGTTCT
161 GATGTGGGAATTGTGTTTCCTGTTAGTCAAGAGTTTTGTGTATGTGTTGTTTTCTTTTGGAATGTCTTTCCATGCAGGCC
241 TTAAAGGTAAAGCTGGAGATGAAAGAGGAAAGAGTCCGATTCCTAGAACAGCAAACCTTATGTAACAATCAAGTAAATGA
321 TTTAACAACAGCCCTTAAGGAAATGGAGCAGCTATTAGAAATGTAAGAAGAAGCAAGTGGCCAGATGGCTCCCTCTTGGG
401 CATAAAATCTCAGAGGAAGCTACTTAGGACATCATCTTGGCCATGATCTTCTGGGACTCACCATCTCCAGAATGAAAACA
481 ATTTCTACAGTAGACTTAAGGACAGTTTATGCTGAAATGGCAATTCCTCATTTAAGCAAGTTTTCCCAACCTTCAGGTTG
561 GTCAGCCCTCCTGAGCCTCACAGGTGGATAATTGAGGCCTACAAGAGAGGGGAGCCTAGGAGCTTGGATTGACCTTCTAG
641 TCAACCACCTGACTTCAGCACACCATTACAATCGGGAGACTAAACCAACAACCAGAGGATCTAAAATGTCACATTCAGAT
721 TTTCAGGAAGAAAATCTTCATTACAGTGGAGCACAAATGTTCCATACAAGACATCATTGAGGAGCCATGCTGTCCCCTTC
801 TAACCTGAAACACATTCTTTCCCATCCTGGTTGGGCTTCTGTACCTCCTTATTAATTTATGAACCTGAAGTTGCTTGAAG
881 TGTTTTGGGCTTAATAAATGGGGTGAAAGTATAGGTAGCAGTAACACCTACATGAAACAATACACCTTGGATCTTTTAAT
961 CTAAATTACTTTTCTTTTTTAAGTCTACTTTTAAAATAAATACTTCTGTAAATATTCTGACTGTAACATTGAGGAATGAA
1041 AATAGCCTTTTAACCTAAAAAAA
Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293S | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | Prostate Tissue | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760630. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_A
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
CLIP-seq Support 1 for dataset GSM1084064 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noemetine_AbnovaAb |
Location of target site | ENST00000608100.1 | 3UTR | AGUCUCACUCUGUUGCCUAGGCU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
108 hsa-miR-873-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT081178 | MIDN | midnolin | ![]() |
![]() |
2 | 4 | ||||||
MIRT109809 | ZFX | zinc finger protein, X-linked | ![]() |
![]() |
2 | 4 | ||||||
MIRT242383 | TMC5 | transmembrane channel like 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT444003 | METRN | meteorin, glial cell differentiation regulator | ![]() |
![]() |
2 | 4 | ||||||
MIRT444097 | SEPHS1 | selenophosphate synthetase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446158 | RPL12 | ribosomal protein L12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446859 | SAMD9L | sterile alpha motif domain containing 9 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT447275 | FZD5 | frizzled class receptor 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT447391 | TMPRSS15 | transmembrane protease, serine 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT448817 | FKBP1A | FK506 binding protein 1A | ![]() |
![]() |
2 | 4 | ||||||
MIRT450582 | HIST1H2BG | histone cluster 1 H2B family member g | ![]() |
![]() |
2 | 2 | ||||||
MIRT451776 | USP36 | ubiquitin specific peptidase 36 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457961 | ABCC5 | ATP binding cassette subfamily C member 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT458424 | KLHL38 | kelch like family member 38 | ![]() |
![]() |
2 | 4 | ||||||
MIRT461383 | SLFN12L | schlafen family member 12 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT467793 | SLC2A14 | solute carrier family 2 member 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT476517 | GABRB1 | gamma-aminobutyric acid type A receptor beta1 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT480290 | C7orf73 | short transmembrane mitochondrial protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT482745 | HES7 | hes family bHLH transcription factor 7 | ![]() |
![]() |
2 | 10 | ||||||
MIRT483189 | HIST1H2AH | histone cluster 1 H2A family member h | ![]() |
![]() |
2 | 6 | ||||||
MIRT486545 | DCTN4 | dynactin subunit 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT486581 | ZNF619 | zinc finger protein 619 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492604 | POLR3E | RNA polymerase III subunit E | ![]() |
![]() |
2 | 2 | ||||||
MIRT494130 | DCAF7 | DDB1 and CUL4 associated factor 7 | ![]() |
![]() |
2 | 6 | ||||||
MIRT496023 | ZBED3 | zinc finger BED-type containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT497121 | NBEAL1 | neurobeachin like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT497400 | TMEM245 | transmembrane protein 245 | ![]() |
![]() |
2 | 2 | ||||||
MIRT501410 | RANBP10 | RAN binding protein 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT510947 | PPTC7 | PTC7 protein phosphatase homolog | ![]() |
![]() |
2 | 6 | ||||||
MIRT512494 | ARID2 | AT-rich interaction domain 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT512595 | ZNF783 | zinc finger family member 783 | ![]() |
![]() |
2 | 2 | ||||||
MIRT512612 | CNTN4 | contactin 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT517808 | UGDH | UDP-glucose 6-dehydrogenase | ![]() |
![]() |
2 | 6 | ||||||
MIRT520686 | TMED7 | transmembrane p24 trafficking protein 7 | ![]() |
![]() |
2 | 4 | ||||||
MIRT526179 | HEPH | hephaestin | ![]() |
![]() |
2 | 2 | ||||||
MIRT532568 | CSTF1 | cleavage stimulation factor subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533979 | TADA2A | transcriptional adaptor 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT538622 | CCSER2 | coiled-coil serine rich protein 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT539703 | EIF3H | eukaryotic translation initiation factor 3 subunit H | ![]() |
![]() |
2 | 2 | ||||||
MIRT539806 | GAPVD1 | GTPase activating protein and VPS9 domains 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540422 | FAM83F | family with sequence similarity 83 member F | ![]() |
![]() |
2 | 2 | ||||||
MIRT540506 | CXCL10 | C-X-C motif chemokine ligand 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540619 | F2RL2 | coagulation factor II thrombin receptor like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542423 | ZNF331 | zinc finger protein 331 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542454 | AKR7A2 | aldo-keto reductase family 7 member A2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT543383 | CC2D2A | coiled-coil and C2 domain containing 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT544777 | CSTF2T | cleavage stimulation factor subunit 2 tau variant | ![]() |
![]() |
2 | 4 | ||||||
MIRT544923 | ERCC4 | ERCC excision repair 4, endonuclease catalytic subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT549768 | ZNF611 | zinc finger protein 611 | ![]() |
![]() |
2 | 4 | ||||||
MIRT551242 | COLEC10 | collectin subfamily member 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT560474 | ENSA | endosulfine alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT569738 | GPR173 | G protein-coupled receptor 173 | ![]() |
![]() |
2 | 2 | ||||||
MIRT571297 | CHCHD4 | coiled-coil-helix-coiled-coil-helix domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572345 | CKAP2L | cytoskeleton associated protein 2 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT573112 | ERBB2IP | erbb2 interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT607744 | ANGPT4 | angiopoietin 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT607903 | SPRYD4 | SPRY domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT611744 | SERPING1 | serpin family G member 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT615101 | BNC2 | basonuclin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT619124 | CD40LG | CD40 ligand | ![]() |
![]() |
2 | 2 | ||||||
MIRT625572 | ANKRD42 | ankyrin repeat domain 42 | ![]() |
![]() |
2 | 2 | ||||||
MIRT629038 | KLLN | killin, p53-regulated DNA replication inhibitor | ![]() |
![]() |
2 | 2 | ||||||
MIRT633986 | SLC35E2 | solute carrier family 35 member E2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635675 | COX18 | COX18, cytochrome c oxidase assembly factor | ![]() |
![]() |
2 | 4 | ||||||
MIRT637471 | DEFB105B | defensin beta 105B | ![]() |
![]() |
2 | 4 | ||||||
MIRT637503 | DEFB105A | defensin beta 105A | ![]() |
![]() |
2 | 4 | ||||||
MIRT639735 | MAP2K2 | mitogen-activated protein kinase kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT640730 | C9orf64 | chromosome 9 open reading frame 64 | ![]() |
![]() |
2 | 2 | ||||||
MIRT645364 | C9orf47 | chromosome 9 open reading frame 47 | ![]() |
![]() |
2 | 2 | ||||||
MIRT647938 | RNF152 | ring finger protein 152 | ![]() |
![]() |
2 | 2 | ||||||
MIRT649400 | SH2D4A | SH2 domain containing 4A | ![]() |
![]() |
2 | 2 | ||||||
MIRT656860 | KIN | Kin17 DNA and RNA binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT663470 | POFUT2 | protein O-fucosyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663507 | NKAPL | NFKB activating protein like | ![]() |
![]() |
2 | 4 | ||||||
MIRT667690 | KNSTRN | kinetochore localized astrin/SPAG5 binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT677403 | PCNP | PEST proteolytic signal containing nuclear protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT678682 | SCUBE3 | signal peptide, CUB domain and EGF like domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT678789 | NUPL2 | nucleoporin like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT680649 | KIAA1456 | KIAA1456 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682450 | MTX3 | metaxin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682740 | CA6 | carbonic anhydrase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT684421 | TUFT1 | tuftelin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690535 | TRAPPC2 | trafficking protein particle complex 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690595 | C17orf105 | chromosome 17 open reading frame 105 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690771 | PLA2G2C | phospholipase A2 group IIC | ![]() |
![]() |
2 | 2 | ||||||
MIRT692233 | ALDH1B1 | aldehyde dehydrogenase 1 family member B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693667 | MXRA7 | matrix remodeling associated 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695551 | CLPB | ClpB homolog, mitochondrial AAA ATPase chaperonin | ![]() |
![]() |
2 | 2 | ||||||
MIRT695870 | C19orf52 | translocase of inner mitochondrial membrane 29 | ![]() |
![]() |
2 | 2 | ||||||
MIRT696214 | LYZ | lysozyme | ![]() |
![]() |
2 | 2 | ||||||
MIRT698368 | TMED4 | transmembrane p24 trafficking protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700795 | PHTF2 | putative homeodomain transcription factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701640 | MYLK3 | myosin light chain kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT702989 | HERPUD2 | HERPUD family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703627 | FBXL3 | F-box and leucine rich repeat protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703783 | FAM102B | family with sequence similarity 102 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT704293 | DDX19B | DEAD-box helicase 19B | ![]() |
![]() |
2 | 2 | ||||||
MIRT704828 | CDC73 | cell division cycle 73 | ![]() |
![]() |
2 | 2 | ||||||
MIRT705014 | CAMK2N1 | calcium/calmodulin dependent protein kinase II inhibitor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT708480 | OLR1 | oxidized low density lipoprotein receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT710770 | PHF7 | PHD finger protein 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT718918 | TRIM66 | tripartite motif containing 66 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720390 | ZNF549 | zinc finger protein 549 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720593 | TTC39C | tetratricopeptide repeat domain 39C | ![]() |
![]() |
2 | 2 | ||||||
MIRT723515 | SIGLEC8 | sialic acid binding Ig like lectin 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT724458 | PRKX | protein kinase, X-linked | ![]() |
![]() |
2 | 2 | ||||||
MIRT737267 | UMAD1 | UBAP1-MVB12-associated (UMA) domain containing 1 | ![]() |
![]() |
![]() |
3 | 0 | |||||
MIRT737356 | ZIC2 | Zic family member 2 | ![]() |
![]() |
![]() |
![]() |
4 | 0 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|