pre-miRNA Information
pre-miRNA hsa-mir-4793   
Genomic Coordinates chr3: 48644194 - 48644280
Description Homo sapiens miR-4793 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4793-3p
Sequence 58| UCUGCACUGUGAGUUGGCUGGCU |80
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSM5899925 14 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs779602935 6 dbSNP
rs757908486 7 dbSNP
rs1422853760 15 dbSNP
rs377721296 23 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol EHD4   
Synonyms PAST4
Description EH domain containing 4
Transcript NM_139265   
Expression
Putative miRNA Targets on EHD4
3'UTR of EHD4
(miRNA target sites are highlighted)
>EHD4|NM_139265|3'UTR
   1 GGGGTGGGCTGCAGAACGGGGTGGGAACTGGGGGACCTGGGCCTCAGGCCTGCTCCACCACTGACTCACCGAATGACCTT
  81 GGGCAAGGCACTGCCCTCTCTGTGCCTTGGTTTCCCCATCTGTAGAATGGGGAGGGTGGACACTGGAAACTAGATGACTT
 161 CTTTCACCTCCAAAATTCCCTTAGTTTCTATGAAAATATTGGGGGTAGGGGGGTGGATTAGGAGATTGAAGGGTTGAGAA
 241 GAAAGAGAAATTGTCCAAAGAGTCCTCAGAACCTGCCTGGAGAAATGCGCATGGGGGTGGGCCTGGTAAGTCCCAGGAAC
 321 CACAGGAAGTGAGCTAAGGCTCACCCAGAGCAGCTGGGTCTCCAGGCTGCCTGGGCTTTTTGTCCTCATGAACAACTCTG
 401 GAGCAGCTGTCTGTCCCTCAGAGGGCACCTGGAGGCAGCAAAGATTATCTTATTTATTTTATTTTGTTTTCTGCTATATT
 481 TAGAGTGGCAAAAAAATAGAGCAGAGGGTTTCTGCTGTCTCCAGACTGTCTACCAAAGAGAAGGCGACAGATGCCTCCTG
 561 GGTTTGGAAGGGGGATGCACTGTGGATCTGCCATCCATTCTGCAGTCTCCAGCAGAGCAGGCAGTCAGGCCCCAGCGTGC
 641 CTCCATCCCAGTGCCCCGATGACCATCTGGTCAGCCCTCCCAACCTCCCTTCCAGGGGGCTTACCAGCAAAGCCATATTC
 721 GGCTAGGAATTTGGAATTCACAACCTTTATTAACCCCTGGCAAAACTTCCCGTTTGCATGTCAAATCACATTGAAGCCTG
 801 AAAATTAGCTTTTCTTACTGGTTTTTCCAATAAGTAATAGCAAAGCCCACTTATCATACTTAAACTACAGTAAAGAAAAG
 881 AGGTGGTTCTCTGCAGTGATCGTTTAGTGTGGCCCTCAAACATTAAATATCCCGAGGTCTCCTTGGTGGGTGGCAGGATT
 961 TAAATTCAATCAAATCCTGTCCTAGTGTGTGCAGTGTCTTCGGCCCTGTGGACACAGGTGAATGAGGGACCAGCCCTGCC
1041 CTGGGCTGTTGAGAAGAGATCAGTCCACCCAGAGTTAGACATTGTTTTTGTAGAAAACAGGCATTTATTATGTCTAGGGT
1121 TTTGTGTTTTTTTTTTTTCCTTACAGGATAAAAGCCTTTATACAGAAACAAAATGGAACCTTTCATATAAAACCTTTTCT
1201 TTAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ucggUCGGUU--GAGU--GUCACGUCu 5'
              |||:||  ||||  ||| |||| 
Target 5' agtgAGCTAAGGCTCACCCAGAGCAGc 3'
328 - 354 139.00 -18.60
2
miRNA  3' ucGGUCGGUUGAG--UGUCACGUCu 5'
            :| || : |||  :||| |||| 
Target 5' atTCTGCAGTCTCCAGCAGAGCAGg 3'
597 - 621 127.00 -17.10
3
miRNA  3' ucgGUCGGUUGAGUGUCACGUCu 5'
             ::|| ||   |:|| |||| 
Target 5' gagTGGCAAAAAAATAGAGCAGa 3'
483 - 505 124.00 -11.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31499328 7 COSMIC
COSN20047570 46 COSMIC
COSN27626198 113 COSMIC
COSN31543844 178 COSMIC
COSN29630490 207 COSMIC
COSN31488413 241 COSMIC
COSN31592824 288 COSMIC
COSN31583919 289 COSMIC
COSN26642194 297 COSMIC
COSN31607312 480 COSMIC
COSN31597515 489 COSMIC
COSN26640153 512 COSMIC
COSN31521129 540 COSMIC
COSN5754452 629 COSMIC
COSN16508133 713 COSMIC
COSN18723459 1568 COSMIC
COSN16090526 1765 COSMIC
COSN17226108 2136 COSMIC
COSN23070950 3066 COSMIC
COSN28954794 3384 COSMIC
COSN22792123 4099 COSMIC
COSN6272878 4307 COSMIC
COSN6272877 4421 COSMIC
COSN31646589 4606 COSMIC
rs117990941 2939 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1247608254 1 dbSNP
rs747406321 3 dbSNP
rs1315584007 8 dbSNP
rs775988621 11 dbSNP
rs1279049148 13 dbSNP
rs200600029 17 dbSNP
rs778505586 18 dbSNP
rs1281498736 19 dbSNP
rs756909109 21 dbSNP
rs1346407566 28 dbSNP
rs953873763 29 dbSNP
rs1295008398 31 dbSNP
rs531962895 34 dbSNP
rs777215958 35 dbSNP
rs1318869854 41 dbSNP
rs1458794764 42 dbSNP
rs1298974166 45 dbSNP
rs1426542726 48 dbSNP
rs1175117188 49 dbSNP
rs544194547 52 dbSNP
rs897037053 53 dbSNP
rs1043105085 54 dbSNP
rs946611219 56 dbSNP
rs112415087 59 dbSNP
rs915024473 70 dbSNP
rs367676526 71 dbSNP
rs1002683793 79 dbSNP
rs1401462154 84 dbSNP
rs937902352 86 dbSNP
rs552787030 90 dbSNP
rs1364162168 91 dbSNP
rs574286230 94 dbSNP
rs1233440197 98 dbSNP
rs981800083 99 dbSNP
rs948152371 103 dbSNP
rs1232463309 109 dbSNP
rs1253698434 112 dbSNP
rs950342854 117 dbSNP
rs919046482 120 dbSNP
rs560617600 123 dbSNP
rs963588731 134 dbSNP
rs1320094510 149 dbSNP
rs1463815769 151 dbSNP
rs1195968976 152 dbSNP
rs773716100 161 dbSNP
rs1268511648 165 dbSNP
rs1007831074 182 dbSNP
rs555780580 188 dbSNP
rs954931063 190 dbSNP
rs1326831044 199 dbSNP
rs1030527134 200 dbSNP
rs1365573464 208 dbSNP
rs748154378 209 dbSNP
rs936931143 210 dbSNP
rs903189587 213 dbSNP
rs924168006 214 dbSNP
rs978250071 214 dbSNP
rs112926893 216 dbSNP
rs912719701 218 dbSNP
rs776754596 226 dbSNP
rs868683908 232 dbSNP
rs1197266328 233 dbSNP
rs529615944 256 dbSNP
rs1454106210 260 dbSNP
rs780499310 266 dbSNP
rs953820008 272 dbSNP
rs893659189 288 dbSNP
rs186046802 289 dbSNP
rs961301990 290 dbSNP
rs1208551027 321 dbSNP
rs1015540703 329 dbSNP
rs543947448 331 dbSNP
rs367728044 332 dbSNP
rs575115017 339 dbSNP
rs1022794260 340 dbSNP
rs1012747201 342 dbSNP
rs1340048189 346 dbSNP
rs1055337502 348 dbSNP
rs1271846110 360 dbSNP
rs937811831 361 dbSNP
rs936653262 373 dbSNP
rs1398631937 376 dbSNP
rs1410366345 387 dbSNP
rs902504402 398 dbSNP
rs558366929 409 dbSNP
rs1348120119 413 dbSNP
rs1230887683 417 dbSNP
rs1234712739 425 dbSNP
rs1313049297 432 dbSNP
rs927887294 438 dbSNP
rs1321478285 446 dbSNP
rs1243152742 449 dbSNP
rs1042647880 453 dbSNP
rs1369991955 466 dbSNP
rs182453840 476 dbSNP
rs151068126 479 dbSNP
rs1046342074 481 dbSNP
rs1249667372 483 dbSNP
rs912764450 484 dbSNP
rs1398333357 486 dbSNP
rs1413417781 487 dbSNP
rs928988366 491 dbSNP
rs549032077 497 dbSNP
rs918893183 503 dbSNP
rs572848902 506 dbSNP
rs963437440 507 dbSNP
rs552982821 508 dbSNP
rs1303058803 515 dbSNP
rs761033991 519 dbSNP
rs1015258909 532 dbSNP
rs773392452 537 dbSNP
rs986733421 542 dbSNP
rs1298124856 545 dbSNP
rs954857557 546 dbSNP
rs1228276153 548 dbSNP
rs768865009 551 dbSNP
rs1030581089 555 dbSNP
rs1273173959 579 dbSNP
rs999056198 580 dbSNP
rs1210994881 586 dbSNP
rs190229038 592 dbSNP
rs80139520 593 dbSNP
rs555060407 594 dbSNP
rs1188535953 597 dbSNP
rs1249629541 602 dbSNP
rs1011674015 614 dbSNP
rs895241192 618 dbSNP
rs1187838200 622 dbSNP
rs1388316438 624 dbSNP
rs1274425879 627 dbSNP
rs1416103880 629 dbSNP
rs894579691 633 dbSNP
rs1198683656 635 dbSNP
rs1358096647 637 dbSNP
rs1347008893 644 dbSNP
rs758164334 646 dbSNP
rs1280827107 647 dbSNP
rs1236188907 650 dbSNP
rs1032413122 657 dbSNP
rs1034418041 658 dbSNP
rs1366356163 659 dbSNP
rs1434902448 663 dbSNP
rs1296041508 667 dbSNP
rs1373747711 670 dbSNP
rs1220330902 677 dbSNP
rs1277952180 687 dbSNP
rs1002073943 693 dbSNP
rs906355163 698 dbSNP
rs1218183832 700 dbSNP
rs1443122716 700 dbSNP
rs1337628212 701 dbSNP
rs535035027 704 dbSNP
rs1332225103 715 dbSNP
rs745682046 720 dbSNP
rs1046353140 721 dbSNP
rs929169876 723 dbSNP
rs1245973951 737 dbSNP
rs897511204 738 dbSNP
rs16972233 743 dbSNP
rs1423822883 745 dbSNP
rs1431005102 754 dbSNP
rs1160913924 755 dbSNP
rs1389009373 756 dbSNP
rs1042370123 769 dbSNP
rs778843885 771 dbSNP
rs1008439110 772 dbSNP
rs74573199 775 dbSNP
rs1418241150 778 dbSNP
rs184932319 784 dbSNP
rs532741291 785 dbSNP
rs1225599696 790 dbSNP
rs910317111 795 dbSNP
rs1048166 803 dbSNP
rs1234145945 809 dbSNP
rs373468493 818 dbSNP
rs920074006 825 dbSNP
rs1222190686 828 dbSNP
rs1485329910 837 dbSNP
rs1246113951 841 dbSNP
rs1487219133 850 dbSNP
rs1258117729 854 dbSNP
rs933525449 867 dbSNP
rs923401404 868 dbSNP
rs1412088224 869 dbSNP
rs570599203 875 dbSNP
rs1472033998 880 dbSNP
rs146645752 882 dbSNP
rs530933574 894 dbSNP
rs967573886 901 dbSNP
rs748764067 902 dbSNP
rs560689198 905 dbSNP
rs1406372132 916 dbSNP
rs1323466956 930 dbSNP
rs990577566 931 dbSNP
rs1224567420 933 dbSNP
rs1048175 934 dbSNP
rs1308662262 939 dbSNP
rs1034879776 956 dbSNP
rs908209816 969 dbSNP
rs1226766261 971 dbSNP
rs530549576 978 dbSNP
rs1358185979 979 dbSNP
rs1414222936 981 dbSNP
rs1356724082 982 dbSNP
rs1288889630 991 dbSNP
rs1319798086 993 dbSNP
rs1207241811 994 dbSNP
rs376230912 1001 dbSNP
rs1482469294 1002 dbSNP
rs1179549118 1008 dbSNP
rs1024791005 1027 dbSNP
rs755795184 1030 dbSNP
rs897767978 1038 dbSNP
rs915808175 1042 dbSNP
rs1344993877 1045 dbSNP
rs1160237699 1048 dbSNP
rs1412104783 1051 dbSNP
rs1432125601 1052 dbSNP
rs373462761 1053 dbSNP
rs1408142847 1054 dbSNP
rs1336397143 1055 dbSNP
rs957257417 1060 dbSNP
rs1409671879 1069 dbSNP
rs1283337035 1102 dbSNP
rs752440965 1108 dbSNP
rs767095445 1111 dbSNP
rs763333067 1112 dbSNP
rs1162237151 1118 dbSNP
rs1280143318 1127 dbSNP
rs180945937 1127 dbSNP
rs966727701 1128 dbSNP
rs1417863070 1130 dbSNP
rs112861844 1139 dbSNP
rs1390174916 1139 dbSNP
rs1428386959 1139 dbSNP
rs796198698 1139 dbSNP
rs1174336944 1143 dbSNP
rs1190002765 1146 dbSNP
rs1414085761 1166 dbSNP
rs763664862 1172 dbSNP
rs1332492121 1174 dbSNP
rs888781458 1179 dbSNP
rs1298063123 1180 dbSNP
rs145878392 1189 dbSNP
rs1216207412 1197 dbSNP
rs542521757 1199 dbSNP
rs1199502841 1208 dbSNP
rs997497078 1218 dbSNP
rs1466526986 1219 dbSNP
rs773449687 1221 dbSNP
rs1247815626 1223 dbSNP
rs923453729 1229 dbSNP
rs1038508094 1234 dbSNP
rs796274598 1238 dbSNP
rs190439698 1239 dbSNP
rs908261608 1240 dbSNP
rs1045442781 1244 dbSNP
rs554692117 1250 dbSNP
rs990406359 1251 dbSNP
rs991456849 1254 dbSNP
rs765764913 1274 dbSNP
rs1289868779 1277 dbSNP
rs538238263 1284 dbSNP
rs1303379932 1285 dbSNP
rs1346661327 1286 dbSNP
rs568973990 1289 dbSNP
rs745719507 1292 dbSNP
rs575846448 1293 dbSNP
rs981544691 1295 dbSNP
rs971445357 1300 dbSNP
rs1460538655 1302 dbSNP
rs1025723331 1308 dbSNP
rs993355344 1309 dbSNP
rs1394613449 1311 dbSNP
rs11070353 1324 dbSNP
rs1008714046 1329 dbSNP
rs1212133816 1333 dbSNP
rs955433470 1336 dbSNP
rs148940920 1337 dbSNP
rs1197287897 1344 dbSNP
rs1006105117 1345 dbSNP
rs1473018012 1352 dbSNP
rs1418683634 1354 dbSNP
rs997108294 1355 dbSNP
rs1186949414 1356 dbSNP
rs888796825 1357 dbSNP
rs1050020839 1358 dbSNP
rs1017126918 1374 dbSNP
rs757264024 1386 dbSNP
rs145703815 1390 dbSNP
rs1250836543 1395 dbSNP
rs1386154921 1395 dbSNP
rs1300695395 1402 dbSNP
rs571387207 1408 dbSNP
rs1469042972 1410 dbSNP
rs1045514770 1413 dbSNP
rs535437137 1429 dbSNP
rs1247352846 1431 dbSNP
rs1266414608 1432 dbSNP
rs1275168231 1437 dbSNP
rs946238512 1441 dbSNP
rs1220942543 1447 dbSNP
rs1254030820 1453 dbSNP
rs1181711812 1459 dbSNP
rs1483450181 1459 dbSNP
rs1248767762 1460 dbSNP
rs547290223 1461 dbSNP
rs1055832064 1462 dbSNP
rs1368855847 1475 dbSNP
rs1457311524 1476 dbSNP
rs1161643135 1486 dbSNP
rs11636178 1495 dbSNP
rs1409968776 1496 dbSNP
rs747115494 1498 dbSNP
rs1369256449 1508 dbSNP
rs977244691 1521 dbSNP
rs945911091 1538 dbSNP
rs911716009 1539 dbSNP
rs1439751940 1541 dbSNP
rs1244394913 1544 dbSNP
rs1394731069 1561 dbSNP
rs927294145 1565 dbSNP
rs371293937 1568 dbSNP
rs981471379 1572 dbSNP
rs1249705792 1579 dbSNP
rs1256563753 1579 dbSNP
rs34607649 1579 dbSNP
rs398118793 1579 dbSNP
rs1443833655 1581 dbSNP
rs1181667884 1583 dbSNP
rs1460014029 1585 dbSNP
rs1391863540 1602 dbSNP
rs971371821 1613 dbSNP
rs1169069726 1615 dbSNP
rs1352289647 1617 dbSNP
rs1467232708 1618 dbSNP
rs567928089 1623 dbSNP
rs918714569 1624 dbSNP
rs972805680 1628 dbSNP
rs1450999232 1643 dbSNP
rs187158818 1646 dbSNP
rs1366486378 1649 dbSNP
rs369137278 1659 dbSNP
rs962973240 1673 dbSNP
rs1017219978 1680 dbSNP
rs1211064845 1688 dbSNP
rs765240326 1688 dbSNP
rs1460704649 1689 dbSNP
rs1201475311 1701 dbSNP
rs1393070367 1709 dbSNP
rs1004456573 1722 dbSNP
rs1192739991 1727 dbSNP
rs887308432 1731 dbSNP
rs1024891763 1737 dbSNP
rs1454908059 1739 dbSNP
rs1006562721 1744 dbSNP
rs1467918278 1745 dbSNP
rs879317841 1747 dbSNP
rs1389881060 1748 dbSNP
rs534030475 1753 dbSNP
rs953348976 1755 dbSNP
rs1175618933 1763 dbSNP
rs564647844 1764 dbSNP
rs182600142 1765 dbSNP
rs1369806630 1766 dbSNP
rs901506464 1768 dbSNP
rs745618976 1769 dbSNP
rs1321609970 1774 dbSNP
rs7166358 1776 dbSNP
rs1009947674 1779 dbSNP
rs911728713 1780 dbSNP
rs1214967292 1781 dbSNP
rs1240351309 1782 dbSNP
rs559317135 1784 dbSNP
rs1191213974 1792 dbSNP
rs1489425213 1792 dbSNP
rs1371359950 1793 dbSNP
rs893311916 1799 dbSNP
rs1054602359 1800 dbSNP
rs1001826720 1801 dbSNP
rs987673896 1801 dbSNP
rs1302949289 1809 dbSNP
rs1160978524 1813 dbSNP
rs934104000 1821 dbSNP
rs542783365 1823 dbSNP
rs573898185 1837 dbSNP
rs921324938 1838 dbSNP
rs149801241 1842 dbSNP
rs962733790 1843 dbSNP
rs1372000376 1847 dbSNP
rs749276012 1848 dbSNP
rs777398418 1850 dbSNP
rs544624255 1851 dbSNP
rs1373530666 1852 dbSNP
rs1289282208 1853 dbSNP
rs1648810 1854 dbSNP
rs188997143 1860 dbSNP
rs1435096106 1867 dbSNP
rs951570766 1872 dbSNP
rs950065356 1873 dbSNP
rs752176811 1875 dbSNP
rs1396585943 1876 dbSNP
rs973232682 1877 dbSNP
rs1489666964 1882 dbSNP
rs562530548 1884 dbSNP
rs559118420 1886 dbSNP
rs909943304 1898 dbSNP
rs984664264 1899 dbSNP
rs1178995947 1900 dbSNP
rs1469316651 1907 dbSNP
rs1175795565 1908 dbSNP
rs999892562 1914 dbSNP
rs1485007236 1916 dbSNP
rs953211748 1922 dbSNP
rs904235213 1927 dbSNP
rs1350510433 1928 dbSNP
rs1041323772 1934 dbSNP
rs1024924463 1936 dbSNP
rs1259272626 1937 dbSNP
rs1431776104 1938 dbSNP
rs539103431 1940 dbSNP
rs1010115224 1941 dbSNP
rs201803000 1945 dbSNP
rs753130379 1947 dbSNP
rs1277516002 1948 dbSNP
rs965684585 1949 dbSNP
rs1019882547 1951 dbSNP
rs147829961 1952 dbSNP
rs1291026448 1953 dbSNP
rs892917116 1955 dbSNP
rs553321821 1971 dbSNP
rs750799246 1972 dbSNP
rs1206599851 1974 dbSNP
rs921772852 1976 dbSNP
rs1274755394 1977 dbSNP
rs1039845803 1978 dbSNP
rs1353560710 1986 dbSNP
rs1001751932 1991 dbSNP
rs1473361992 1997 dbSNP
rs536851392 2000 dbSNP
rs906023261 2009 dbSNP
rs1312200041 2010 dbSNP
rs1383856013 2011 dbSNP
rs1451893839 2012 dbSNP
rs1169246412 2013 dbSNP
rs867720109 2020 dbSNP
rs765634682 2023 dbSNP
rs550597172 2024 dbSNP
rs1360673086 2027 dbSNP
rs557191418 2030 dbSNP
rs1314119509 2036 dbSNP
rs1380420800 2039 dbSNP
rs536653438 2040 dbSNP
rs570875768 2047 dbSNP
rs1270236268 2053 dbSNP
rs1338234459 2054 dbSNP
rs1193700668 2055 dbSNP
rs1286858086 2056 dbSNP
rs1453372564 2061 dbSNP
rs1203371520 2070 dbSNP
rs941339743 2075 dbSNP
rs910006660 2076 dbSNP
rs184667300 2077 dbSNP
rs931821912 2078 dbSNP
rs764619386 2084 dbSNP
rs959159409 2085 dbSNP
rs975988483 2087 dbSNP
rs1426055747 2091 dbSNP
rs965904533 2092 dbSNP
rs1469498697 2096 dbSNP
rs79467542 2112 dbSNP
rs181141984 2113 dbSNP
rs968402495 2117 dbSNP
rs1318961980 2121 dbSNP
rs1019918962 2123 dbSNP
rs1224525212 2124 dbSNP
rs1276118974 2129 dbSNP
rs3088159 2151 dbSNP
rs1204894052 2153 dbSNP
rs890109897 2158 dbSNP
rs529042710 2166 dbSNP
rs1206228520 2169 dbSNP
rs1261722779 2174 dbSNP
rs1445783001 2190 dbSNP
rs188766177 2198 dbSNP
rs79760798 2201 dbSNP
rs865892503 2203 dbSNP
rs759743033 2206 dbSNP
rs1037500873 2208 dbSNP
rs1260942601 2218 dbSNP
rs530946348 2219 dbSNP
rs1174605807 2225 dbSNP
rs1426922009 2230 dbSNP
rs754175272 2231 dbSNP
rs1332045714 2242 dbSNP
rs1380480465 2244 dbSNP
rs1292077691 2245 dbSNP
rs1324906494 2246 dbSNP
rs906033343 2250 dbSNP
rs1342164859 2260 dbSNP
rs1293241567 2261 dbSNP
rs564352611 2264 dbSNP
rs909942325 2268 dbSNP
rs1024456391 2274 dbSNP
rs1240127101 2277 dbSNP
rs1381429487 2285 dbSNP
rs1386039124 2286 dbSNP
rs1322812513 2287 dbSNP
rs1212188360 2290 dbSNP
rs1446060859 2298 dbSNP
rs774162716 2299 dbSNP
rs897434037 2305 dbSNP
rs1254163723 2306 dbSNP
rs372019101 2308 dbSNP
rs550510413 2311 dbSNP
rs917246022 2317 dbSNP
rs545365452 2318 dbSNP
rs993524697 2318 dbSNP
rs958944509 2321 dbSNP
rs941404016 2322 dbSNP
rs1300754195 2324 dbSNP
rs1351891534 2325 dbSNP
rs1391639342 2326 dbSNP
rs1306691506 2327 dbSNP
rs1429481658 2328 dbSNP
rs1247607153 2331 dbSNP
rs1293224507 2337 dbSNP
rs1359353612 2350 dbSNP
rs1220273076 2352 dbSNP
rs573304900 2359 dbSNP
rs1481058720 2366 dbSNP
rs968456953 2372 dbSNP
rs1249532108 2373 dbSNP
rs888408229 2374 dbSNP
rs1466827929 2382 dbSNP
rs545948838 2386 dbSNP
rs1272031305 2387 dbSNP
rs1020015351 2406 dbSNP
rs1049837684 2407 dbSNP
rs932712768 2411 dbSNP
rs1161081221 2415 dbSNP
rs553423323 2416 dbSNP
rs988506300 2420 dbSNP
rs1358458326 2425 dbSNP
rs1297307019 2427 dbSNP
rs975918241 2429 dbSNP
rs542863302 2434 dbSNP
rs573850765 2435 dbSNP
rs368116636 2436 dbSNP
rs1029996932 2443 dbSNP
rs989128664 2444 dbSNP
rs996500690 2445 dbSNP
rs957069018 2446 dbSNP
rs900383631 2453 dbSNP
rs34161137 2459 dbSNP
rs1326822443 2465 dbSNP
rs1263435904 2478 dbSNP
rs1308205200 2482 dbSNP
rs76586605 2485 dbSNP
rs1439027037 2487 dbSNP
rs1370490391 2491 dbSNP
rs1326729127 2492 dbSNP
rs1006037670 2493 dbSNP
rs1484363113 2495 dbSNP
rs3743020 2498 dbSNP
rs1243555226 2500 dbSNP
rs969767467 2501 dbSNP
rs1047208953 2502 dbSNP
rs886257997 2502 dbSNP
rs930071238 2502 dbSNP
rs1167857215 2506 dbSNP
rs111573285 2514 dbSNP
rs1014470036 2515 dbSNP
rs1470763940 2517 dbSNP
rs1337755358 2523 dbSNP
rs1405860216 2538 dbSNP
rs937600015 2553 dbSNP
rs927524788 2555 dbSNP
rs961835279 2562 dbSNP
rs1213993133 2574 dbSNP
rs1293542906 2588 dbSNP
rs1452241658 2590 dbSNP
rs1015855255 2593 dbSNP
rs557034018 2601 dbSNP
rs888470436 2602 dbSNP
rs1322614472 2615 dbSNP
rs1050161483 2618 dbSNP
rs1243705868 2621 dbSNP
rs947585513 2623 dbSNP
rs184267757 2625 dbSNP
rs1452839783 2633 dbSNP
rs192352953 2634 dbSNP
rs1481195087 2641 dbSNP
rs1176770898 2642 dbSNP
rs565645822 2645 dbSNP
rs954448393 2646 dbSNP
rs1672461 2647 dbSNP
rs974406959 2654 dbSNP
rs529096926 2656 dbSNP
rs1276562444 2657 dbSNP
rs1287152115 2674 dbSNP
rs964643805 2680 dbSNP
rs1016215120 2683 dbSNP
rs1006130976 2684 dbSNP
rs1347510574 2686 dbSNP
rs367750272 2687 dbSNP
rs1221395310 2688 dbSNP
rs369930928 2695 dbSNP
rs769855250 2696 dbSNP
rs549987941 2704 dbSNP
rs1258409130 2705 dbSNP
rs935895426 2707 dbSNP
rs1490713875 2708 dbSNP
rs1438799952 2712 dbSNP
rs780637455 2713 dbSNP
rs1334080829 2715 dbSNP
rs1479243892 2716 dbSNP
rs1179367010 2724 dbSNP
rs1409133611 2725 dbSNP
rs994666693 2730 dbSNP
rs55757218 2731 dbSNP
rs1057445730 2745 dbSNP
rs34794954 2753 dbSNP
rs1372923943 2767 dbSNP
rs1302618249 2773 dbSNP
rs1209334 2774 dbSNP
rs1281103323 2782 dbSNP
rs1373727910 2792 dbSNP
rs1223160830 2810 dbSNP
rs1304699692 2817 dbSNP
rs905860038 2818 dbSNP
rs1222658056 2820 dbSNP
rs545114688 2820 dbSNP
rs1434484228 2831 dbSNP
rs1489742157 2833 dbSNP
rs1206131728 2834 dbSNP
rs769639786 2840 dbSNP
rs116136311 2842 dbSNP
rs947636301 2851 dbSNP
rs1175988540 2857 dbSNP
rs911037407 2860 dbSNP
rs913405510 2870 dbSNP
rs992541197 2874 dbSNP
rs1163054478 2875 dbSNP
rs961570719 2885 dbSNP
rs1411890002 2892 dbSNP
rs757579963 2893 dbSNP
rs535809060 2899 dbSNP
rs1246580488 2915 dbSNP
rs1313775231 2918 dbSNP
rs754208242 2930 dbSNP
rs1215971566 2932 dbSNP
rs1273182478 2936 dbSNP
rs117990941 2939 dbSNP
rs866197531 2941 dbSNP
rs1202930690 2949 dbSNP
rs901174360 2950 dbSNP
rs1462181183 2951 dbSNP
rs1208552855 2952 dbSNP
rs1183468199 2966 dbSNP
rs1383477906 2973 dbSNP
rs776543001 2974 dbSNP
rs1168563586 2975 dbSNP
rs950578100 2980 dbSNP
rs1010029961 2985 dbSNP
rs543079710 2987 dbSNP
rs1221186298 2988 dbSNP
rs1407974646 2988 dbSNP
rs761145032 2988 dbSNP
rs1335933704 2999 dbSNP
rs1053335568 3002 dbSNP
rs1338193231 3008 dbSNP
rs1348768029 3017 dbSNP
rs935837120 3027 dbSNP
rs925899714 3029 dbSNP
rs960802478 3031 dbSNP
rs1338396383 3033 dbSNP
rs566738494 3044 dbSNP
rs1265414179 3046 dbSNP
rs948373072 3050 dbSNP
rs1324645803 3056 dbSNP
rs1352938195 3060 dbSNP
rs916876709 3064 dbSNP
rs1203591213 3068 dbSNP
rs573779576 3074 dbSNP
rs939736776 3075 dbSNP
rs908272184 3079 dbSNP
rs905912501 3080 dbSNP
rs1376471935 3086 dbSNP
rs1241561918 3087 dbSNP
rs557160546 3091 dbSNP
rs767532967 3092 dbSNP
rs952908346 3097 dbSNP
rs759781243 3098 dbSNP
rs1175432600 3101 dbSNP
rs1400047238 3103 dbSNP
rs1011792666 3110 dbSNP
rs1318445879 3118 dbSNP
rs1405321641 3119 dbSNP
rs892020350 3120 dbSNP
rs1472633798 3122 dbSNP
rs1028567151 3123 dbSNP
rs933529703 3124 dbSNP
rs1353518377 3125 dbSNP
rs923421625 3125 dbSNP
rs1185735256 3127 dbSNP
rs543605633 3127 dbSNP
rs1485281437 3138 dbSNP
rs1269949687 3140 dbSNP
rs1237881800 3148 dbSNP
rs975602263 3152 dbSNP
rs965351486 3153 dbSNP
rs1283823272 3159 dbSNP
rs984425316 3160 dbSNP
rs1331336783 3161 dbSNP
rs1383625563 3164 dbSNP
rs1019552342 3166 dbSNP
rs1304417435 3172 dbSNP
rs577957697 3174 dbSNP
rs1233250234 3180 dbSNP
rs188024003 3180 dbSNP
rs1299680479 3185 dbSNP
rs1337852133 3190 dbSNP
rs1240401119 3195 dbSNP
rs919203627 3196 dbSNP
rs878993319 3197 dbSNP
rs1352139383 3204 dbSNP
rs1009669654 3205 dbSNP
rs1292555072 3214 dbSNP
rs1490257989 3216 dbSNP
rs1429049257 3232 dbSNP
rs774665128 3238 dbSNP
rs371158745 3258 dbSNP
rs1420586542 3260 dbSNP
rs571976539 3261 dbSNP
rs1033927883 3264 dbSNP
rs771307509 3266 dbSNP
rs1457394795 3276 dbSNP
rs1390244409 3282 dbSNP
rs1385269381 3288 dbSNP
rs1001575725 3290 dbSNP
rs1000469617 3291 dbSNP
rs1021593371 3293 dbSNP
rs1011509892 3297 dbSNP
rs904321057 3303 dbSNP
rs552195330 3305 dbSNP
rs948594701 3306 dbSNP
rs762766325 3307 dbSNP
rs148414195 3308 dbSNP
rs1358749650 3310 dbSNP
rs1414426319 3322 dbSNP
rs1183451540 3327 dbSNP
rs773150325 3328 dbSNP
rs902051966 3330 dbSNP
rs1474307252 3332 dbSNP
rs1196210250 3333 dbSNP
rs569749957 3335 dbSNP
rs376204949 3336 dbSNP
rs908935255 3350 dbSNP
rs539636363 3351 dbSNP
rs1048822859 3356 dbSNP
rs1162082771 3359 dbSNP
rs1374490220 3360 dbSNP
rs1189480640 3365 dbSNP
rs1398500980 3367 dbSNP
rs1466394192 3368 dbSNP
rs1271397466 3370 dbSNP
rs1213123270 3372 dbSNP
rs939683891 3373 dbSNP
rs1337893025 3377 dbSNP
rs1322917046 3378 dbSNP
rs1382692453 3378 dbSNP
rs1394427556 3383 dbSNP
rs1297786253 3385 dbSNP
rs570769705 3391 dbSNP
rs1292644887 3393 dbSNP
rs918908974 3395 dbSNP
rs1213262903 3396 dbSNP
rs1361720380 3397 dbSNP
rs1298738639 3399 dbSNP
rs1205488021 3402 dbSNP
rs746779927 3406 dbSNP
rs1366889564 3407 dbSNP
rs1323375362 3420 dbSNP
rs35432750 3420 dbSNP
rs1179652075 3423 dbSNP
rs983880189 3427 dbSNP
rs1337639730 3432 dbSNP
rs1460461110 3440 dbSNP
rs573985866 3441 dbSNP
rs939226034 3449 dbSNP
rs926484187 3453 dbSNP
rs185540666 3456 dbSNP
rs1408094818 3457 dbSNP
rs1470808924 3468 dbSNP
rs1418569558 3469 dbSNP
rs1188934796 3473 dbSNP
rs921393287 3481 dbSNP
rs530468835 3482 dbSNP
rs975657621 3497 dbSNP
rs970134855 3500 dbSNP
rs1362691774 3504 dbSNP
rs192617080 3510 dbSNP
rs1193163093 3512 dbSNP
rs1347613375 3513 dbSNP
rs559730970 3520 dbSNP
rs1248477592 3523 dbSNP
rs1263498272 3528 dbSNP
rs1175497355 3535 dbSNP
rs144416759 3536 dbSNP
rs956723012 3537 dbSNP
rs1261991977 3544 dbSNP
rs1032847548 3546 dbSNP
rs1032089121 3557 dbSNP
rs375395291 3557 dbSNP
rs997783660 3557 dbSNP
rs1307394282 3563 dbSNP
rs1260666247 3577 dbSNP
rs1275859752 3578 dbSNP
rs1200652476 3582 dbSNP
rs529392412 3590 dbSNP
rs904373057 3596 dbSNP
rs763962155 3599 dbSNP
rs1343942750 3602 dbSNP
rs563432452 3609 dbSNP
rs1022775420 3610 dbSNP
rs1012741433 3611 dbSNP
rs1296404546 3626 dbSNP
rs1367740844 3648 dbSNP
rs1007754269 3650 dbSNP
rs187304996 3651 dbSNP
rs1366576609 3658 dbSNP
rs78192672 3659 dbSNP
rs1309145356 3662 dbSNP
rs939717243 3669 dbSNP
rs564644307 3671 dbSNP
rs1367721847 3672 dbSNP
rs1215325261 3675 dbSNP
rs1283228279 3679 dbSNP
rs746563298 3681 dbSNP
rs779617397 3684 dbSNP
rs1246500624 3690 dbSNP
rs1353840609 3691 dbSNP
rs541672972 3707 dbSNP
rs1431398527 3708 dbSNP
rs1392971560 3711 dbSNP
rs1156970785 3712 dbSNP
rs1387121135 3713 dbSNP
rs1425552798 3718 dbSNP
rs1173270407 3722 dbSNP
rs532427488 3722 dbSNP
rs758062206 3723 dbSNP
rs921448746 3731 dbSNP
rs1434109272 3732 dbSNP
rs780075804 3733 dbSNP
rs1480624726 3734 dbSNP
rs1377607147 3743 dbSNP
rs1239289677 3744 dbSNP
rs1039880220 3746 dbSNP
rs944192668 3748 dbSNP
rs926509288 3749 dbSNP
rs1288787074 3764 dbSNP
rs1319538208 3770 dbSNP
rs1484903961 3771 dbSNP
rs912848022 3772 dbSNP
rs1280001488 3781 dbSNP
rs182928567 3782 dbSNP
rs1312380768 3783 dbSNP
rs1162729524 3792 dbSNP
rs1411963074 3793 dbSNP
rs1411837213 3798 dbSNP
rs754188184 3799 dbSNP
rs1400699289 3807 dbSNP
rs1445973838 3825 dbSNP
rs1221565009 3833 dbSNP
rs1349869620 3834 dbSNP
rs1308569521 3844 dbSNP
rs1411528570 3845 dbSNP
rs149276643 3853 dbSNP
rs1215919277 3859 dbSNP
rs1302008308 3863 dbSNP
rs979937204 3868 dbSNP
rs535442114 3870 dbSNP
rs569012422 3885 dbSNP
rs956281497 3895 dbSNP
rs1031681421 3897 dbSNP
rs753192413 3908 dbSNP
rs1023705880 3911 dbSNP
rs1187274173 3913 dbSNP
rs1012794737 3921 dbSNP
rs34546908 3922 dbSNP
rs1464967298 3925 dbSNP
rs1157093938 3927 dbSNP
rs1168256348 3937 dbSNP
rs370392405 3938 dbSNP
rs1414936640 3940 dbSNP
rs10162754 3941 dbSNP
rs1338139353 3953 dbSNP
rs1432472073 3955 dbSNP
rs1004094011 3964 dbSNP
rs4924583 3973 dbSNP
rs1217242148 3974 dbSNP
rs966051740 3987 dbSNP
rs1412727039 3988 dbSNP
rs1346366224 3990 dbSNP
rs1017897529 3994 dbSNP
rs1007804871 3998 dbSNP
rs1048033329 4005 dbSNP
rs570597902 4007 dbSNP
rs189989229 4012 dbSNP
rs1056152869 4013 dbSNP
rs939038062 4013 dbSNP
rs1257308203 4017 dbSNP
rs1298256124 4020 dbSNP
rs138562837 4021 dbSNP
rs1397705560 4023 dbSNP
rs112784446 4025 dbSNP
rs944216912 4028 dbSNP
rs1331984139 4032 dbSNP
rs904856243 4048 dbSNP
rs563147180 4051 dbSNP
rs1241025269 4052 dbSNP
rs946633975 4055 dbSNP
rs1487446760 4056 dbSNP
rs1483408713 4057 dbSNP
rs1269215609 4058 dbSNP
rs1053132621 4059 dbSNP
rs1197893657 4063 dbSNP
rs1375910186 4068 dbSNP
rs915081460 4069 dbSNP
rs1158761059 4082 dbSNP
rs1213135060 4088 dbSNP
rs549397130 4090 dbSNP
rs763319838 4091 dbSNP
rs1288381570 4109 dbSNP
rs1304511195 4112 dbSNP
rs925513151 4113 dbSNP
rs1230190887 4124 dbSNP
rs1386619542 4133 dbSNP
rs1321961584 4135 dbSNP
rs1353456762 4139 dbSNP
rs1448111419 4141 dbSNP
rs934778431 4143 dbSNP
rs924710377 4145 dbSNP
rs1248448280 4148 dbSNP
rs976178317 4153 dbSNP
rs966472555 4156 dbSNP
rs910552595 4163 dbSNP
rs1264957737 4164 dbSNP
rs979450845 4170 dbSNP
rs952240032 4181 dbSNP
rs1237037683 4183 dbSNP
rs1437353664 4184 dbSNP
rs1166274409 4185 dbSNP
rs1368733363 4188 dbSNP
rs969374012 4194 dbSNP
rs916699558 4197 dbSNP
rs1161861141 4208 dbSNP
rs1399019766 4209 dbSNP
rs529209210 4215 dbSNP
rs1311812170 4223 dbSNP
rs1331180121 4224 dbSNP
rs1027838533 4225 dbSNP
rs563442877 4238 dbSNP
rs959864411 4244 dbSNP
rs1404002006 4248 dbSNP
rs187985326 4250 dbSNP
rs1704382 4252 dbSNP
rs386783425 4253 dbSNP
rs1263470568 4254 dbSNP
rs1389511559 4256 dbSNP
rs1199034533 4260 dbSNP
rs951360396 4261 dbSNP
rs368002083 4266 dbSNP
rs1243303724 4268 dbSNP
rs1003287721 4277 dbSNP
rs564734471 4282 dbSNP
rs1704381 4294 dbSNP
rs1426235945 4296 dbSNP
rs1417762405 4303 dbSNP
rs572749453 4307 dbSNP
rs1398796525 4315 dbSNP
rs899473170 4323 dbSNP
rs1039428700 4325 dbSNP
rs183434681 4326 dbSNP
rs541858198 4336 dbSNP
rs576062343 4342 dbSNP
rs1219060578 4344 dbSNP
rs1464135865 4347 dbSNP
rs1277296419 4349 dbSNP
rs556316708 4350 dbSNP
rs145963959 4354 dbSNP
rs1212089411 4358 dbSNP
rs1210037970 4359 dbSNP
rs1256085248 4360 dbSNP
rs1482604387 4362 dbSNP
rs1198225432 4366 dbSNP
rs1332671495 4367 dbSNP
rs904143918 4370 dbSNP
rs1043992355 4375 dbSNP
rs1193439504 4379 dbSNP
rs1421877046 4383 dbSNP
rs1052341184 4391 dbSNP
rs1177343718 4403 dbSNP
rs1245351513 4406 dbSNP
rs948044344 4415 dbSNP
rs1464661220 4421 dbSNP
rs1342067755 4422 dbSNP
rs916546261 4431 dbSNP
rs1399588316 4437 dbSNP
rs1293128601 4444 dbSNP
rs775444381 4444 dbSNP
rs1297377428 4446 dbSNP
rs992262002 4447 dbSNP
rs1220873156 4451 dbSNP
rs1301972859 4456 dbSNP
rs935187890 4458 dbSNP
rs1230493445 4464 dbSNP
rs1287493063 4468 dbSNP
rs1488427897 4469 dbSNP
rs768644731 4471 dbSNP
rs1322716123 4478 dbSNP
rs1261486633 4488 dbSNP
rs1489710797 4489 dbSNP
rs1040897892 4498 dbSNP
rs1425146524 4499 dbSNP
rs1431911860 4500 dbSNP
rs944733039 4516 dbSNP
rs1380944043 4518 dbSNP
rs907940396 4520 dbSNP
rs910562540 4521 dbSNP
rs1390027581 4523 dbSNP
rs1351827302 4524 dbSNP
rs1164360353 4532 dbSNP
rs982662282 4533 dbSNP
rs1293872908 4543 dbSNP
rs190778364 4545 dbSNP
rs757562843 4547 dbSNP
rs951288717 4555 dbSNP
rs1384961444 4558 dbSNP
rs576850342 4573 dbSNP
rs1026939824 4583 dbSNP
rs1353716902 4592 dbSNP
rs973920564 4595 dbSNP
rs142985603 4603 dbSNP
rs1017864095 4604 dbSNP
rs138409363 4605 dbSNP
rs890901519 4606 dbSNP
rs1180986107 4609 dbSNP
rs1238866457 4615 dbSNP
rs1031165203 4617 dbSNP
rs1035193071 4621 dbSNP
rs546538758 4627 dbSNP
rs186207431 4628 dbSNP
rs1416290216 4629 dbSNP
rs999731759 4631 dbSNP
rs1466760484 4644 dbSNP
rs1406132343 4650 dbSNP
rs117525154 4654 dbSNP
rs969078232 4658 dbSNP
rs1044005533 4664 dbSNP
rs948262511 4673 dbSNP
rs1023274080 4675 dbSNP
rs1010549792 4698 dbSNP
rs150493525 4701 dbSNP
rs1052813814 4706 dbSNP
rs1056507698 4711 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' ucGGUCGGUUGAGUGUCACGUCu 5'
            :|| |||:  :: ||||||| 
Target 5' ugUCACCCAGGCUGGAGUGCAGu 3'
7 - 29
Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' ucGGUCGGUUGAGUGUCACGUCu 5'
            :|| |||:  :: ||||||| 
Target 5' ugUCACCCAGGCUGGAGUGCAGu 3'
10 - 32
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Cardiac Tissues
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM2202479. RNA binding protein: AGO2. Condition:S4_LV_29yo_Male_AGO2_bound_RNA ...

- Spengler RM; Zhang X; Cheng C; McLendon JM; et al., 2016, Nucleic acids research.

Article - Spengler RM; Zhang X; Cheng C; McLendon JM; et al.
- Nucleic acids research, 2016
MicroRNAs (miRs) have emerged as key biological effectors in human health and disease. These small noncoding RNAs are incorporated into Argonaute (Ago) proteins, where they direct post-transcriptional gene silencing via base-pairing with target transcripts. Although miRs have become intriguing biological entities and attractive therapeutic targets, the translational impacts of miR research remain limited by a paucity of empirical miR targeting data, particularly in human primary tissues. Here, to improve our understanding of the diverse roles miRs play in cardiovascular function and disease, we applied high-throughput methods to globally profile miR:target interactions in human heart tissues. We deciphered Ago2:RNA interactions using crosslinking immunoprecipitation coupled with high-throughput sequencing (HITS-CLIP) to generate the first transcriptome-wide map of miR targeting events in human myocardium, detecting 4000 cardiac Ago2 binding sites across >2200 target transcripts. Our initial exploration of this interactome revealed an abundance of miR target sites in gene coding regions, including several sites pointing to new miR-29 functions in regulating cardiomyocyte calcium, growth and metabolism. Also, we uncovered several clinically-relevant interactions involving common genetic variants that alter miR targeting events in cardiomyopathy-associated genes. Overall, these data provide a critical resource for bolstering translational miR research in heart, and likely beyond.
LinkOut: [PMID: 27418678]
CLIP-seq Support 1 for dataset GSM1048187
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_control
Location of target site ENST00000220325.4 | 3UTR | AGUCUCUGUCACCCAGGCUGGAGUGCAGUGGCGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000220325.4 | 3UTR | GGAAGUCUCUGUCACCCAGGCUGGAGUGCAGUGGCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
296 hsa-miR-4793-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT092332 EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 2 6
MIRT131237 ATG2A autophagy related 2A 2 2
MIRT145926 ANKFY1 ankyrin repeat and FYVE domain containing 1 2 2
MIRT206559 SOCS5 suppressor of cytokine signaling 5 2 8
MIRT226455 TP53INP1 tumor protein p53 inducible nuclear protein 1 2 2
MIRT337662 ZNF695 zinc finger protein 695 2 2
MIRT405828 SIX4 SIX homeobox 4 2 2
MIRT455113 RILPL1 Rab interacting lysosomal protein like 1 2 2
MIRT456756 TMEM239 transmembrane protein 239 2 4
MIRT457974 RGS9BP regulator of G protein signaling 9 binding protein 2 2
MIRT458173 LYRM4 LYR motif containing 4 2 4
MIRT458245 SLC9A7 solute carrier family 9 member A7 2 2
MIRT466145 TMEM120B transmembrane protein 120B 2 2
MIRT474981 KATNAL1 katanin catalytic subunit A1 like 1 2 2
MIRT475601 HMGB2 high mobility group box 2 2 4
MIRT480759 BMP3 bone morphogenetic protein 3 2 4
MIRT481156 AVL9 AVL9 cell migration associated 2 2
MIRT482155 AK2 adenylate kinase 2 2 2
MIRT488386 VAV3 vav guanine nucleotide exchange factor 3 2 6
MIRT496575 KIF18B kinesin family member 18B 2 2
MIRT498411 TXNDC16 thioredoxin domain containing 16 2 4
MIRT504547 ZNF417 zinc finger protein 417 2 6
MIRT505417 TCF7L2 transcription factor 7 like 2 2 2
MIRT509349 ALDH9A1 aldehyde dehydrogenase 9 family member A1 2 6
MIRT512164 CD164 CD164 molecule 2 6
MIRT517238 PRIM1 DNA primase subunit 1 2 2
MIRT518671 KCNMB1 potassium calcium-activated channel subfamily M regulatory beta subunit 1 2 2
MIRT519298 MLH1 mutL homolog 1 2 2
MIRT523662 FOSL2 FOS like 2, AP-1 transcription factor subunit 2 2
MIRT525452 GPATCH2L G-patch domain containing 2 like 2 2
MIRT539847 ZNF766 zinc finger protein 766 2 2
MIRT540076 SSH3 slingshot protein phosphatase 3 2 2
MIRT540320 PIGR polymeric immunoglobulin receptor 2 2
MIRT540548 MAGI3 membrane associated guanylate kinase, WW and PDZ domain containing 3 2 2
MIRT540759 UTP6 UTP6, small subunit processome component 2 2
MIRT541545 HIATL2 major facilitator superfamily domain containing 14C 2 2
MIRT541553 SLC35E1 solute carrier family 35 member E1 2 2
MIRT541666 ATP8B3 ATPase phospholipid transporting 8B3 2 4
MIRT541722 TFDP2 transcription factor Dp-2 2 2
MIRT541800 DUSP28 dual specificity phosphatase 28 2 2
MIRT541816 SMU1 DNA replication regulator and spliceosomal factor 2 2
MIRT541907 VWA7 von Willebrand factor A domain containing 7 2 2
MIRT542154 UGDH UDP-glucose 6-dehydrogenase 2 2
MIRT542207 C14orf142 GON7, KEOPS complex subunit homolog 2 2
MIRT542233 FUT9 fucosyltransferase 9 2 2
MIRT542320 SERPING1 serpin family G member 1 2 2
MIRT542369 PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase 2 2
MIRT542476 APOC3 apolipoprotein C3 2 2
MIRT542641 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT542660 TAF11 TATA-box binding protein associated factor 11 2 2
MIRT542749 PRRG4 proline rich and Gla domain 4 2 4
MIRT542789 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT545442 FGFRL1 fibroblast growth factor receptor like 1 2 2
MIRT546206 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT552270 RAB3D RAB3D, member RAS oncogene family 2 2
MIRT552655 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 2 2
MIRT554134 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 2 2
MIRT556795 KIAA1958 KIAA1958 2 2
MIRT564762 ZHX3 zinc fingers and homeoboxes 3 2 2
MIRT569428 STX7 syntaxin 7 2 2
MIRT573245 ZBTB46 zinc finger and BTB domain containing 46 2 2
MIRT607390 LANCL3 LanC like 3 2 2
MIRT607430 NOTCH2NL notch 2 N-terminal like 2 2
MIRT607452 ZNF543 zinc finger protein 543 2 2
MIRT607580 TANGO2 transport and golgi organization 2 homolog 2 2
MIRT607748 ANGPT4 angiopoietin 4 2 2
MIRT607907 SPRYD4 SPRY domain containing 4 2 2
MIRT608703 GMPR guanosine monophosphate reductase 2 2
MIRT612127 NDUFA10 NADH:ubiquinone oxidoreductase subunit A10 2 2
MIRT612786 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 4
MIRT616692 LPL lipoprotein lipase 2 2
MIRT617045 ZNF610 zinc finger protein 610 2 2
MIRT617091 ZNF43 zinc finger protein 43 2 2
MIRT617314 MBOAT1 membrane bound O-acyltransferase domain containing 1 2 2
MIRT617355 MELK maternal embryonic leucine zipper kinase 2 2
MIRT617486 ALG9 ALG9, alpha-1,2-mannosyltransferase 2 2
MIRT617579 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT617669 RSRC1 arginine and serine rich coiled-coil 1 2 2
MIRT617722 TRAPPC2 trafficking protein particle complex 2 2 4
MIRT617893 PTCHD3 patched domain containing 3 2 2
MIRT617982 ZNF234 zinc finger protein 234 2 4
MIRT618434 MYLK3 myosin light chain kinase 3 2 4
MIRT618732 HIST1H2AH histone cluster 1 H2A family member h 2 2
MIRT619045 CASS4 Cas scaffolding protein family member 4 2 2
MIRT619573 ATAT1 alpha tubulin acetyltransferase 1 2 4
MIRT619671 CYP1A2 cytochrome P450 family 1 subfamily A member 2 2 2
MIRT619887 ABHD17B abhydrolase domain containing 17B 2 2
MIRT620519 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 2 4
MIRT620535 AVPR1A arginine vasopressin receptor 1A 2 2
MIRT620996 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT621304 YIPF4 Yip1 domain family member 4 2 2
MIRT622086 SRPX2 sushi repeat containing protein, X-linked 2 2 2
MIRT622168 SMYD1 SET and MYND domain containing 1 2 2
MIRT622543 PXMP4 peroxisomal membrane protein 4 2 2
MIRT622761 PGM3 phosphoglucomutase 3 2 2
MIRT622885 PDCL3 phosducin like 3 2 4
MIRT623130 NDUFC2 NADH:ubiquinone oxidoreductase subunit C2 2 2
MIRT624840 ACAP2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 2 2
MIRT625047 MBD3 methyl-CpG binding domain protein 3 2 2
MIRT625059 ZNF556 zinc finger protein 556 2 2
MIRT625508 PPAPDC1A phospholipid phosphatase 4 2 2
MIRT625573 ANKRD42 ankyrin repeat domain 42 2 2
MIRT626133 SNRNP48 small nuclear ribonucleoprotein U11/U12 subunit 48 2 2
MIRT626327 LRTOMT leucine rich transmembrane and O-methyltransferase domain containing 2 2
MIRT626765 CDC14B cell division cycle 14B 2 2
MIRT626798 CSE1L chromosome segregation 1 like 2 2
MIRT627212 ZC3H12B zinc finger CCCH-type containing 12B 2 2
MIRT627225 ZBTB8B zinc finger and BTB domain containing 8B 2 4
MIRT627256 XKR4 XK related 4 2 2
MIRT628190 GATSL2 cytosolic arginine sensor for mTORC1 subunit 2 2 2
MIRT628466 AHSA2 activator of HSP90 ATPase homolog 2 2 2
MIRT628627 CCT4 chaperonin containing TCP1 subunit 4 2 2
MIRT629040 KLLN killin, p53-regulated DNA replication inhibitor 2 2
MIRT630847 ACACB acetyl-CoA carboxylase beta 2 2
MIRT631721 RNASEH2B ribonuclease H2 subunit B 2 2
MIRT632264 USP1 ubiquitin specific peptidase 1 2 4
MIRT632571 POLQ DNA polymerase theta 2 2
MIRT633992 SLC35E2 solute carrier family 35 member E2 2 2
MIRT635211 ZNF286A zinc finger protein 286A 2 4
MIRT635249 ELOVL6 ELOVL fatty acid elongase 6 2 4
MIRT635261 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT635283 GK5 glycerol kinase 5 (putative) 2 2
MIRT635663 DTX3L deltex E3 ubiquitin ligase 3L 2 2
MIRT636251 SEC63 SEC63 homolog, protein translocation regulator 2 2
MIRT636564 EPB41 erythrocyte membrane protein band 4.1 2 2
MIRT636814 TBC1D24 TBC1 domain family member 24 2 2
MIRT637358 ZNF460 zinc finger protein 460 2 2
MIRT637473 DEFB105B defensin beta 105B 2 4
MIRT637505 DEFB105A defensin beta 105A 2 4
MIRT637861 SC5D sterol-C5-desaturase 2 2
MIRT638080 ZNF652 zinc finger protein 652 2 2
MIRT638096 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT638174 TMED4 transmembrane p24 trafficking protein 4 2 2
MIRT638201 TAF13 TATA-box binding protein associated factor 13 2 2
MIRT638278 SH2B3 SH2B adaptor protein 3 2 2
MIRT638714 FUT11 fucosyltransferase 11 2 2
MIRT638852 CLMP CXADR like membrane protein 2 2
MIRT639815 TMED8 transmembrane p24 trafficking protein family member 8 2 2
MIRT640879 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT640937 FAM129A family with sequence similarity 129 member A 2 2
MIRT640971 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT641642 GNAZ G protein subunit alpha z 2 2
MIRT641931 SLC25A16 solute carrier family 25 member 16 2 2
MIRT642136 CRY2 cryptochrome circadian clock 2 2 2
MIRT643199 JAK3 Janus kinase 3 2 2
MIRT643256 ZNF566 zinc finger protein 566 2 2
MIRT643378 TRIM16L tripartite motif containing 16 like 2 2
MIRT643683 AMER3 APC membrane recruitment protein 3 2 2
MIRT643728 MCMDC2 minichromosome maintenance domain containing 2 2 2
MIRT643949 CCDC141 coiled-coil domain containing 141 2 2
MIRT644915 SERF1B small EDRK-rich factor 1B 2 2
MIRT645163 NOL9 nucleolar protein 9 2 2
MIRT645547 PABPC1L2B poly(A) binding protein cytoplasmic 1 like 2B 2 2
MIRT645550 PABPC1L2A poly(A) binding protein cytoplasmic 1 like 2A 2 2
MIRT645572 TACR2 tachykinin receptor 2 2 2
MIRT646697 SERF1A small EDRK-rich factor 1A 2 2
MIRT647806 FRMD8 FERM domain containing 8 2 2
MIRT647903 CIRH1A UTP4, small subunit processome component 2 2
MIRT648978 ACAD8 acyl-CoA dehydrogenase family member 8 2 2
MIRT649907 SLFN12L schlafen family member 12 like 2 2
MIRT650224 SIGLEC9 sialic acid binding Ig like lectin 9 2 4
MIRT651880 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 2 2
MIRT651935 UBN1 ubinuclein 1 2 2
MIRT652839 TACO1 translational activator of cytochrome c oxidase I 2 2
MIRT652994 SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone 2 2
MIRT654800 PRICKLE1 prickle planar cell polarity protein 1 2 2
MIRT655591 OTUD7B OTU deubiquitinase 7B 2 2
MIRT658760 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 2 2
MIRT659358 CRKL CRK like proto-oncogene, adaptor protein 2 2
MIRT660717 AMER1 APC membrane recruitment protein 1 2 2
MIRT660737 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT661088 TMEM145 transmembrane protein 145 2 2
MIRT661176 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT662005 ZNF445 zinc finger protein 445 2 2
MIRT662178 KIAA1210 KIAA1210 2 2
MIRT662270 OR51E2 olfactory receptor family 51 subfamily E member 2 2 2
MIRT663046 SLC16A4 solute carrier family 16 member 4 2 2
MIRT663476 POFUT2 protein O-fucosyltransferase 2 2 2
MIRT664039 RPL27A ribosomal protein L27a 2 2
MIRT664096 ZDHHC24 zinc finger DHHC-type containing 24 2 2
MIRT664109 FUT1 fucosyltransferase 1 (H blood group) 2 2
MIRT664317 CD209 CD209 molecule 2 2
MIRT664455 BBS5 Bardet-Biedl syndrome 5 2 2
MIRT664595 HSD17B12 hydroxysteroid 17-beta dehydrogenase 12 2 4
MIRT664694 DBF4 DBF4 zinc finger 2 2
MIRT665162 SF3A1 splicing factor 3a subunit 1 2 2
MIRT665214 RBM22 RNA binding motif protein 22 2 2
MIRT665254 ZNF286B zinc finger protein 286B 2 2
MIRT665268 ZFP69B ZFP69 zinc finger protein B 2 2
MIRT665606 TTC39A tetratricopeptide repeat domain 39A 2 2
MIRT665830 TIMELESS timeless circadian clock 2 2
MIRT666201 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 1 2 2
MIRT666546 RNF115 ring finger protein 115 2 2
MIRT666602 REEP3 receptor accessory protein 3 2 2
MIRT666862 POU2F3 POU class 2 homeobox 3 2 4
MIRT666886 POLA2 DNA polymerase alpha 2, accessory subunit 2 2
MIRT667158 NRXN3 neurexin 3 2 2
MIRT667252 NEK9 NIMA related kinase 9 2 2
MIRT667419 MFSD2A major facilitator superfamily domain containing 2A 2 2
MIRT667434 METTL8 methyltransferase like 8 2 2
MIRT668023 HAUS3 HAUS augmin like complex subunit 3 2 2
MIRT668062 GPR75 G protein-coupled receptor 75 2 2
MIRT668070 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT668607 EHD4 EH domain containing 4 2 4
MIRT668694 DNAL1 dynein axonemal light chain 1 2 2
MIRT668782 DAAM1 dishevelled associated activator of morphogenesis 1 2 2
MIRT669037 CHEK1 checkpoint kinase 1 2 2
MIRT669044 CHAF1B chromatin assembly factor 1 subunit B 2 4
MIRT669156 CCNG1 cyclin G1 2 2
MIRT670090 ABCF3 ATP binding cassette subfamily F member 3 2 4
MIRT670206 SLC24A4 solute carrier family 24 member 4 2 2
MIRT672488 FUS FUS RNA binding protein 2 2
MIRT673830 SLC11A2 solute carrier family 11 member 2 2 2
MIRT675481 VEGFC vascular endothelial growth factor C 2 2
MIRT675634 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 2
MIRT677913 HIST1H2BN histone cluster 1 H2B family member n 2 2
MIRT678420 ANKRD36 ankyrin repeat domain 36 2 2
MIRT678626 OLFML2A olfactomedin like 2A 2 2
MIRT678791 NUPL2 nucleoporin like 2 2 2
MIRT679561 LIN9 lin-9 DREAM MuvB core complex component 2 2
MIRT680743 CA5B carbonic anhydrase 5B 2 2
MIRT682481 LIX1L limb and CNS expressed 1 like 2 4
MIRT682701 PSMD9 proteasome 26S subunit, non-ATPase 9 2 2
MIRT682759 MDM2 MDM2 proto-oncogene 2 2
MIRT682811 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT682847 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT682896 XIAP X-linked inhibitor of apoptosis 2 2
MIRT682916 FAM73A mitoguardin 1 2 2
MIRT682935 ZNF292 zinc finger protein 292 2 2
MIRT682953 RPL12 ribosomal protein L12 2 2
MIRT682972 NF2 neurofibromin 2 2 2
MIRT683033 SUSD5 sushi domain containing 5 2 2
MIRT683081 A1BG alpha-1-B glycoprotein 2 2
MIRT683105 TIMM10B translocase of inner mitochondrial membrane 10B 2 2
MIRT686640 TMEM184C transmembrane protein 184C 2 2
MIRT687444 NR3C1 nuclear receptor subfamily 3 group C member 1 2 2
MIRT688401 EMC8 ER membrane protein complex subunit 8 2 2
MIRT688886 C3orf70 chromosome 3 open reading frame 70 2 2
MIRT689148 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 2 2
MIRT689234 RPS19 ribosomal protein S19 2 2
MIRT689306 C5AR2 complement component 5a receptor 2 2 2
MIRT689364 ZNF101 zinc finger protein 101 2 2
MIRT689498 SCARF1 scavenger receptor class F member 1 2 2
MIRT689655 RBM23 RNA binding motif protein 23 2 2
MIRT689897 SOD2 superoxide dismutase 2 2 2
MIRT690150 PPIL6 peptidylprolyl isomerase like 6 2 2
MIRT690601 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT690805 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT690946 GLG1 golgi glycoprotein 1 2 2
MIRT691388 ATP13A4 ATPase 13A4 2 2
MIRT691408 DNA2 DNA replication helicase/nuclease 2 2 2
MIRT692175 LRRC3C leucine rich repeat containing 3C 2 2
MIRT692235 ALDH1B1 aldehyde dehydrogenase 1 family member B1 2 2
MIRT693283 GINM1 glycoprotein integral membrane 1 2 2
MIRT693439 TPGS1 tubulin polyglutamylase complex subunit 1 2 2
MIRT693460 HIST1H2AG histone cluster 1 H2A family member g 2 2
MIRT693768 ZNF383 zinc finger protein 383 2 2
MIRT694018 PPIL4 peptidylprolyl isomerase like 4 2 2
MIRT694236 ZNF749 zinc finger protein 749 2 2
MIRT694321 NLRP9 NLR family pyrin domain containing 9 2 2
MIRT694347 CHST6 carbohydrate sulfotransferase 6 2 2
MIRT694430 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 2 2
MIRT695763 WDR35 WD repeat domain 35 2 2
MIRT696167 TIPIN TIMELESS interacting protein 2 2
MIRT696417 DOCK7 dedicator of cytokinesis 7 2 2
MIRT696543 C3 complement C3 2 2
MIRT696998 CCDC80 coiled-coil domain containing 80 2 2
MIRT697232 ZYG11A zyg-11 family member A, cell cycle regulator 2 2
MIRT697806 UBXN2A UBX domain protein 2A 2 2
MIRT697944 TVP23C trans-golgi network vesicle protein 23 homolog C 2 2
MIRT698161 TNFRSF13C TNF receptor superfamily member 13C 2 2
MIRT698778 STK4 serine/threonine kinase 4 2 2
MIRT700259 RBM12B RNA binding motif protein 12B 2 2
MIRT700970 PDK3 pyruvate dehydrogenase kinase 3 2 2
MIRT701251 NUP35 nucleoporin 35 2 2
MIRT701607 MYPN myopalladin 2 2
MIRT702457 KIAA1467 family with sequence similarity 234 member B 2 2
MIRT702613 ITPRIPL2 inositol 1,4,5-trisphosphate receptor interacting protein like 2 2 2
MIRT702691 IRGQ immunity related GTPase Q 2 2
MIRT702934 HMX3 H6 family homeobox 3 2 2
MIRT702991 HERPUD2 HERPUD family member 2 2 2
MIRT703148 GPR137C G protein-coupled receptor 137C 2 2
MIRT703980 EMC1 ER membrane protein complex subunit 1 2 2
MIRT704569 CLPX caseinolytic mitochondrial matrix peptidase chaperone subunit 2 2
MIRT705065 C4orf32 family with sequence similarity 241 member A 2 2
MIRT705447 ATL2 atlastin GTPase 2 2 2
MIRT705856 AFF3 AF4/FMR2 family member 3 2 2
MIRT705886 ADIPOR2 adiponectin receptor 2 2 2
MIRT714370 HP1BP3 heterochromatin protein 1 binding protein 3 2 2
MIRT715784 PHF12 PHD finger protein 12 2 2
MIRT715864 KIAA0101 PCNA clamp associated factor 2 2
MIRT715947 NUP93 nucleoporin 93 2 2
MIRT716132 THOC5 THO complex 5 2 2
MIRT717084 EBF4 early B-cell factor 4 2 2
MIRT725424 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 2 2
MIRT736091 GREM1 gremlin 1, DAN family BMP antagonist 3 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4793 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-miR-4793-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-4793-3p Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-4793-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)

Error report submission