pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6787 |
Genomic Coordinates | chr17: 82236668 - 82236728 |
Description | Homo sapiens miR-6787 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6787-5p | ||||||||||||||||||||||||||||||||||||
Sequence | 6| UGGCGGGGGUAGAGCUGGCUGC |27 | ||||||||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||||||||
Experiments | Meta-analysis | ||||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | KIAA1551 | ||||||||||||||||||||
Synonyms | C12orf35, GET, UTA2-1 | ||||||||||||||||||||
Description | KIAA1551 | ||||||||||||||||||||
Transcript | NM_018169 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on KIAA1551 | |||||||||||||||||||||
3'UTR of KIAA1551 (miRNA target sites are highlighted) |
>KIAA1551|NM_018169|3'UTR 1 TTACAAGATGTGGTTTTGTAATTGCCACTGGGAAATTTCTTTCCTTTTCTGTTCAAAATATTTCGCTGAAACTAATGAGA 81 AATGCCATGATAAAGATTTCTCAGAGTTTGGTTCCCACTTTCATTGTATTTCATTGAAAGTGCTTAATTAAAATGGCTTG 161 AGAACTTTGGGTAGCCATGTGTAAGAAATGGATGGTATTCACCGGGGAAACAAGGTATTTGAATTTCTACTTTATTGAAC 241 CAGATTTACCATTATTTTAAAAGGAATGCTTATACAAATCAATTTGAAATTCTACCCATCTTGAGGGAGGACCGTTCCTC 321 AGTTAAGGACTTGTTTATTTAAATGGGACTGTAAATATGTTTTGGTTTCTAAGCTATATTAGCAAAATTTATTTTTCAAA 401 AATGCCCACTGTGATGTGAATGTCAAAATATATTCTTAAGTGTTTTATAACTAATTGTAAACTTTTTTTCAGAAGTCTTA 481 TTTTATACTTGTGAAACTGAACACAATTTTGGGACAACGTTTAAACATTACTTTTCATACTTGAAATAAACATTTATTTT 561 TTAAAAAACTAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293S | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084047. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep4
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
CLIP-seq Support 1 for dataset GSM1084047 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_arsenite_rep4 |
Location of target site | ENST00000312561.4 | 3UTR | GUAGCUGGGAUUACAGGCGCCCGCCACCACGCCCAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
90 hsa-miR-6787-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT449091 | XPO6 | exportin 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT449991 | PSMG1 | proteasome assembly chaperone 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454608 | MYADM | myeloid associated differentiation marker | ![]() |
![]() |
2 | 2 | ||||||
MIRT456116 | VAV3 | vav guanine nucleotide exchange factor 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT457064 | TOR4A | torsin family 4 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT461023 | SDF4 | stromal cell derived factor 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT467197 | SPRY4 | sprouty RTK signaling antagonist 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471711 | OTUB1 | OTU deubiquitinase, ubiquitin aldehyde binding 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472566 | NACC1 | nucleus accumbens associated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT476079 | GRB2 | growth factor receptor bound protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT480150 | CALR | calreticulin | ![]() |
![]() |
2 | 2 | ||||||
MIRT483027 | KHSRP | KH-type splicing regulatory protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT483498 | STMN3 | stathmin 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT483728 | THSD4 | thrombospondin type 1 domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT484550 | BARHL1 | BarH like homeobox 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT484684 | PACSIN1 | protein kinase C and casein kinase substrate in neurons 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT486059 | CTDNEP1 | CTD nuclear envelope phosphatase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT486116 | INO80E | INO80 complex subunit E | ![]() |
![]() |
2 | 2 | ||||||
MIRT486313 | SIPA1 | signal-induced proliferation-associated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT486525 | CLCN7 | chloride voltage-gated channel 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT486857 | DPF1 | double PHD fingers 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487352 | PHF15 | jade family PHD finger 2 | ![]() |
1 | 1 | |||||||
MIRT487582 | FAM83H | family with sequence similarity 83 member H | ![]() |
![]() |
2 | 4 | ||||||
MIRT487792 | GPR20 | G protein-coupled receptor 20 | ![]() |
![]() |
2 | 4 | ||||||
MIRT488104 | POU3F1 | POU class 3 homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT488786 | POFUT2 | protein O-fucosyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489361 | SYNGR1 | synaptogyrin 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT489387 | RAB11B | RAB11B, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT489680 | SCAMP4 | secretory carrier membrane protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489731 | GNAI2 | G protein subunit alpha i2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT489750 | TACC3 | transforming acidic coiled-coil containing protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490029 | PCSK4 | proprotein convertase subtilisin/kexin type 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490379 | LHFPL3 | LHFPL tetraspan subfamily member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490580 | SLC47A1 | solute carrier family 47 member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490753 | SRCIN1 | SRC kinase signaling inhibitor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491187 | JUND | JunD proto-oncogene, AP-1 transcription factor subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT491301 | VGF | VGF nerve growth factor inducible | ![]() |
![]() |
2 | 2 | ||||||
MIRT491462 | HOXB8 | homeobox B8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491702 | PDZD4 | PDZ domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491724 | RTN4R | reticulon 4 receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT491737 | SEMA3F | semaphorin 3F | ![]() |
![]() |
2 | 2 | ||||||
MIRT491984 | UNK | unkempt family zinc finger | ![]() |
![]() |
2 | 2 | ||||||
MIRT492844 | NRGN | neurogranin | ![]() |
![]() |
2 | 2 | ||||||
MIRT492936 | NEUROD2 | neuronal differentiation 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT493713 | H2AFX | H2A histone family member X | ![]() |
![]() |
2 | 2 | ||||||
MIRT494623 | ASB6 | ankyrin repeat and SOCS box containing 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT494703 | ARHGAP31 | Rho GTPase activating protein 31 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495602 | NKX2-5 | NK2 homeobox 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495750 | PDE4C | phosphodiesterase 4C | ![]() |
![]() |
2 | 4 | ||||||
MIRT500367 | ZNF385A | zinc finger protein 385A | ![]() |
![]() |
2 | 2 | ||||||
MIRT501161 | SLC10A7 | solute carrier family 10 member 7 | ![]() |
![]() |
2 | 6 | ||||||
MIRT501702 | PCGF3 | polycomb group ring finger 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT504922 | PDRG1 | p53 and DNA damage regulated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT517945 | TRIM59 | tripartite motif containing 59 | ![]() |
![]() |
2 | 2 | ||||||
MIRT524212 | DDI2 | DNA damage inducible 1 homolog 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT531186 | SIGLEC12 | sialic acid binding Ig like lectin 12 (gene/pseudogene) | ![]() |
![]() |
2 | 2 | ||||||
MIRT531972 | C12orf49 | chromosome 12 open reading frame 49 | ![]() |
![]() |
2 | 2 | ||||||
MIRT558055 | EVI5L | ecotropic viral integration site 5 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT560482 | LACE1 | AFG1 like ATPase | ![]() |
![]() |
2 | 2 | ||||||
MIRT563217 | FXN | frataxin | ![]() |
![]() |
2 | 2 | ||||||
MIRT569095 | FSCN1 | fascin actin-bundling protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569522 | AP5Z1 | adaptor related protein complex 5 zeta 1 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT569531 | CTTN | cortactin | ![]() |
![]() |
2 | 2 | ||||||
MIRT569848 | RGS5 | regulator of G protein signaling 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570738 | ANKRD52 | ankyrin repeat domain 52 | ![]() |
![]() |
2 | 2 | ||||||
MIRT574140 | MARVELD1 | MARVEL domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT615994 | DHTKD1 | dehydrogenase E1 and transketolase domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628493 | ZNF556 | zinc finger protein 556 | ![]() |
![]() |
2 | 2 | ||||||
MIRT633451 | KLLN | killin, p53-regulated DNA replication inhibitor | ![]() |
![]() |
2 | 2 | ||||||
MIRT649054 | SLC1A2 | solute carrier family 1 member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT649340 | HEXA | hexosaminidase subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT670226 | PTCHD1 | patched domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670666 | KIAA1551 | KIAA1551 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671452 | CDH7 | cadherin 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671729 | ZNF451 | zinc finger protein 451 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690285 | ZNF154 | zinc finger protein 154 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700575 | PRSS22 | protease, serine 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701411 | NKRF | NFKB repressing factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT711877 | VASP | vasodilator stimulated phosphoprotein | ![]() |
![]() |
2 | 2 | ||||||
MIRT712082 | UNC13A | unc-13 homolog A | ![]() |
![]() |
2 | 2 | ||||||
MIRT712523 | CYTH2 | cytohesin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712751 | GMDS | GDP-mannose 4,6-dehydratase | ![]() |
![]() |
2 | 2 | ||||||
MIRT714681 | PRX | periaxin | ![]() |
![]() |
2 | 2 | ||||||
MIRT714718 | VPS8 | VPS8, CORVET complex subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT717508 | HRNR | hornerin | ![]() |
![]() |
2 | 2 | ||||||
MIRT717650 | THBS2 | thrombospondin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT719592 | PIAS4 | protein inhibitor of activated STAT 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720521 | PTGR2 | prostaglandin reductase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT721295 | C3orf36 | chromosome 3 open reading frame 36 | ![]() |
![]() |
2 | 2 | ||||||
MIRT724922 | VPS18 | VPS18, CORVET/HOPS core subunit | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|