pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4486 |
Genomic Coordinates | chr11: 19575310 - 19575372 |
Description | Homo sapiens miR-4486 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4486 | ||||||||||||
Sequence | 5| GCUGGGCGAGGCUGGCA |21 | ||||||||||||
Evidence | Experimental | ||||||||||||
Experiments | Illumina | ||||||||||||
SNPs in miRNA |
|
||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | KIAA1551 | ||||||||||||||||||||
Synonyms | C12orf35, GET, UTA2-1 | ||||||||||||||||||||
Description | KIAA1551 | ||||||||||||||||||||
Transcript | NM_018169 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on KIAA1551 | |||||||||||||||||||||
3'UTR of KIAA1551 (miRNA target sites are highlighted) |
>KIAA1551|NM_018169|3'UTR 1 TTACAAGATGTGGTTTTGTAATTGCCACTGGGAAATTTCTTTCCTTTTCTGTTCAAAATATTTCGCTGAAACTAATGAGA 81 AATGCCATGATAAAGATTTCTCAGAGTTTGGTTCCCACTTTCATTGTATTTCATTGAAAGTGCTTAATTAAAATGGCTTG 161 AGAACTTTGGGTAGCCATGTGTAAGAAATGGATGGTATTCACCGGGGAAACAAGGTATTTGAATTTCTACTTTATTGAAC 241 CAGATTTACCATTATTTTAAAAGGAATGCTTATACAAATCAATTTGAAATTCTACCCATCTTGAGGGAGGACCGTTCCTC 321 AGTTAAGGACTTGTTTATTTAAATGGGACTGTAAATATGTTTTGGTTTCTAAGCTATATTAGCAAAATTTATTTTTCAAA 401 AATGCCCACTGTGATGTGAATGTCAAAATATATTCTTAAGTGTTTTATAACTAATTGTAAACTTTTTTTCAGAAGTCTTA 481 TTTTATACTTGTGAAACTGAACACAATTTTGGGACAACGTTTAAACATTACTTTTCATACTTGAAATAAACATTTATTTT 561 TTAAAAAACTAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
miRNA:Target | ---- | |||||||||
Validation Method |
|
|||||||||
Conditions | HEK293S | |||||||||
Location of target site | 3'UTR | |||||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | |||||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084047. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep4
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
|||||||||
miRNA-target interactions (Provided by authors) |
|
|||||||||
Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
CLIP-seq Support 1 for dataset GSM1084047 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_arsenite_rep4 |
Location of target site | ENST00000312561.4 | 3UTR | GUAGCUGGGAUUACAGGCGCCCGCCACCACGCCCAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
108 hsa-miR-4486 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT254654 | NF2 | neurofibromin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT458684 | MRI1 | methylthioribose-1-phosphate isomerase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470845 | PLXND1 | plexin D1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493011 | NANOS1 | nanos C2HC-type zinc finger 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT497264 | GRK6 | G protein-coupled receptor kinase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT497675 | SYNGR1 | synaptogyrin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498219 | TLN2 | talin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498310 | BCL11B | B-cell CLL/lymphoma 11B | ![]() |
![]() |
2 | 2 | ||||||
MIRT504048 | TOMM5 | translocase of outer mitochondrial membrane 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT519959 | ZCCHC8 | zinc finger CCHC-type containing 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531521 | NOM1 | nucleolar protein with MIF4G domain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533144 | WNT10A | Wnt family member 10A | ![]() |
![]() |
2 | 2 | ||||||
MIRT533541 | TPR | translocated promoter region, nuclear basket protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT533681 | TMEM86A | transmembrane protein 86A | ![]() |
![]() |
2 | 2 | ||||||
MIRT540321 | PIGR | polymeric immunoglobulin receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT540719 | GUF1 | GUF1 homolog, GTPase | ![]() |
![]() |
2 | 2 | ||||||
MIRT541566 | ZNF43 | zinc finger protein 43 | ![]() |
![]() |
2 | 4 | ||||||
MIRT541787 | TBCCD1 | TBCC domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541925 | ORC1 | origin recognition complex subunit 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT542232 | FUT9 | fucosyltransferase 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542285 | POLR3K | RNA polymerase III subunit K | ![]() |
![]() |
2 | 2 | ||||||
MIRT542299 | QTRTD1 | queuine tRNA-ribosyltransferase accessory subunit 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT542368 | PAICS | phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase | ![]() |
![]() |
2 | 2 | ||||||
MIRT542441 | C3 | complement C3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT542475 | APOC3 | apolipoprotein C3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542535 | MRPS10 | mitochondrial ribosomal protein S10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542640 | TIMM8A | translocase of inner mitochondrial membrane 8A | ![]() |
![]() |
2 | 2 | ||||||
MIRT542788 | PLEKHA3 | pleckstrin homology domain containing A3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT552104 | PPP1R1A | protein phosphatase 1 regulatory inhibitor subunit 1A | ![]() |
![]() |
2 | 2 | ||||||
MIRT564913 | YTHDF1 | YTH N6-methyladenosine RNA binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568606 | ACVR2A | activin A receptor type 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT607389 | LANCL3 | LanC like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT607451 | ZNF543 | zinc finger protein 543 | ![]() |
![]() |
2 | 2 | ||||||
MIRT610058 | MYBPC1 | myosin binding protein C, slow type | ![]() |
![]() |
2 | 2 | ||||||
MIRT610793 | KLK2 | kallikrein related peptidase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617176 | GOSR2 | golgi SNAP receptor complex member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT620579 | WBSCR27 | methyltransferase like 27 | ![]() |
![]() |
2 | 4 | ||||||
MIRT622085 | SRPX2 | sushi repeat containing protein, X-linked 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622542 | PXMP4 | peroxisomal membrane protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT630009 | PDE6B | phosphodiesterase 6B | ![]() |
![]() |
2 | 2 | ||||||
MIRT631813 | PTDSS2 | phosphatidylserine synthase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT632721 | MSANTD4 | Myb/SANT DNA binding domain containing 4 with coiled-coils | ![]() |
![]() |
2 | 2 | ||||||
MIRT632757 | MED28 | mediator complex subunit 28 | ![]() |
![]() |
2 | 2 | ||||||
MIRT634821 | ASB6 | ankyrin repeat and SOCS box containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635255 | FBXL20 | F-box and leucine rich repeat protein 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT637082 | SELPLG | selectin P ligand | ![]() |
![]() |
2 | 2 | ||||||
MIRT637357 | ZNF460 | zinc finger protein 460 | ![]() |
![]() |
2 | 2 | ||||||
MIRT637472 | DEFB105B | defensin beta 105B | ![]() |
![]() |
2 | 4 | ||||||
MIRT637504 | DEFB105A | defensin beta 105A | ![]() |
![]() |
2 | 4 | ||||||
MIRT639022 | AAK1 | AP2 associated kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641012 | ANKFY1 | ankyrin repeat and FYVE domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642170 | HEBP2 | heme binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648977 | ACAD8 | acyl-CoA dehydrogenase family member 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650515 | UFM1 | ubiquitin fold modifier 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650949 | INMT | indolethylamine N-methyltransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT658354 | FAM65B | RHO family interacting cell polarization regulator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT660736 | ALG14 | ALG14, UDP-N-acetylglucosaminyltransferase subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT662191 | MEI1 | meiotic double-stranded break formation protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663045 | SLC16A4 | solute carrier family 16 member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT664811 | IRAK3 | interleukin 1 receptor associated kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665161 | SF3A1 | splicing factor 3a subunit 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT665346 | YES1 | YES proto-oncogene 1, Src family tyrosine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT666493 | SBNO1 | strawberry notch homolog 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT666545 | RNF115 | ring finger protein 115 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669351 | BMP3 | bone morphogenetic protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669904 | KIAA0754 | KIAA0754 | ![]() |
![]() |
2 | 4 | ||||||
MIRT670323 | CEP57L1 | centrosomal protein 57 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670430 | ELP2 | elongator acetyltransferase complex subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670672 | KIAA1551 | KIAA1551 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670746 | HOOK3 | hook microtubule tethering protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670998 | PTGIS | prostaglandin I2 synthase | ![]() |
![]() |
2 | 2 | ||||||
MIRT671290 | RPL37A | ribosomal protein L37a | ![]() |
![]() |
2 | 2 | ||||||
MIRT671469 | AGPAT6 | glycerol-3-phosphate acyltransferase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671833 | STIL | STIL, centriolar assembly protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT673006 | TAF1 | TATA-box binding protein associated factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675881 | CSTF1 | cleavage stimulation factor subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT678625 | OLFML2A | olfactomedin like 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT678790 | NUPL2 | nucleoporin like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT679560 | LIN9 | lin-9 DREAM MuvB core complex component | ![]() |
![]() |
2 | 2 | ||||||
MIRT681032 | AAED1 | AhpC/TSA antioxidant enzyme domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682480 | LIX1L | limb and CNS expressed 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT682758 | MDM2 | MDM2 proto-oncogene | ![]() |
![]() |
2 | 2 | ||||||
MIRT682810 | TMCO1 | transmembrane and coiled-coil domains 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682867 | C9orf156 | tRNA methyltransferase O | ![]() |
![]() |
2 | 2 | ||||||
MIRT689233 | RPS19 | ribosomal protein S19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689305 | C5AR2 | complement component 5a receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689363 | ZNF101 | zinc finger protein 101 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689629 | NAA30 | N(alpha)-acetyltransferase 30, NatC catalytic subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT689654 | RBM23 | RNA binding motif protein 23 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690148 | PPIL6 | peptidylprolyl isomerase like 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691407 | DNA2 | DNA replication helicase/nuclease 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691847 | OSCAR | osteoclast associated, immunoglobulin-like receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT692234 | ALDH1B1 | aldehyde dehydrogenase 1 family member B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT694320 | NLRP9 | NLR family pyrin domain containing 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT694365 | CHST6 | carbohydrate sulfotransferase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT696215 | LYZ | lysozyme | ![]() |
![]() |
2 | 2 | ||||||
MIRT697230 | ZYG11A | zyg-11 family member A, cell cycle regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT700487 | PTPRF | protein tyrosine phosphatase, receptor type F | ![]() |
![]() |
2 | 2 | ||||||
MIRT700612 | PRKCA | protein kinase C alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT702456 | KIAA1467 | family with sequence similarity 234 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT702990 | HERPUD2 | HERPUD family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703998 | EIF5A2 | eukaryotic translation initiation factor 5A2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT704701 | CHRFAM7A | CHRNA7 (exons 5-10) and FAM7A (exons A-E) fusion | ![]() |
![]() |
2 | 2 | ||||||
MIRT712481 | FSTL3 | follistatin like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712781 | ZNF154 | zinc finger protein 154 | ![]() |
![]() |
2 | 2 | ||||||
MIRT714369 | HP1BP3 | heterochromatin protein 1 binding protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT722570 | C1orf95 | stum, mechanosensory transduction mediator homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT722839 | C17orf102 | chromosome 17 open reading frame 102 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|