pre-miRNA Information
pre-miRNA hsa-mir-5691   
Genomic Coordinates chr11: 9090312 - 9090379
Description Homo sapiens miR-5691 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-5691
Sequence 9| UUGCUCUGAGCUCCGAGAAAGC |30
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1042238449 3 dbSNP
rs554804494 11 dbSNP
rs1172229307 13 dbSNP
rs112511786 14 dbSNP
Putative Targets

Gene Information
Gene Symbol DCTN6   
Synonyms WS-3, WS3, p27
Description dynactin subunit 6
Transcript NM_006571   
Expression
Putative miRNA Targets on DCTN6
3'UTR of DCTN6
(miRNA target sites are highlighted)
>DCTN6|NM_006571|3'UTR
   1 GAACAGTGTATAACATGAAGATAACATTTTGTCTTTGACCACTGTCTTTTGAATGGGCCCACAGTGTTTATGTACTCTTA
  81 ACAACTCACAGAATAATACATGTTCACTTTATTTTGTAAAATTGGGTTGAGAGGAAACTAATGGAGTTTCATTGTAACTG
 161 TCCTTTGTAATTTATATAAATGTATTATTTTCCTATATCCTTGGTTCTTTTCTGATAATTTACAGATTTAGCTTTTCTTT
 241 TGTTATATAAACTGCTAGCCACAAATTTTAGTTATGTAAAAGGCTACCCTTGACAAGAAAAGACATACTGTCATGTATTT
 321 ATATTCTAGCATAGACTAAACTGAATAAAAATGCTGATAACAGGACCTTTAGTAAGCATACTTTAATCAGTTTTTCTCCT
 401 TGAATTAATCTTTTCTCTTAATTTTTATTATGTACTAGTTGTATTAAAGCTAATGTGTTTACTTTT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' cgaaagagCCUCG-AGUC--UCGUu 5'
                  ||| | |:||  |||| 
Target 5' tgataacaGGACCTTTAGTAAGCAt 3'
355 - 379 98.00 -6.90
2
miRNA  3' cgAAAGAGC---CUCGAGUCUCGUu 5'
            | |:|:|   |:|| || ||:: 
Target 5' tgTCTTTTGAATGGGCCCACAGTGt 3'
43 - 67 96.00 -8.80
3
miRNA  3' cgaAAGAGCCUCGAGUCUCGUu 5'
             ||||   ||| :||| :| 
Target 5' ataTTCT---AGCATAGACTAa 3'
321 - 339 96.00 -6.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM3412969 1 COSMIC
COSN31525792 20 COSMIC
COSN31528728 34 COSMIC
COSN30454543 40 COSMIC
COSN30116944 58 COSMIC
COSN31581116 60 COSMIC
COSN30108786 62 COSMIC
COSN30132370 69 COSMIC
COSN30162767 78 COSMIC
COSN28666104 135 COSMIC
COSN31601398 164 COSMIC
COSN6920773 346 COSMIC
COSN18816047 400 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1333770349 1 dbSNP
rs766879862 5 dbSNP
rs1280063980 8 dbSNP
rs200863630 9 dbSNP
rs1310620788 10 dbSNP
rs371971868 11 dbSNP
rs766433518 12 dbSNP
rs768192496 13 dbSNP
rs753137193 14 dbSNP
rs760861658 15 dbSNP
rs1417690615 22 dbSNP
rs1420377689 25 dbSNP
rs764035942 26 dbSNP
rs112297965 27 dbSNP
rs754123310 32 dbSNP
rs1176030211 40 dbSNP
rs757357787 48 dbSNP
rs1011337503 54 dbSNP
rs1244198606 60 dbSNP
rs1237863035 71 dbSNP
rs1460226521 78 dbSNP
rs546015805 87 dbSNP
rs537540664 90 dbSNP
rs1216736603 91 dbSNP
rs905131961 98 dbSNP
rs1186076613 100 dbSNP
rs1003374765 101 dbSNP
rs1034883335 103 dbSNP
rs1304951305 125 dbSNP
rs1239408546 135 dbSNP
rs1383454522 142 dbSNP
rs966586560 146 dbSNP
rs3808483 152 dbSNP
rs1401175546 154 dbSNP
rs1158065920 168 dbSNP
rs1406478670 182 dbSNP
rs1157720942 185 dbSNP
rs567949359 194 dbSNP
rs1386418596 201 dbSNP
rs993205160 208 dbSNP
rs1027832719 212 dbSNP
rs1177368301 225 dbSNP
rs936365706 227 dbSNP
rs1054875774 229 dbSNP
rs1375253010 233 dbSNP
rs1486964589 240 dbSNP
rs951734103 240 dbSNP
rs986226106 244 dbSNP
rs916356725 247 dbSNP
rs533864983 255 dbSNP
rs1215989750 257 dbSNP
rs1413250918 274 dbSNP
rs553622133 276 dbSNP
rs1046514943 283 dbSNP
rs1296026731 289 dbSNP
rs964298844 289 dbSNP
rs576642649 301 dbSNP
rs1359450245 305 dbSNP
rs1197361798 307 dbSNP
rs866160006 311 dbSNP
rs139694211 318 dbSNP
rs1424767085 327 dbSNP
rs1366868758 328 dbSNP
rs1049150419 332 dbSNP
rs1423282764 332 dbSNP
rs935521635 335 dbSNP
rs1347859961 340 dbSNP
rs1194363534 348 dbSNP
rs1430595283 367 dbSNP
rs558632646 373 dbSNP
rs1193159083 397 dbSNP
rs1490548759 403 dbSNP
rs1271103249 411 dbSNP
rs1052443227 421 dbSNP
rs1355544479 426 dbSNP
rs149784790 456 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084045. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep3 ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' cgaaagagccucgaGUCUCGUu 5'
                        ||||||| 
Target 5' ------------aaCAGAGCAa 3'
1 - 10
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084045
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep3
Location of target site ENST00000221114.3 | 3UTR | AACAGAGCAAGACUCCAUCUCAAAAAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
91 hsa-miR-5691 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT091162 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT242227 TTC9 tetratricopeptide repeat domain 9 2 4
MIRT246192 TXNIP thioredoxin interacting protein 2 2
MIRT251553 DCAF7 DDB1 and CUL4 associated factor 7 2 4
MIRT387267 SOX9 SRY-box 9 2 2
MIRT463486 ZC3H11A zinc finger CCCH-type containing 11A 2 12
MIRT494446 BTG2 BTG anti-proliferation factor 2 2 2
MIRT496478 ADAMTS17 ADAM metallopeptidase with thrombospondin type 1 motif 17 2 2
MIRT501825 NCOA3 nuclear receptor coactivator 3 2 2
MIRT503072 C6orf120 chromosome 6 open reading frame 120 2 2
MIRT504755 TEP1 telomerase associated protein 1 2 4
MIRT505971 RAB11FIP1 RAB11 family interacting protein 1 2 4
MIRT511868 GOLGA7 golgin A7 2 6
MIRT512900 UBL4A ubiquitin like 4A 2 2
MIRT513048 LYPD6 LY6/PLAUR domain containing 6 2 6
MIRT523772 FAM83D family with sequence similarity 83 member D 2 2
MIRT525126 RPS11 ribosomal protein S11 2 2
MIRT525816 VIMP selenoprotein S 2 10
MIRT531222 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT531729 SLC2A9 solute carrier family 2 member 9 2 2
MIRT536282 LIMA1 LIM domain and actin binding 1 2 2
MIRT537291 G3BP1 G3BP stress granule assembly factor 1 2 2
MIRT537724 ELAVL2 ELAV like RNA binding protein 2 2 2
MIRT547940 HNRNPA0 heterogeneous nuclear ribonucleoprotein A0 2 2
MIRT554177 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT555015 RAB2B RAB2B, member RAS oncogene family 2 2
MIRT576717 Wars tryptophanyl-tRNA synthetase 2 2
MIRT607484 HEBP2 heme binding protein 2 2 2
MIRT610786 KLK2 kallikrein related peptidase 2 2 2
MIRT611491 ZNF440 zinc finger protein 440 2 2
MIRT613986 DBT dihydrolipoamide branched chain transacylase E2 2 2
MIRT615782 KIAA0319L KIAA0319 like 2 2
MIRT620563 WBSCR27 methyltransferase like 27 2 4
MIRT624157 DGKE diacylglycerol kinase epsilon 2 2
MIRT626088 MKLN1 muskelin 1 2 2
MIRT629481 GSN gelsolin 2 2
MIRT636645 CDK4 cyclin dependent kinase 4 2 2
MIRT638074 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT638442 PLXDC2 plexin domain containing 2 2 2
MIRT641025 KLHL7 kelch like family member 7 2 2
MIRT641539 MOCOS molybdenum cofactor sulfurase 2 2
MIRT643004 ZNF829 zinc finger protein 829 2 2
MIRT643092 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT644979 IL2RA interleukin 2 receptor subunit alpha 2 2
MIRT645912 PLXNA3 plexin A3 2 2
MIRT646605 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT648033 FADS6 fatty acid desaturase 6 2 2
MIRT657491 HBEGF heparin binding EGF like growth factor 2 2
MIRT658381 FAM26E calcium homeostasis modulator family member 5 2 2
MIRT659695 CD200 CD200 molecule 2 2
MIRT661276 TEX9 testis expressed 9 2 2
MIRT661348 DYRK4 dual specificity tyrosine phosphorylation regulated kinase 4 2 2
MIRT662948 JPH2 junctophilin 2 2 2
MIRT663225 PPY pancreatic polypeptide 2 2
MIRT663280 SPN sialophorin 2 2
MIRT663335 ZNF74 zinc finger protein 74 2 2
MIRT664344 C16orf45 chromosome 16 open reading frame 45 2 2
MIRT664855 TBRG4 transforming growth factor beta regulator 4 2 2
MIRT665484 VPS53 VPS53, GARP complex subunit 2 2
MIRT666428 SH2B3 SH2B adaptor protein 3 2 2
MIRT668162 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT670170 CCDC142 coiled-coil domain containing 142 2 2
MIRT671277 MTO1 mitochondrial tRNA translation optimization 1 2 2
MIRT672284 GP2 glycoprotein 2 2 2
MIRT672435 RAB10 RAB10, member RAS oncogene family 2 2
MIRT672646 SLC25A16 solute carrier family 25 member 16 2 4
MIRT672760 UBE2V2 ubiquitin conjugating enzyme E2 V2 2 2
MIRT672834 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 2 2
MIRT672841 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT673080 AK1 adenylate kinase 1 2 2
MIRT673148 C1orf50 chromosome 1 open reading frame 50 2 2
MIRT673323 THAP1 THAP domain containing 1 2 2
MIRT673893 DCTN6 dynactin subunit 6 2 2
MIRT674182 PLEKHM3 pleckstrin homology domain containing M3 2 2
MIRT674607 RBBP4 RB binding protein 4, chromatin remodeling factor 2 2
MIRT674740 SLC16A1 solute carrier family 16 member 1 2 2
MIRT675140 MOGAT1 monoacylglycerol O-acyltransferase 1 2 4
MIRT675194 NKPD1 NTPase KAP family P-loop domain containing 1 2 2
MIRT675886 SNAP29 synaptosome associated protein 29 2 2
MIRT679163 PSMB2 proteasome subunit beta 2 2 2
MIRT680337 ZNF281 zinc finger protein 281 2 2
MIRT706699 GPR155 G protein-coupled receptor 155 2 2
MIRT706911 THAP6 THAP domain containing 6 2 2
MIRT707880 SLC45A4 solute carrier family 45 member 4 2 2
MIRT709097 SEPT4 septin 4 2 2
MIRT709408 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT710845 FAM210A family with sequence similarity 210 member A 2 2
MIRT711358 VPS8 VPS8, CORVET complex subunit 2 2
MIRT718590 SCD5 stearoyl-CoA desaturase 5 2 2
MIRT723649 RPTN repetin 2 2
MIRT724208 NUP205 nucleoporin 205 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-5691 Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)

Error report submission