miRTarBase - #MIRT673895


—
pre-miRNA Information
pre-miRNA hsa-mir-6501   
Genomic Coordinates chr21: 33550662 - 33550728
Description Homo sapiens miR-6501 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6501-5p
Sequence 3| AGUUGCCAGGGCUGCCUUUGGU |24
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
1055619 20 ClinVar
COSM5974214 5 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs756127353 5 dbSNP
rs764400023 6 dbSNP
rs753967693 8 dbSNP
rs1283296362 14 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DCTN6   
Synonyms WS-3, WS3, p27
Description dynactin subunit 6
Transcript NM_006571   
Expression
Putative miRNA Targets on DCTN6
3'UTR of DCTN6
(miRNA target sites are highlighted)		 
>DCTN6|NM_006571|3'UTR
   1 GAACAGTGTATAACATGAAGATAACATTTTGTCTTTGACCACTGTCTTTTGAATGGGCCCACAGTGTTTATGTACTCTTA
  81 ACAACTCACAGAATAATACATGTTCACTTTATTTTGTAAAATTGGGTTGAGAGGAAACTAATGGAGTTTCATTGTAACTG
 161 TCCTTTGTAATTTATATAAATGTATTATTTTCCTATATCCTTGGTTCTTTTCTGATAATTTACAGATTTAGCTTTTCTTT
 241 TGTTATATAAACTGCTAGCCACAAATTTTAGTTATGTAAAAGGCTACCCTTGACAAGAAAAGACATACTGTCATGTATTT
 321 ATATTCTAGCATAGACTAAACTGAATAAAAATGCTGATAACAGGACCTTTAGTAAGCATACTTTAATCAGTTTTTCTCCT
 401 TGAATTAATCTTTTCTCTTAATTTTTATTATGTACTAGTTGTATTAAAGCTAATGTGTTTACTTTT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uggUUUCCG-UCGGGACCGUUga 5'
             |||||| | ||:|| |||  
Target 5' gtaAAAGGCTACCCTTGACAAga 3'
 276 - 298 123.00 -14.60
2 
miRNA  3' ugGUUUCCGUC--GGGACCGUUGa 5'
            | || | ||  :| | |:||| 
Target 5' aaCTAATGGAGTTTCATTGTAACt 3'
 136 - 159 106.00 -10.30
3 
miRNA  3' ugGUUUCCGUCGGGACCGUUGa 5'
            :|||   | : ||| :||| 
Target 5' aaTAAA---AATGCTGATAACa 3'
 344 - 362 101.00 -6.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM3412969 1 COSMIC
COSN31525792 20 COSMIC
COSN31528728 34 COSMIC
COSN30454543 40 COSMIC
COSN30116944 58 COSMIC
COSN31581116 60 COSMIC
COSN30108786 62 COSMIC
COSN30132370 69 COSMIC
COSN30162767 78 COSMIC
COSN28666104 135 COSMIC
COSN31601398 164 COSMIC
COSN6920773 346 COSMIC
COSN18816047 400 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1333770349 1 dbSNP
rs766879862 5 dbSNP
rs1280063980 8 dbSNP
rs200863630 9 dbSNP
rs1310620788 10 dbSNP
rs371971868 11 dbSNP
rs766433518 12 dbSNP
rs768192496 13 dbSNP
rs753137193 14 dbSNP
rs760861658 15 dbSNP
rs1417690615 22 dbSNP
rs1420377689 25 dbSNP
rs764035942 26 dbSNP
rs112297965 27 dbSNP
rs754123310 32 dbSNP
rs1176030211 40 dbSNP
rs757357787 48 dbSNP
rs1011337503 54 dbSNP
rs1244198606 60 dbSNP
rs1237863035 71 dbSNP
rs1460226521 78 dbSNP
rs546015805 87 dbSNP
rs537540664 90 dbSNP
rs1216736603 91 dbSNP
rs905131961 98 dbSNP
rs1186076613 100 dbSNP
rs1003374765 101 dbSNP
rs1034883335 103 dbSNP
rs1304951305 125 dbSNP
rs1239408546 135 dbSNP
rs1383454522 142 dbSNP
rs966586560 146 dbSNP
rs3808483 152 dbSNP
rs1401175546 154 dbSNP
rs1158065920 168 dbSNP
rs1406478670 182 dbSNP
rs1157720942 185 dbSNP
rs567949359 194 dbSNP
rs1386418596 201 dbSNP
rs993205160 208 dbSNP
rs1027832719 212 dbSNP
rs1177368301 225 dbSNP
rs936365706 227 dbSNP
rs1054875774 229 dbSNP
rs1375253010 233 dbSNP
rs1486964589 240 dbSNP
rs951734103 240 dbSNP
rs986226106 244 dbSNP
rs916356725 247 dbSNP
rs533864983 255 dbSNP
rs1215989750 257 dbSNP
rs1413250918 274 dbSNP
rs553622133 276 dbSNP
rs1046514943 283 dbSNP
rs1296026731 289 dbSNP
rs964298844 289 dbSNP
rs576642649 301 dbSNP
rs1359450245 305 dbSNP
rs1197361798 307 dbSNP
rs866160006 311 dbSNP
rs139694211 318 dbSNP
rs1424767085 327 dbSNP
rs1366868758 328 dbSNP
rs1049150419 332 dbSNP
rs1423282764 332 dbSNP
rs935521635 335 dbSNP
rs1347859961 340 dbSNP
rs1194363534 348 dbSNP
rs1430595283 367 dbSNP
rs558632646 373 dbSNP
rs1193159083 397 dbSNP
rs1490548759 403 dbSNP
rs1271103249 411 dbSNP
rs1052443227 421 dbSNP
rs1355544479 426 dbSNP
rs149784790 456 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084045. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep3 ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ugguuuccgucgggacCGUUga 5'
                          ||||  
Target 5' ----------aacagaGCAAga 3'
 		1 - 12
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084045
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep3
Location of target site ENST00000221114.3 | 3UTR | AACAGAGCAAGACUCCAUCUCAAAAAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
167 hsa-miR-6501-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT156859 FAM126B family with sequence similarity 126 member B 2 2
MIRT173355 TP53INP1 tumor protein p53 inducible nuclear protein 1 2 2
MIRT369102 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT442037 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT442829 AZIN1 antizyme inhibitor 1 2 2
MIRT443729 CCND2 cyclin D2 2 2
MIRT453771 NUCB1 nucleobindin 1 2 10
MIRT453875 IFRD1 interferon related developmental regulator 1 2 12
MIRT454229 OSBPL10 oxysterol binding protein like 10 2 11
MIRT458829 RPUSD2 RNA pseudouridylate synthase domain containing 2 2 2
MIRT459898 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 10
MIRT464162 VMP1 vacuole membrane protein 1 2 15
MIRT495411 SMAD2 SMAD family member 2 2 2
MIRT496906 TRIM56 tripartite motif containing 56 2 2
MIRT498653 AP3B2 adaptor related protein complex 3 beta 2 subunit 2 6
MIRT498706 PGAM5 PGAM family member 5, mitochondrial serine/threonine protein phosphatase 2 10
MIRT499308 ZNF485 zinc finger protein 485 2 6
MIRT499707 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 2 10
MIRT499755 CIRH1A UTP4, small subunit processome component 2 6
MIRT499827 PCSK9 proprotein convertase subtilisin/kexin type 9 2 8
MIRT503691 MAVS mitochondrial antiviral signaling protein 2 2
MIRT512418 LAYN layilin 2 4
MIRT516232 RAB3B RAB3B, member RAS oncogene family 2 2
MIRT522554 MCAM melanoma cell adhesion molecule 2 4
MIRT523760 FBXO27 F-box protein 27 2 4
MIRT525107 PRKD2 protein kinase D2 2 2
MIRT525919 KIAA0391 KIAA0391 2 2
MIRT527246 COMMD6 COMM domain containing 6 2 2
MIRT527564 ADCY7 adenylate cyclase 7 2 2
MIRT528764 CD1D CD1d molecule 2 2
MIRT529362 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 4
MIRT529464 ZNF546 zinc finger protein 546 2 2
MIRT530676 CHRNB1 cholinergic receptor nicotinic beta 1 subunit 2 4
MIRT531635 C19orf52 translocase of inner mitochondrial membrane 29 2 4
MIRT531909 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT532172 SEC14L5 SEC14 like lipid binding 5 2 4
MIRT534234 SLC25A16 solute carrier family 25 member 16 2 4
MIRT534561 RRAGD Ras related GTP binding D 2 2
MIRT534971 PSD3 pleckstrin and Sec7 domain containing 3 2 2
MIRT536738 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT538544 CELF1 CUGBP Elav-like family member 1 2 2
MIRT540462 ZNF71 zinc finger protein 71 2 2
MIRT540554 PPIC peptidylprolyl isomerase C 2 2
MIRT543593 KIAA1549 KIAA1549 2 2
MIRT543963 RNF20 ring finger protein 20 2 2
MIRT544047 C9orf64 chromosome 9 open reading frame 64 2 2
MIRT544670 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT550665 TRAF1 TNF receptor associated factor 1 2 2
MIRT558540 CSNK1G3 casein kinase 1 gamma 3 2 4
MIRT574917 Vmp1 vacuole membrane protein 1 2 9
MIRT575298 Osbpl10 oxysterol binding protein-like 10 2 7
MIRT607960 SNX22 sorting nexin 22 2 2
MIRT610649 TIPRL TOR signaling pathway regulator 2 8
MIRT615899 GATAD1 GATA zinc finger domain containing 1 2 2
MIRT617438 CCS copper chaperone for superoxide dismutase 2 2
MIRT617510 C5orf45 MRN complex interacting protein 2 2
MIRT617548 MTO1 mitochondrial tRNA translation optimization 1 2 2
MIRT620565 WBSCR27 methyltransferase like 27 2 2
MIRT623166 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT624161 DGKE diacylglycerol kinase epsilon 2 2
MIRT626090 MKLN1 muskelin 1 2 2
MIRT627010 FIG4 FIG4 phosphoinositide 5-phosphatase 2 2
MIRT627073 SF3A1 splicing factor 3a subunit 1 2 2
MIRT627136 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT627340 TSHZ2 teashirt zinc finger homeobox 2 2 2
MIRT627436 TAS2R5 taste 2 receptor member 5 2 2
MIRT628273 CYB5D1 cytochrome b5 domain containing 1 2 2
MIRT629091 F2RL1 F2R like trypsin receptor 1 2 4
MIRT629282 UNC13A unc-13 homolog A 2 2
MIRT630122 ARHGEF5 Rho guanine nucleotide exchange factor 5 2 2
MIRT630247 SMTNL2 smoothelin like 2 2 2
MIRT631260 CENPM centromere protein M 2 2
MIRT631336 CD300E CD300e molecule 2 2
MIRT631399 IL2RA interleukin 2 receptor subunit alpha 2 2
MIRT632593 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT632991 DUSP18 dual specificity phosphatase 18 2 2
MIRT633079 CXorf21 chromosome X open reading frame 21 2 2
MIRT634223 TMEM132B transmembrane protein 132B 2 2
MIRT635046 MYH11 myosin heavy chain 11 2 2
MIRT636444 LRCH3 leucine rich repeats and calponin homology domain containing 3 2 2
MIRT636649 CDK4 cyclin dependent kinase 4 2 2
MIRT637129 BAMBI BMP and activin membrane bound inhibitor 2 2
MIRT637282 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT637527 RGS9BP regulator of G protein signaling 9 binding protein 2 2
MIRT637783 OLA1 Obg like ATPase 1 2 2
MIRT637920 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT638238 SLC1A5 solute carrier family 1 member 5 2 2
MIRT638444 PLXDC2 plexin domain containing 2 2 2
MIRT639765 GPR45 G protein-coupled receptor 45 2 2
MIRT640437 ERVMER34-1 endogenous retrovirus group MER34 member 1, envelope 2 2
MIRT643006 ZNF829 zinc finger protein 829 2 2
MIRT644233 SLC35E3 solute carrier family 35 member E3 2 2
MIRT644661 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT644957 ATP6AP1L ATPase H+ transporting accessory protein 1 like 2 2
MIRT645086 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT645256 DFFA DNA fragmentation factor subunit alpha 2 2
MIRT645861 GBP6 guanylate binding protein family member 6 2 2
MIRT645987 ACP6 acid phosphatase 6, lysophosphatidic 2 2
MIRT646502 FAM217B family with sequence similarity 217 member B 2 2
MIRT646811 COX19 COX19, cytochrome c oxidase assembly factor 2 2
MIRT647706 NFX1 nuclear transcription factor, X-box binding 1 2 2
MIRT649657 TEP1 telomerase associated protein 1 2 2
MIRT650550 YIPF4 Yip1 domain family member 4 2 2
MIRT650785 GSR glutathione-disulfide reductase 2 2
MIRT651461 XIAP X-linked inhibitor of apoptosis 2 2
MIRT652098 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT654117 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT658901 DPY19L4 dpy-19 like 4 2 2
MIRT659370 CREG2 cellular repressor of E1A stimulated genes 2 2 2
MIRT662537 MTAP methylthioadenosine phosphorylase 2 2
MIRT662617 MCM8 minichromosome maintenance 8 homologous recombination repair factor 2 2
MIRT663491 IYD iodotyrosine deiodinase 2 2
MIRT663899 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT664552 MKI67IP nucleolar protein interacting with the FHA domain of MKI67 1 1
MIRT664582 HSD17B12 hydroxysteroid 17-beta dehydrogenase 12 2 2
MIRT664953 PTCD3 pentatricopeptide repeat domain 3 2 2
MIRT665193 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 2 2
MIRT665446 WDR17 WD repeat domain 17 2 2
MIRT665894 TCEANC2 transcription elongation factor A N-terminal and central domain containing 2 2 2
MIRT666480 SBNO1 strawberry notch homolog 1 2 2
MIRT666514 RNF170 ring finger protein 170 2 2
MIRT666692 RBM23 RNA binding motif protein 23 2 2
MIRT666791 PSMD1 proteasome 26S subunit, non-ATPase 1 2 2
MIRT667453 MAPK14 mitogen-activated protein kinase 14 2 2
MIRT667553 LRAT lecithin retinol acyltransferase 2 4
MIRT667744 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT668080 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT668114 GK5 glycerol kinase 5 (putative) 2 2
MIRT668501 ESYT2 extended synaptotagmin 2 2 2
MIRT668942 CNKSR3 CNKSR family member 3 2 2
MIRT670408 ELP2 elongator acetyltransferase complex subunit 2 2 2
MIRT671134 CD226 CD226 molecule 2 2
MIRT671919 PLEKHS1 pleckstrin homology domain containing S1 2 4
MIRT672287 GP2 glycoprotein 2 2 2
MIRT672427 POLR2D RNA polymerase II subunit D 2 2
MIRT672762 UBE2V2 ubiquitin conjugating enzyme E2 V2 2 2
MIRT672923 LRRC2 leucine rich repeat containing 2 2 2
MIRT673150 C1orf50 chromosome 1 open reading frame 50 2 2
MIRT673309 UBE2G2 ubiquitin conjugating enzyme E2 G2 2 2
MIRT673560 PLA2G16 phospholipase A2 group XVI 2 2
MIRT673895 DCTN6 dynactin subunit 6 2 2
MIRT674513 PRR23A proline rich 23A 2 2
MIRT674614 RBBP4 RB binding protein 4, chromatin remodeling factor 2 2
MIRT674747 SLC16A1 solute carrier family 16 member 1 2 2
MIRT675693 PIWIL1 piwi like RNA-mediated gene silencing 1 2 2
MIRT675890 SNAP29 synaptosome associated protein 29 2 2
MIRT685271 KIAA1143 KIAA1143 2 2
MIRT686057 KCNA7 potassium voltage-gated channel subfamily A member 7 2 2
MIRT693886 C3orf62 chromosome 3 open reading frame 62 2 2
MIRT695594 TMEM199 transmembrane protein 199 2 2
MIRT696592 ORMDL2 ORMDL sphingolipid biosynthesis regulator 2 2 2
MIRT698041 TRPM7 transient receptor potential cation channel subfamily M member 7 2 2
MIRT699907 RUNDC1 RUN domain containing 1 2 2
MIRT706608 CYB5B cytochrome b5 type B 2 2
MIRT706628 PNPT1 polyribonucleotide nucleotidyltransferase 1 2 2
MIRT706640 NCBP2 nuclear cap binding protein subunit 2 2 2
MIRT706676 COL13A1 collagen type XIII alpha 1 chain 2 2
MIRT706723 RFK riboflavin kinase 2 2
MIRT706857 MAFF MAF bZIP transcription factor F 2 2
MIRT706891 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 2 2
MIRT706958 FANCC Fanconi anemia complementation group C 2 2
MIRT706976 XPO5 exportin 5 2 2
MIRT707010 RRP36 ribosomal RNA processing 36 2 2
MIRT707028 ACTR5 ARP5 actin related protein 5 homolog 2 2
MIRT707068 MED29 mediator complex subunit 29 2 2
MIRT713253 ZFP30 ZFP30 zinc finger protein 2 2
MIRT719130 NR2F6 nuclear receptor subfamily 2 group F member 6 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-6501 Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-6501 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-6501-5p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-6501-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-6501-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-6501-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-6501-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-6501-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-6501-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-6501-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-6501-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-6501-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)

Error report submission