pre-miRNA Information
pre-miRNA hsa-mir-1303   
Genomic Coordinates chr5: 154685776 - 154685861
Synonyms MIRN1303, hsa-mir-1303, MIR1303
Description Homo sapiens miR-1303 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-1303
Sequence 52| UUUAGAGACGGGGUCUUGCUCU |73
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 5 + 154685830 23291724, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs370437195 6 dbSNP
rs1195001383 7 dbSNP
rs546614687 8 dbSNP
rs762579883 9 dbSNP
rs766041486 10 dbSNP
rs751079975 12 dbSNP
rs888516744 13 dbSNP
rs566454487 14 dbSNP
rs766973220 15 dbSNP
rs1474274822 17 dbSNP
rs753222192 18 dbSNP
rs1230907999 19 dbSNP
rs756552638 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol LMOD3   
Synonyms NEM10
Description leiomodin 3
Transcript NM_198271   
Expression
Putative miRNA Targets on LMOD3
3'UTR of LMOD3
(miRNA target sites are highlighted)
>LMOD3|NM_198271|3'UTR
   1 GAGGCAACAGAGCCATCTAGAAGAACAAGAAATGGAAATAGTGACTCTTGGATTACAGCATGGAGACTATGTCAGCAGCA
  81 ATACTTTAGGATCCACGTGGCAGAACTGGAAACAATGCTACCATCTGATAAGGGTATTTGTAAAAGGCAGAATGTTTGGG
 161 CCATGAAGAAGTAGGGGCTGAAGAGGAAGGTGGAAGGAGATAAAATATAATATTTAGAGGCAATATTTTCTACTTGCAAT
 241 CAATTTGAGTGACTCAGGTGAAATTTAGAGTCATATTTCCCGAAGCAGAAGTTAAAGAAAATTTTTTAAACATTTGCTTT
 321 ATTATTGTTTTCTTCTGGTAAATAATAAATATAACAGAAGTGTTAACTATTGTATTCCCATTTTTTTCTCCTTCCATCTC
 401 TTCTGCGGTAATTCATCACATAG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ucUCG--UUCUGGGGCAGAGAUUu 5'
            ||:  ||||   : |:|:||| 
Target 5' gaAGTTAAAGAAAAT-TTTTTAAa 3'
288 - 310 113.00 -5.60
2
miRNA  3' ucucguucuGGGGCAGAGAuuu 5'
                   ::|| |||||   
Target 5' tttttctccTTCCATCTCTtct 3'
383 - 404 109.00 -7.92
3
miRNA  3' ucUCGUUCUGG-GGCAGA-GAUUu 5'
            | ||| :|: || |||  ||| 
Target 5' gaAACAATGCTACCATCTGATAAg 3'
109 - 132 96.00 -6.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1180899 15 ClinVar
1188646 255 ClinVar
COSN28616811 15 COSMIC
COSN30154252 23 COSMIC
COSN31605379 65 COSMIC
COSN19664650 96 COSMIC
COSN31592768 117 COSMIC
COSN28613895 152 COSMIC
COSN30722780 153 COSMIC
COSN30526774 154 COSMIC
COSN30172108 217 COSMIC
COSN31596557 271 COSMIC
COSN31566143 303 COSMIC
COSN31583377 332 COSMIC
COSN31549891 405 COSMIC
COSN26505394 407 COSMIC
COSN1958933 417 COSMIC
COSN20090835 464 COSMIC
COSN5865614 524 COSMIC
COSN30164577 533 COSMIC
COSN20098623 838 COSMIC
COSN27237493 839 COSMIC
COSN28201250 1310 COSMIC
COSN23735658 1570 COSMIC
COSN21760012 1670 COSMIC
COSN6774543 1749 COSMIC
COSN29938147 1806 COSMIC
COSN26077114 1900 COSMIC
COSN32174316 2173 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1421353979 2 dbSNP
rs756451308 3 dbSNP
rs1305895031 5 dbSNP
rs1476424806 9 dbSNP
rs750758554 12 dbSNP
rs60474520 15 dbSNP
rs776195983 17 dbSNP
rs1440868809 23 dbSNP
rs759211507 26 dbSNP
rs1265255254 29 dbSNP
rs921555866 32 dbSNP
rs1334054330 40 dbSNP
rs974062060 47 dbSNP
rs575145635 51 dbSNP
rs369054587 61 dbSNP
rs1412696059 64 dbSNP
rs1459168062 66 dbSNP
rs376972659 68 dbSNP
rs1423084602 69 dbSNP
rs1170592267 70 dbSNP
rs77192792 81 dbSNP
rs959581777 82 dbSNP
rs1190040211 84 dbSNP
rs1416224301 88 dbSNP
rs1389746205 94 dbSNP
rs72924865 96 dbSNP
rs1004725624 97 dbSNP
rs950552103 102 dbSNP
rs1484432537 108 dbSNP
rs1238480289 117 dbSNP
rs1297190028 121 dbSNP
rs1209949843 122 dbSNP
rs553024582 126 dbSNP
rs1397484889 141 dbSNP
rs1291186386 148 dbSNP
rs1131960 152 dbSNP
rs1219119466 158 dbSNP
rs538734354 169 dbSNP
rs1280040580 172 dbSNP
rs905783948 174 dbSNP
rs1044323384 176 dbSNP
rs1250893168 183 dbSNP
rs1026475115 194 dbSNP
rs997235035 199 dbSNP
rs1011161648 207 dbSNP
rs1475104918 214 dbSNP
rs1275378070 215 dbSNP
rs892806516 217 dbSNP
rs1340905757 220 dbSNP
rs1294930241 225 dbSNP
rs771452824 232 dbSNP
rs573305843 234 dbSNP
rs1379546969 237 dbSNP
rs1359294363 239 dbSNP
rs934418706 241 dbSNP
rs912342568 242 dbSNP
rs541781019 253 dbSNP
rs188468021 255 dbSNP
rs185272458 258 dbSNP
rs567970228 267 dbSNP
rs1400394559 270 dbSNP
rs1279938997 273 dbSNP
rs1051901 281 dbSNP
rs112424917 282 dbSNP
rs1312894363 301 dbSNP
rs1370089260 302 dbSNP
rs568745241 303 dbSNP
rs1278488995 308 dbSNP
rs1485517101 318 dbSNP
rs760415822 330 dbSNP
rs1217816141 346 dbSNP
rs1265880094 350 dbSNP
rs908552470 351 dbSNP
rs1186485502 352 dbSNP
rs1425785820 355 dbSNP
rs1414903287 357 dbSNP
rs1434420295 357 dbSNP
rs1045976513 362 dbSNP
rs1394102629 367 dbSNP
rs1181660710 368 dbSNP
rs552178550 371 dbSNP
rs1299791028 372 dbSNP
rs1343263707 376 dbSNP
rs1429903811 378 dbSNP
rs1254569273 380 dbSNP
rs961059709 396 dbSNP
rs1482439974 398 dbSNP
rs990794787 400 dbSNP
rs532081677 406 dbSNP
rs781301892 407 dbSNP
rs1286757489 419 dbSNP
rs1315537303 420 dbSNP
rs969871170 425 dbSNP
rs1469362570 426 dbSNP
rs1191197105 427 dbSNP
rs878904745 429 dbSNP
rs1022796108 432 dbSNP
rs560202570 435 dbSNP
rs892772561 438 dbSNP
rs547168838 444 dbSNP
rs1031740902 446 dbSNP
rs755246117 451 dbSNP
rs1405474426 456 dbSNP
rs998555760 456 dbSNP
rs1438709552 457 dbSNP
rs1323959227 475 dbSNP
rs1370407239 488 dbSNP
rs530313492 491 dbSNP
rs1050873726 496 dbSNP
rs932768016 497 dbSNP
rs1371556200 501 dbSNP
rs1223581874 505 dbSNP
rs751805105 511 dbSNP
rs951036335 517 dbSNP
rs1337562796 519 dbSNP
rs1409201376 526 dbSNP
rs1212419399 527 dbSNP
rs1271949852 546 dbSNP
rs189475350 561 dbSNP
rs1183477533 566 dbSNP
rs1230837623 574 dbSNP
rs544902955 577 dbSNP
rs575919806 579 dbSNP
rs780213787 593 dbSNP
rs1415768066 594 dbSNP
rs1459790327 595 dbSNP
rs1164178530 601 dbSNP
rs941582473 603 dbSNP
rs1466219033 610 dbSNP
rs908819776 624 dbSNP
rs1352972566 628 dbSNP
rs983187534 629 dbSNP
rs1285130446 630 dbSNP
rs1357799725 632 dbSNP
rs939399745 636 dbSNP
rs1293240297 639 dbSNP
rs116497630 640 dbSNP
rs1403943787 644 dbSNP
rs745452054 647 dbSNP
rs980823583 651 dbSNP
rs903105027 653 dbSNP
rs1259317493 655 dbSNP
rs1474115272 658 dbSNP
rs1187062824 661 dbSNP
rs1424254058 662 dbSNP
rs1045538565 666 dbSNP
rs1472561398 670 dbSNP
rs949880991 677 dbSNP
rs969840116 681 dbSNP
rs545397130 684 dbSNP
rs1335136593 685 dbSNP
rs1192463914 694 dbSNP
rs1377604778 695 dbSNP
rs1022765138 696 dbSNP
rs35632514 699 dbSNP
rs140867689 710 dbSNP
rs1312737499 714 dbSNP
rs1341680551 716 dbSNP
rs957497702 718 dbSNP
rs553055887 720 dbSNP
rs542762094 722 dbSNP
rs937985293 725 dbSNP
rs909253466 727 dbSNP
rs1219000078 729 dbSNP
rs1282038871 734 dbSNP
rs1049538594 735 dbSNP
rs1209882486 748 dbSNP
rs998893618 749 dbSNP
rs1448633885 755 dbSNP
rs890800531 759 dbSNP
rs750215948 762 dbSNP
rs1371363231 789 dbSNP
rs1029396041 793 dbSNP
rs929545906 794 dbSNP
rs919521598 795 dbSNP
rs1330939551 800 dbSNP
rs1173391283 805 dbSNP
rs185365776 808 dbSNP
rs554378454 813 dbSNP
rs765150467 816 dbSNP
rs1038531089 820 dbSNP
rs537728395 825 dbSNP
rs569156128 826 dbSNP
rs1325291918 828 dbSNP
rs879030659 838 dbSNP
rs941551436 840 dbSNP
rs1388558903 845 dbSNP
rs887348289 846 dbSNP
rs985884528 848 dbSNP
rs1286423978 854 dbSNP
rs957123167 854 dbSNP
rs35415250 856 dbSNP
rs558226547 856 dbSNP
rs1260976888 857 dbSNP
rs1446438424 857 dbSNP
rs1491014736 857 dbSNP
rs199731409 857 dbSNP
rs200667133 857 dbSNP
rs3839076 857 dbSNP
rs3796213 865 dbSNP
rs1438991478 871 dbSNP
rs928003516 872 dbSNP
rs1462481007 878 dbSNP
rs1391222540 883 dbSNP
rs753335457 904 dbSNP
rs1160404718 908 dbSNP
rs1439652313 910 dbSNP
rs1457141468 924 dbSNP
rs1410360051 926 dbSNP
rs980793121 936 dbSNP
rs948125401 940 dbSNP
rs1337252723 954 dbSNP
rs915349932 955 dbSNP
rs1356953030 957 dbSNP
rs3839077 957 dbSNP
rs777812830 957 dbSNP
rs1189023094 958 dbSNP
rs989939142 961 dbSNP
rs17005359 963 dbSNP
rs1031967086 985 dbSNP
rs1193192164 991 dbSNP
rs1251520886 993 dbSNP
rs1421173817 1001 dbSNP
rs1180089686 1004 dbSNP
rs1207909594 1031 dbSNP
rs747000777 1039 dbSNP
rs145263349 1040 dbSNP
rs532355446 1046 dbSNP
rs1233967516 1050 dbSNP
rs529847294 1053 dbSNP
rs1398185870 1057 dbSNP
rs1389379420 1059 dbSNP
rs1306002258 1061 dbSNP
rs1355896761 1065 dbSNP
rs1040641103 1069 dbSNP
rs567835584 1077 dbSNP
rs1016729125 1078 dbSNP
rs986267930 1084 dbSNP
rs1006097606 1092 dbSNP
rs566792228 1093 dbSNP
rs925710923 1095 dbSNP
rs1434800106 1098 dbSNP
rs551216049 1124 dbSNP
rs1383327883 1125 dbSNP
rs967476458 1127 dbSNP
rs1024217658 1132 dbSNP
rs1467004278 1135 dbSNP
rs13315413 1137 dbSNP
rs1374348945 1146 dbSNP
rs3796214 1147 dbSNP
rs565584106 1148 dbSNP
rs1450901416 1151 dbSNP
rs1390367764 1153 dbSNP
rs1375784203 1162 dbSNP
rs775285413 1164 dbSNP
rs1416405935 1176 dbSNP
rs1310914519 1178 dbSNP
rs1005407873 1180 dbSNP
rs1187591734 1182 dbSNP
rs1296350562 1185 dbSNP
rs1309362385 1192 dbSNP
rs1045026783 1198 dbSNP
rs1225451389 1203 dbSNP
rs887851037 1204 dbSNP
rs1049642385 1208 dbSNP
rs1258018956 1222 dbSNP
rs948094263 1224 dbSNP
rs1213465659 1226 dbSNP
rs993507130 1231 dbSNP
rs13067875 1237 dbSNP
rs771791917 1241 dbSNP
rs190663129 1245 dbSNP
rs1263171786 1250 dbSNP
rs1040357830 1251 dbSNP
rs944927668 1252 dbSNP
rs1436263335 1254 dbSNP
rs758380543 1263 dbSNP
rs1255452823 1265 dbSNP
rs1431337067 1270 dbSNP
rs528484972 1277 dbSNP
rs1364095070 1282 dbSNP
rs559363903 1287 dbSNP
rs1050528453 1293 dbSNP
rs935810462 1294 dbSNP
rs936189175 1300 dbSNP
rs925711783 1308 dbSNP
rs1236835724 1315 dbSNP
rs542698574 1321 dbSNP
rs977688516 1325 dbSNP
rs1312008018 1328 dbSNP
rs955300288 1329 dbSNP
rs922554498 1334 dbSNP
rs763469519 1348 dbSNP
rs1484571081 1352 dbSNP
rs1185416253 1363 dbSNP
rs148476179 1364 dbSNP
rs1228026740 1370 dbSNP
rs1191390263 1373 dbSNP
rs13067673 1380 dbSNP
rs13068879 1385 dbSNP
rs144633600 1387 dbSNP
rs1397072207 1398 dbSNP
rs1005318072 1399 dbSNP
rs561105065 1401 dbSNP
rs1319948679 1403 dbSNP
rs1025797444 1415 dbSNP
rs1034292280 1418 dbSNP
rs1370710549 1422 dbSNP
rs1004142139 1425 dbSNP
rs1301558116 1427 dbSNP
rs184539454 1429 dbSNP
rs1045323580 1430 dbSNP
rs983958700 1431 dbSNP
rs13067525 1432 dbSNP
rs558811458 1433 dbSNP
rs12714751 1434 dbSNP
rs893827061 1435 dbSNP
rs1054252077 1438 dbSNP
rs935417425 1443 dbSNP
rs924046273 1444 dbSNP
rs544444242 1446 dbSNP
rs952688386 1459 dbSNP
rs1470345982 1460 dbSNP
rs1423073411 1461 dbSNP
rs1178715108 1463 dbSNP
rs1405584683 1464 dbSNP
rs1041551574 1465 dbSNP
rs933854539 1466 dbSNP
rs1418401210 1468 dbSNP
rs1165603124 1470 dbSNP
rs71302171 1474 dbSNP
rs1463096129 1493 dbSNP
rs1324059031 1494 dbSNP
rs113940511 1496 dbSNP
rs1443264526 1497 dbSNP
rs1281602965 1499 dbSNP
rs1371666949 1502 dbSNP
rs796754783 1503 dbSNP
rs975328238 1504 dbSNP
rs566458809 1507 dbSNP
rs1336211065 1509 dbSNP
rs1230916713 1511 dbSNP
rs1288596638 1512 dbSNP
rs1438027371 1518 dbSNP
rs1275445980 1520 dbSNP
rs1018870521 1523 dbSNP
rs1230924328 1525 dbSNP
rs1482618564 1536 dbSNP
rs963682825 1538 dbSNP
rs1337718150 1544 dbSNP
rs1267563940 1550 dbSNP
rs71302170 1552 dbSNP
rs1008869061 1555 dbSNP
rs889346012 1556 dbSNP
rs553030363 1557 dbSNP
rs1413213969 1558 dbSNP
rs1434126161 1563 dbSNP
rs1340296833 1569 dbSNP
rs536323445 1572 dbSNP
rs1412229266 1573 dbSNP
rs951144906 1575 dbSNP
rs1350509107 1578 dbSNP
rs904729012 1585 dbSNP
rs1357902250 1586 dbSNP
rs866352210 1587 dbSNP
rs1025853640 1588 dbSNP
rs1407819005 1597 dbSNP
rs71302169 1598 dbSNP
rs1392399474 1599 dbSNP
rs1433647935 1600 dbSNP
rs1252768762 1601 dbSNP
rs982294547 1601 dbSNP
rs970872466 1609 dbSNP
rs1341118634 1610 dbSNP
rs1457209045 1612 dbSNP
rs1415479793 1613 dbSNP
rs1161196642 1614 dbSNP
rs1186784686 1616 dbSNP
rs1472883082 1617 dbSNP
rs1475788193 1618 dbSNP
rs1023819217 1619 dbSNP
rs1012466656 1620 dbSNP
rs894091377 1621 dbSNP
rs1032327202 1622 dbSNP
rs1377694402 1623 dbSNP
rs999975665 1624 dbSNP
rs1210722906 1625 dbSNP
rs1356009859 1626 dbSNP
rs1432298725 1627 dbSNP
rs902591419 1628 dbSNP
rs1052290582 1629 dbSNP
rs1230722765 1630 dbSNP
rs917020313 1631 dbSNP
rs77742285 1632 dbSNP
rs1195398227 1633 dbSNP
rs901022630 1634 dbSNP
rs1039610758 1635 dbSNP
rs1332380647 1636 dbSNP
rs1323807090 1637 dbSNP
rs942579094 1637 dbSNP
rs909811978 1638 dbSNP
rs1464870356 1639 dbSNP
rs983800253 1640 dbSNP
rs10529927 1641 dbSNP
rs1157614386 1642 dbSNP
rs1198586144 1642 dbSNP
rs1203358516 1642 dbSNP
rs1207460028 1642 dbSNP
rs1214491940 1642 dbSNP
rs1221913515 1642 dbSNP
rs1232252720 1642 dbSNP
rs1236735290 1642 dbSNP
rs1255130656 1642 dbSNP
rs1266274061 1642 dbSNP
rs1275194324 1642 dbSNP
rs1279981856 1642 dbSNP
rs1287666044 1642 dbSNP
rs1305187308 1642 dbSNP
rs1315590529 1642 dbSNP
rs1327405506 1642 dbSNP
rs1328492134 1642 dbSNP
rs1329260444 1642 dbSNP
rs1352723560 1642 dbSNP
rs1363864736 1642 dbSNP
rs1364790595 1642 dbSNP
rs1385921157 1642 dbSNP
rs1387199553 1642 dbSNP
rs1388115157 1642 dbSNP
rs1403015160 1642 dbSNP
rs1431731394 1642 dbSNP
rs1436958187 1642 dbSNP
rs1461509548 1642 dbSNP
rs1464520759 1642 dbSNP
rs1471425994 1642 dbSNP
rs752807599 1642 dbSNP
rs992475701 1645 dbSNP
rs937018276 1648 dbSNP
rs12496490 1649 dbSNP
rs1251624729 1651 dbSNP
rs1439930253 1666 dbSNP
rs976307509 1667 dbSNP
rs1161126226 1669 dbSNP
rs1457662967 1671 dbSNP
rs927186165 1677 dbSNP
rs1166438466 1679 dbSNP
rs918308218 1682 dbSNP
rs1366244696 1686 dbSNP
rs984481996 1692 dbSNP
rs567381809 1693 dbSNP
rs1025863164 1697 dbSNP
rs970841262 1702 dbSNP
rs1307256499 1708 dbSNP
rs962081005 1709 dbSNP
rs1314906285 1714 dbSNP
rs116430467 1716 dbSNP
rs1008841279 1718 dbSNP
rs1251481301 1724 dbSNP
rs1203433417 1726 dbSNP
rs531141434 1727 dbSNP
rs1486267243 1736 dbSNP
rs1029198683 1740 dbSNP
rs1253401447 1741 dbSNP
rs879058482 1742 dbSNP
rs958282384 1743 dbSNP
rs145955194 1746 dbSNP
rs1374430223 1747 dbSNP
rs1268041979 1755 dbSNP
rs1167708765 1763 dbSNP
rs552044792 1768 dbSNP
rs1375882412 1770 dbSNP
rs563727273 1785 dbSNP
rs1346419301 1793 dbSNP
rs867763388 1796 dbSNP
rs1395516863 1802 dbSNP
rs369060371 1803 dbSNP
rs997612031 1808 dbSNP
rs377157970 1809 dbSNP
rs1274315525 1814 dbSNP
rs1349073038 1816 dbSNP
rs895554196 1822 dbSNP
rs9816032 1825 dbSNP
rs78662166 1826 dbSNP
rs1186580655 1829 dbSNP
rs1263289884 1832 dbSNP
rs1447256550 1836 dbSNP
rs926904667 1839 dbSNP
rs367963445 1849 dbSNP
rs1416116949 1851 dbSNP
rs1395408035 1854 dbSNP
rs888361910 1855 dbSNP
rs1048797812 1857 dbSNP
rs1358488804 1870 dbSNP
rs1404384202 1871 dbSNP
rs1454289602 1872 dbSNP
rs918532141 1879 dbSNP
rs1173268546 1880 dbSNP
rs929634284 1889 dbSNP
rs1390964869 1890 dbSNP
rs1433104097 1893 dbSNP
rs918261339 1909 dbSNP
rs776958048 1910 dbSNP
rs1453913060 1911 dbSNP
rs73835726 1912 dbSNP
rs142453116 1914 dbSNP
rs370247996 1915 dbSNP
rs1312102536 1920 dbSNP
rs1217187589 1944 dbSNP
rs11715138 1963 dbSNP
rs572794340 1984 dbSNP
rs987557006 1986 dbSNP
rs1207634558 1993 dbSNP
rs1253230634 2002 dbSNP
rs1455350948 2005 dbSNP
rs1189221979 2010 dbSNP
rs4393910 2011 dbSNP
rs1419557912 2013 dbSNP
rs958458439 2017 dbSNP
rs1161229355 2024 dbSNP
rs1948935 2026 dbSNP
rs1000213784 2028 dbSNP
rs969358209 2030 dbSNP
rs564966039 2031 dbSNP
rs867322642 2033 dbSNP
rs192492011 2037 dbSNP
rs1438938354 2039 dbSNP
rs1395568 2040 dbSNP
rs186804776 2059 dbSNP
rs1278661879 2064 dbSNP
rs966704401 2065 dbSNP
rs183582961 2072 dbSNP
rs1030732428 2075 dbSNP
rs1209486016 2080 dbSNP
rs1827977 2086 dbSNP
rs111801010 2088 dbSNP
rs536260150 2092 dbSNP
rs1452940418 2093 dbSNP
rs376648929 2098 dbSNP
rs1006694193 2104 dbSNP
rs1245862134 2106 dbSNP
rs1480844189 2107 dbSNP
rs888279474 2112 dbSNP
rs1048279399 2113 dbSNP
rs1249525919 2115 dbSNP
rs1268223260 2124 dbSNP
rs1158494640 2129 dbSNP
rs1418718300 2131 dbSNP
rs557018581 2132 dbSNP
rs1340961307 2135 dbSNP
rs897094911 2136 dbSNP
rs1046045227 2139 dbSNP
rs1349148839 2140 dbSNP
rs145099471 2158 dbSNP
rs1293324374 2160 dbSNP
rs1357873323 2161 dbSNP
rs1226201997 2168 dbSNP
rs1288706150 2177 dbSNP
rs1373783150 2179 dbSNP
rs1170650003 2180 dbSNP
rs905622474 2181 dbSNP
rs868220757 2182 dbSNP
rs916298895 2183 dbSNP
rs1054806624 2185 dbSNP
rs1473827868 2186 dbSNP
rs1180272238 2196 dbSNP
rs1048508859 2197 dbSNP
rs986353230 2203 dbSNP
rs1473999781 2206 dbSNP
rs1238533054 2207 dbSNP
rs1170837892 2208 dbSNP
rs1187941176 2208 dbSNP
rs1484401823 2220 dbSNP
rs1276161103 2223 dbSNP
rs1429618908 2233 dbSNP
rs13089686 2234 dbSNP
rs1190777851 2235 dbSNP
rs1206085849 2235 dbSNP
rs1211439706 2235 dbSNP
rs1230213381 2235 dbSNP
rs1272165734 2235 dbSNP
rs1280659771 2235 dbSNP
rs1283154673 2235 dbSNP
rs1314033476 2235 dbSNP
rs1341229576 2235 dbSNP
rs1341669268 2235 dbSNP
rs1362196604 2235 dbSNP
rs1440683744 2235 dbSNP
rs1445166785 2235 dbSNP
rs1306593992 2236 dbSNP
rs4356824 2236 dbSNP
rs1173595976 2237 dbSNP
rs1332897476 2237 dbSNP
rs1341923884 2237 dbSNP
rs1449247019 2237 dbSNP
rs376179501 2238 dbSNP
rs936834014 2242 dbSNP
rs1345305410 2245 dbSNP
rs931019951 2246 dbSNP
rs918488535 2248 dbSNP
rs925454087 2249 dbSNP
rs71302168 2250 dbSNP
rs967345391 2256 dbSNP
rs4561843 2259 dbSNP
rs1342742703 2267 dbSNP
rs943873292 2268 dbSNP
rs1379697877 2270 dbSNP
rs7431424 2278 dbSNP
rs1292598541 2281 dbSNP
rs912356867 2282 dbSNP
rs1246418179 2284 dbSNP
rs1350801361 2294 dbSNP
rs1464660853 2297 dbSNP
rs747029284 2297 dbSNP
rs1199999950 2299 dbSNP
rs371478999 2302 dbSNP
rs1477304043 2307 dbSNP
rs953434384 2308 dbSNP
rs148158933 2309 dbSNP
rs1309956154 2311 dbSNP
rs1458366238 2316 dbSNP
rs192970421 2324 dbSNP
rs1410619496 2326 dbSNP
rs1354124507 2327 dbSNP
rs1441227378 2329 dbSNP
rs968781210 2331 dbSNP
rs1395567 2333 dbSNP
rs1280068159 2344 dbSNP
rs1415061151 2349 dbSNP
rs989021101 2354 dbSNP
rs1266369402 2355 dbSNP
rs1474520263 2359 dbSNP
rs529246301 2372 dbSNP
rs1182230794 2373 dbSNP
rs1269854534 2374 dbSNP
rs1450254837 2378 dbSNP
rs1035829110 2380 dbSNP
rs1480055020 2381 dbSNP
rs1236074956 2382 dbSNP
rs1332246876 2383 dbSNP
rs1301172096 2384 dbSNP
rs1031984049 2385 dbSNP
rs1272337494 2401 dbSNP
rs1001718911 2402 dbSNP
rs1371837848 2402 dbSNP
rs1410620748 2402 dbSNP
rs373817195 2402 dbSNP
rs1407963964 2411 dbSNP
rs1286489272 2416 dbSNP
rs1006322632 2417 dbSNP
rs1245723691 2419 dbSNP
rs187876420 2429 dbSNP
rs573669086 2432 dbSNP
rs1354600096 2446 dbSNP
rs1331176613 2448 dbSNP
rs1027216528 2453 dbSNP
rs1288952281 2463 dbSNP
rs994055418 2468 dbSNP
rs1275865468 2469 dbSNP
rs7629932 2472 dbSNP
rs770159962 2480 dbSNP
rs1250349431 2482 dbSNP
rs1296661723 2488 dbSNP
rs1438884067 2490 dbSNP
rs1046308286 2493 dbSNP
rs1189099955 2495 dbSNP
rs111847692 2497 dbSNP
rs1350772174 2502 dbSNP
rs376934876 2506 dbSNP
rs1457137525 2513 dbSNP
rs1037109074 2516 dbSNP
rs1325689494 2516 dbSNP
rs943924296 2517 dbSNP
rs1013169373 2519 dbSNP
rs1460243571 2523 dbSNP
rs891055712 2525 dbSNP
rs1160630021 2533 dbSNP
rs1413044937 2541 dbSNP
rs894835518 2546 dbSNP
rs1417998924 2547 dbSNP
rs1396676449 2550 dbSNP
rs1315013131 2560 dbSNP
rs1338908310 2577 dbSNP
rs1405174190 2581 dbSNP
rs1049527201 2582 dbSNP
rs1054771478 2584 dbSNP
rs1274545237 2588 dbSNP
rs1483897252 2594 dbSNP
rs1192516080 2595 dbSNP
rs1488617946 2600 dbSNP
rs1422839571 2601 dbSNP
rs538025065 2610 dbSNP
rs936403309 2614 dbSNP
rs569140832 2618 dbSNP
rs978908214 2620 dbSNP
rs1042946649 2627 dbSNP
rs1304633677 2641 dbSNP
rs372758605 2650 dbSNP
rs1321472320 2660 dbSNP
rs780124529 2667 dbSNP
rs371756674 2671 dbSNP
rs945598230 2684 dbSNP
rs139035345 2700 dbSNP
rs1226632158 2702 dbSNP
rs573130635 2705 dbSNP
rs960253794 2711 dbSNP
rs1313265787 2712 dbSNP
rs1035966793 2714 dbSNP
rs976334624 2722 dbSNP
rs1208894254 2726 dbSNP
rs756950189 2738 dbSNP
rs1187678444 2739 dbSNP
rs558613480 2739 dbSNP
rs1221104985 2742 dbSNP
rs1371962519 2743 dbSNP
rs183737279 2750 dbSNP
rs1015185783 2758 dbSNP
rs3772983 2769 dbSNP
rs1049666894 2770 dbSNP
rs932473785 2779 dbSNP
rs1433220440 2781 dbSNP
rs1288614767 2783 dbSNP
rs1289899923 2786 dbSNP
rs903644698 2793 dbSNP
rs1453693465 2795 dbSNP
rs573672663 2802 dbSNP
rs556718494 2807 dbSNP
rs952224798 2808 dbSNP
rs1342883968 2809 dbSNP
rs1026432153 2822 dbSNP
rs972942116 2824 dbSNP
rs756266072 2829 dbSNP
rs961195583 2830 dbSNP
rs1177646450 2834 dbSNP
rs1214656499 2843 dbSNP
rs947463403 2843 dbSNP
rs1024822342 2848 dbSNP
rs1189314688 2850 dbSNP
rs1394075204 2851 dbSNP
rs1159975276 2854 dbSNP
rs988790359 2855 dbSNP
rs928865795 2863 dbSNP
rs1013466540 2864 dbSNP
rs1459755392 2866 dbSNP
rs970720911 2868 dbSNP
rs1345398246 2873 dbSNP
rs1248414227 2874 dbSNP
rs895098806 2891 dbSNP
rs920073685 2900 dbSNP
rs1033290735 2903 dbSNP
rs1204419409 2906 dbSNP
rs1348096808 2909 dbSNP
rs374357859 2912 dbSNP
rs903594271 2920 dbSNP
rs1257729758 2921 dbSNP
rs1323213146 2924 dbSNP
rs191421560 2930 dbSNP
rs1290827286 2932 dbSNP
rs558298472 2933 dbSNP
rs534898341 2945 dbSNP
rs945498053 2946 dbSNP
rs764055688 2947 dbSNP
rs565987453 2949 dbSNP
rs1040593714 2953 dbSNP
rs549255191 2964 dbSNP
rs1176744916 2967 dbSNP
rs1414792302 2969 dbSNP
rs535778829 2970 dbSNP
rs570009450 2972 dbSNP
rs17005358 2973 dbSNP
rs752241817 2975 dbSNP
rs1369312609 2978 dbSNP
rs985188050 2982 dbSNP
rs930668305 2985 dbSNP
rs996740974 2998 dbSNP
rs1380862237 3002 dbSNP
rs1226280427 3004 dbSNP
rs767345957 3005 dbSNP
rs972190547 3006 dbSNP
rs961164278 3008 dbSNP
rs1207138765 3014 dbSNP
rs1043541557 3016 dbSNP
rs1437233434 3022 dbSNP
rs1203866597 3027 dbSNP
rs1238169376 3030 dbSNP
rs1473868093 3031 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084044. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep3 ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' ucUCGUUCUGGGGCAGAGAUuu 5'
            :|::| ||||||||||||  
Target 5' auGGUGAAACCCCGUCUCUAu- 3'
16 - 36
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084044
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep3
Location of target site ENST00000420581.2 | 3UTR | ACCAGCCUGGCCAACAUGGUGAAACCCCGUCUCUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38226 Liver fibrosis -0.522 7.6e-3 -0.243 1.4e-1 21 Click to see details
GSE28260 Renal cortex and medulla 0.574 2.0e-2 0.670 6.1e-3 13 Click to see details
GSE42095 Differentiated embryonic stem cells 0.177 2.1e-1 0.171 2.2e-1 23 Click to see details
GSE28544 Breast cancer 0.123 2.8e-1 0.146 2.5e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells 0.081 3.5e-1 0.021 4.6e-1 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.057 3.9e-1 0.073 3.6e-1 25 Click to see details
GSE32688 Pancreatic cancer 0.042 4.1e-1 0.049 3.9e-1 32 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
186 hsa-miR-1303 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT035871 SOAT1 sterol O-acyltransferase 1 1 1
MIRT035872 FHOD3 formin homology 2 domain containing 3 1 1
MIRT035873 RPL7A ribosomal protein L7a 1 1
MIRT035874 NCAPD2 non-SMC condensin I complex subunit D2 1 1
MIRT035875 RPS8 ribosomal protein S8 1 1
MIRT035876 AHNAK AHNAK nucleoprotein 1 1
MIRT035877 ACTB actin beta 1 1
MIRT035878 DEF8 differentially expressed in FDCP 8 homolog 1 1
MIRT035879 MET MET proto-oncogene, receptor tyrosine kinase 1 1
MIRT035880 MED13 mediator complex subunit 13 1 1
MIRT035881 FAT3 FAT atypical cadherin 3 1 1
MIRT035882 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT035883 RPS16 ribosomal protein S16 1 1
MIRT035884 CDK6 cyclin dependent kinase 6 1 1
MIRT035885 GEMIN5 gem nuclear organelle associated protein 5 1 1
MIRT035886 PITRM1 pitrilysin metallopeptidase 1 1 1
MIRT035887 PRRC2A proline rich coiled-coil 2A 1 1
MIRT035888 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT035889 MLLT6 MLLT6, PHD finger containing 1 1
MIRT035890 EIF3I eukaryotic translation initiation factor 3 subunit I 1 1
MIRT035891 FASN fatty acid synthase 1 1
MIRT035892 LEPREL4 prolyl 3-hydroxylase family member 4 (non-enzymatic) 1 1
MIRT035893 HSCB HscB mitochondrial iron-sulfur cluster cochaperone 1 1
MIRT035894 PSME4 proteasome activator subunit 4 1 1
MIRT035895 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT035896 ZNF264 zinc finger protein 264 1 1
MIRT035897 HYLS1 HYLS1, centriolar and ciliogenesis associated 1 1
MIRT035898 USP54 ubiquitin specific peptidase 54 1 1
MIRT035899 L1TD1 LINE1 type transposase domain containing 1 1 1
MIRT035900 OR51E2 olfactory receptor family 51 subfamily E member 2 1 1
MIRT053762 CLDN18 claudin 18 3 1
MIRT060730 RPS3 ribosomal protein S3 2 2
MIRT083986 RAB22A RAB22A, member RAS oncogene family 2 2
MIRT098550 TBPL1 TATA-box binding protein like 1 2 6
MIRT134983 TWF1 twinfilin actin binding protein 1 2 4
MIRT136956 FNDC3A fibronectin type III domain containing 3A 2 2
MIRT222065 PURB purine rich element binding protein B 2 2
MIRT239574 UBN2 ubinuclein 2 2 4
MIRT261820 BUB3 BUB3, mitotic checkpoint protein 2 2
MIRT264698 C11ORF57 chromosome 11 open reading frame 57 2 4
MIRT308476 GXYLT2 glucoside xylosyltransferase 2 2 2
MIRT377481 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT442304 NEU3 neuraminidase 3 2 2
MIRT446083 SLC30A10 solute carrier family 30 member 10 2 2
MIRT449606 PRPF4 pre-mRNA processing factor 4 2 2
MIRT453767 NUCB1 nucleobindin 1 2 10
MIRT455603 SRSF3 serine and arginine rich splicing factor 3 2 2
MIRT455913 KIF2C kinesin family member 2C 2 2
MIRT460091 ZYG11B zyg-11 family member B, cell cycle regulator 2 4
MIRT460866 UBE2S ubiquitin conjugating enzyme E2 S 2 2
MIRT461339 NUP133 nucleoporin 133 2 2
MIRT463769 YOD1 YOD1 deubiquitinase 2 2
MIRT466368 THAP1 THAP domain containing 1 2 4
MIRT467168 SPTY2D1 SPT2 chromatin protein domain containing 1 2 2
MIRT468703 SDHD succinate dehydrogenase complex subunit D 2 2
MIRT469122 RNF126 ring finger protein 126 2 2
MIRT472426 NCBP2 nuclear cap binding protein subunit 2 2 4
MIRT479420 CDKN1B cyclin dependent kinase inhibitor 1B 2 8
MIRT484260 FAM177A1 family with sequence similarity 177 member A1 2 2
MIRT485468 IL6ST interleukin 6 signal transducer 2 10
MIRT490237 H2AFZ H2A histone family member Z 2 6
MIRT491002 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT492127 SUMO2 small ubiquitin-like modifier 2 2 2
MIRT499169 RBPJL recombination signal binding protein for immunoglobulin kappa J region like 2 2
MIRT499825 PCSK9 proprotein convertase subtilisin/kexin type 9 2 8
MIRT501794 NRAS NRAS proto-oncogene, GTPase 2 2
MIRT503441 GINS4 GINS complex subunit 4 2 4
MIRT503688 MAVS mitochondrial antiviral signaling protein 2 5
MIRT506926 IGDCC4 immunoglobulin superfamily DCC subclass member 4 2 6
MIRT511430 HOXA10 homeobox A10 2 6
MIRT512415 LAYN layilin 2 4
MIRT513791 NIPAL3 NIPA like domain containing 3 2 4
MIRT516163 NTMT1 N-terminal Xaa-Pro-Lys N-methyltransferase 1 2 4
MIRT516513 PARK2 parkin RBR E3 ubiquitin protein ligase 2 2
MIRT516915 HINFP histone H4 transcription factor 2 2
MIRT517102 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 2 2
MIRT517350 NLRP9 NLR family pyrin domain containing 9 2 2
MIRT518019 ABHD15 abhydrolase domain containing 15 2 2
MIRT520945 SRSF10 serine and arginine rich splicing factor 10 2 2
MIRT525250 RNF213 ring finger protein 213 2 2
MIRT530634 PPIC peptidylprolyl isomerase C 2 4
MIRT530671 CHRNB1 cholinergic receptor nicotinic beta 1 subunit 2 4
MIRT531563 ILDR1 immunoglobulin like domain containing receptor 1 2 2
MIRT538205 CYR61 cysteine rich angiogenic inducer 61 2 2
MIRT538419 COLEC10 collectin subfamily member 10 2 2
MIRT541964 ZNF485 zinc finger protein 485 2 2
MIRT543088 KNSTRN kinetochore localized astrin/SPAG5 binding protein 2 2
MIRT543257 ZNF662 zinc finger protein 662 2 2
MIRT543589 KIAA1549 KIAA1549 2 2
MIRT543955 RNF20 ring finger protein 20 2 2
MIRT544043 C9orf64 chromosome 9 open reading frame 64 2 4
MIRT548064 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT548240 FBXW7 F-box and WD repeat domain containing 7 2 2
MIRT548442 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 2
MIRT548623 DAZAP1 DAZ associated protein 1 2 4
MIRT548770 COLEC12 collectin subfamily member 12 2 2
MIRT549506 HDDC2 HD domain containing 2 2 4
MIRT551924 AKAP8 A-kinase anchoring protein 8 2 4
MIRT555656 PGRMC1 progesterone receptor membrane component 1 2 2
MIRT556286 MAP3K5 mitogen-activated protein kinase kinase kinase 5 2 2
MIRT557012 HOXD13 homeobox D13 2 4
MIRT563907 CLSPN claspin 2 2
MIRT565527 SON SON DNA binding protein 2 2
MIRT568000 COMMD2 COMM domain containing 2 2 2
MIRT569831 PLA2G16 phospholipase A2 group XVI 2 4
MIRT573905 PARP1 poly(ADP-ribose) polymerase 1 2 2
MIRT616589 KLHL9 kelch like family member 9 2 2
MIRT617137 ZNF556 zinc finger protein 556 2 2
MIRT617400 API5 apoptosis inhibitor 5 2 2
MIRT617455 CCS copper chaperone for superoxide dismutase 2 2
MIRT617799 ZNF793 zinc finger protein 793 2 2
MIRT618190 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT618303 GNE glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase 2 2
MIRT618329 ZNF813 zinc finger protein 813 2 2
MIRT618820 PHF20 PHD finger protein 20 2 2
MIRT619153 PPDPF pancreatic progenitor cell differentiation and proliferation factor 2 2
MIRT619530 ZNF708 zinc finger protein 708 2 2
MIRT619849 KIR3DX1 killer cell immunoglobulin like receptor, three Ig domains X1 2 2
MIRT620806 SLC26A2 solute carrier family 26 member 2 2 2
MIRT621312 YIPF4 Yip1 domain family member 4 2 2
MIRT621358 GUCA1B guanylate cyclase activator 1B 2 2
MIRT621366 ART4 ADP-ribosyltransferase 4 (Dombrock blood group) 2 2
MIRT621547 ZMYM1 zinc finger MYM-type containing 1 2 2
MIRT621883 TAOK1 TAO kinase 1 2 2
MIRT622451 RNF19B ring finger protein 19B 2 2
MIRT623404 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT623587 IPO9 importin 9 2 2
MIRT623974 FAM63A MINDY lysine 48 deubiquitinase 1 2 2
MIRT624086 DPP8 dipeptidyl peptidase 8 2 2
MIRT624108 DNAH10OS dynein axonemal heavy chain 10 opposite strand 2 2
MIRT632486 RNF8 ring finger protein 8 2 2
MIRT634057 PLIN3 perilipin 3 2 2
MIRT634657 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT640682 MCUR1 mitochondrial calcium uniporter regulator 1 2 2
MIRT641242 CENPN centromere protein N 2 2
MIRT642260 ZNF677 zinc finger protein 677 2 2
MIRT642954 RELA RELA proto-oncogene, NF-kB subunit 2 2
MIRT644326 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT644632 ICA1L islet cell autoantigen 1 like 2 2
MIRT645721 POLR3A RNA polymerase III subunit A 2 2
MIRT647850 LYPLA1 lysophospholipase I 2 2
MIRT649281 NEK8 NIMA related kinase 8 2 2
MIRT650038 VHL von Hippel-Lindau tumor suppressor 2 2
MIRT650354 RRP36 ribosomal RNA processing 36 2 2
MIRT651144 ZNF384 zinc finger protein 384 2 2
MIRT651778 UTP6 UTP6, small subunit processome component 2 2
MIRT652576 TLCD2 TLC domain containing 2 2 2
MIRT654621 PTPRJ protein tyrosine phosphatase, receptor type J 2 2
MIRT656023 MYO5A myosin VA 2 2
MIRT656105 MSRB3 methionine sulfoxide reductase B3 2 2
MIRT657749 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT657924 GATSL2 cytosolic arginine sensor for mTORC1 subunit 2 2 2
MIRT658848 DUSP19 dual specificity phosphatase 19 2 2
MIRT659100 DENND6A DENN domain containing 6A 2 2
MIRT659153 DCX doublecortin 2 2
MIRT660870 ADRBK2 G protein-coupled receptor kinase 3 2 2
MIRT661941 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT663577 C10orf32 BLOC-1 related complex subunit 7 2 2
MIRT664625 WDPCP WD repeat containing planar cell polarity effector 2 4
MIRT666562 RHOBTB3 Rho related BTB domain containing 3 2 2
MIRT669992 GPR156 G protein-coupled receptor 156 2 4
MIRT670445 RSBN1L round spermatid basic protein 1 like 2 2
MIRT670853 IFNAR1 interferon alpha and beta receptor subunit 1 2 4
MIRT671942 SPPL3 signal peptide peptidase like 3 2 2
MIRT674269 LMOD3 leiomodin 3 2 2
MIRT674424 MIOX myo-inositol oxygenase 2 4
MIRT674982 ATP5G1 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C1 (subunit 9) 2 2
MIRT675038 BACE2 beta-site APP-cleaving enzyme 2 2 4
MIRT675309 C2orf68 chromosome 2 open reading frame 68 2 2
MIRT675641 TTPAL alpha tocopherol transfer protein like 2 2
MIRT688688 CPS1 carbamoyl-phosphate synthase 1 2 2
MIRT689369 ZNF101 zinc finger protein 101 2 2
MIRT689605 AKAP6 A-kinase anchoring protein 6 2 2
MIRT691715 LARS leucyl-tRNA synthetase 2 2
MIRT695473 TRAT1 T-cell receptor associated transmembrane adaptor 1 2 2
MIRT695530 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 2
MIRT695878 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT696586 ORMDL2 ORMDL sphingolipid biosynthesis regulator 2 2 2
MIRT703007 HEATR5A HEAT repeat containing 5A 2 2
MIRT707942 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 2
MIRT709765 GPR183 G protein-coupled receptor 183 2 2
MIRT710332 ZNF669 zinc finger protein 669 2 2
MIRT713249 ZFP30 ZFP30 zinc finger protein 2 2
MIRT716613 RBM18 RNA binding motif protein 18 2 2
MIRT733414 BAG2 BCL2 associated athanogene 2 2 0
MIRT756135 THSD7A thrombospondin type 1 domain containing 7A 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1 Anthocyanin NULL 145858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Caffeic acid NULL 689043 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Ferulic acid NULL 445858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Hesperidin NULL 10621 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-1 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR myocardial differentiation of mouse ES cells 19521018 2009 down-regulated
miR-1 Sulfonyl-hydrazone-1 (SHZ) NULL NULL Quantitative real-time PCR Murine broblast-derived Induced pluripotent stem cells 21445862 2011 up-regulated
miR-1 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 up-regulated
miR-1 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-1 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-1 Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 Palmitic acid approved 985 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-1 Essential amino acids (EAA) NULL NULL Quantitative real-time PCR skeletal muscle of young adults 19828686 2009 up-regulated
miR-1 Hydrogen peroxide (H2O2) NULL 784 Quantitative real-time PCR Human umbilical vein endothelial cells 21527937 2011 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-1 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-1 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR cardia 22889704 2012 up-regulated
miR-1 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-1 Quinidine approved 441074 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 up-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 down-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR post-infarction rat cardiomyocytes 21220930 2011 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-1 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-1303 Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-1303 Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-1303 Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-1303 Fulvestrant 17756771 NSC719276 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-1303 Rituximab sensitive High Diffuse Large B-Cell Lymphoma cell line (DB, NU-DHL-1, NU-DUL-1, MC-116, SU-DHL-4, SU-DHL-5, FARAGE, HBL-1, OCI-Ly3, OCI-Ly7, OCI-Ly8, OCI-Ly19, RIVA, SU-DHL-8, U2932)
hsa-miR-1303 Etoposide 36462 NSC141540 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-1303 Doxorubicin 31703 NSC123127 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-1303 Vinorelbine 44424639 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-1303 Vincristine 5978 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-1303 Paclitaxel 36314 NSC125973 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-mir-1303 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-1303 Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-mir-1303 Topotecan 60699 NSC609699 approved resistant cell line (W1)
hsa-mir-1303 Androstenedione+Letrozole resistant cell line (MCF-7)
hsa-miR-1303 Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-1303 Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-1303 Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-1303 Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-1303 Palbociclib 5330286 NSC758247 approved resistant tissue (breast cancer)
hsa-miR-1303 Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-1303 Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-1303 Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-1303 Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-1303 Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-1303 Cisplatin 5460033 NSC119875 approved sensitive cell line (MGC-803)
hsa-miR-1303 Oxaliplatin 6857599 NSC266046 approved sensitive cell line (IGROV-1)
hsa-miR-1303 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission