pre-miRNA Information
pre-miRNA hsa-mir-640   
Genomic Coordinates chr19: 19435063 - 19435158
Synonyms MIRN640, hsa-mir-640, MIR640
Description Homo sapiens miR-640 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-640
Sequence 61| AUGAUCCAGGAACCUGCCUCU |81
Evidence Experimental
Experiments RT-PCR
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30153378 1 COSMIC
COSN23015356 12 COSMIC
COSN30513185 19 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs111726405 1 dbSNP
rs765622881 2 dbSNP
rs1249744889 6 dbSNP
rs752995186 12 dbSNP
rs758746736 13 dbSNP
rs918887970 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MAN2A2   
Synonyms MANA2X
Description mannosidase alpha class 2A member 2
Transcript NM_006122   
Expression
Putative miRNA Targets on MAN2A2
3'UTR of MAN2A2
(miRNA target sites are highlighted)
>MAN2A2|NM_006122|3'UTR
   1 GGCTTCTTGTGGCCTGAAGAGAAAGTTCATTCACAGAGACTGCCTCTTAACATGAAGATCATTGGACAAGCCACACGGGT
  81 ATCCCATCCCGATCTGCCTCCCAGAACTGTGACACACTGGGCTCTGCCCTCATTTTCTGTTTATTGCTGCTGCTGTGTTT
 161 TCGGCGCAACCCACAAACCCAGTGATGGGTAAATAGGGCAGACGCCAGTGAGATCAGGGAGAGAAGGCCCTTGGTCAGAG
 241 TGGGCAGTGCCAGGCTCTGCTTTGGGTTGTGAGTGGACACCCAACTGGGCACAGGCTCAGGCACCCATCCTTTTTCCAAA
 321 CAGGGATATAGAAGTGGTGGAAGCAGACAGAAGAGGTAAGGGAGGCTAAGTGGGTAACAGCCCAGCATCAGGGTCACTGT
 401 GGCAACAGCAGGCTCTAGGGGAATCCTGTGGTTATGTAGAGACTCCATGTCCTGGTGTGATGAGCAGGATCAGAGTGACT
 481 CTGGGAGGACAGGGGTGGGGACCCAGAGTTAGCAGTGGGGATGGAGCAGTAGAAGGAATCACTGTTTCTCCTAGGAGTCT
 561 GAAGGCCTCGCTGCTTTCTGTGATGGCTTTGCAGTAAGTGCCGCCTGGCCTGCATGCATTGGCTAACAGGCTGCAGAATG
 641 GCAGGAAGGACTCGCTAGAGATTGTCATGGCCAGAGATCATAGGTCACTTCAGGTAGCAAGACCCCTGGCAAACTGGGCA
 721 CTTGGCCTATGTACTGATTTGTGGGATGGTGGCAGGGGTGTGGGGTCCTTCACCCTGCCTGAATTCTCTTTGGCTTCTGT
 801 GCTCTGTATGCTGCTGTCCCCAAGGGCTCTTTCTTATTATGGCAGGGAGTGGGGATTGGTCCTACTTTCTTTCTCTGGAA
 881 AGGAAAGCCTCCAAGACTCCATGTGCTTGGGCAGCTTGAGAAGGCGTTCAGCACCACGCCTAGCAGGCAGACCTTGAAGC
 961 CTCACCTTTAGTCTATCTGCAGAGGTATTCAGTTCCTGGCACAGGGGACTAGGGGCATGTAGAGTATATGAGGAGGCAGT
1041 ATGGCTGTGCAGGAGCCTTCATTTCAGCTTCAATTAATAGGGAAGAATTTATGATAGCTCTATAGATGCTGAAAAGGTAT
1121 TTCGTAAGATTTAAAATCCATCCCTTATTAAAACTCTTAGTAAATTAAGTCTGGAAAGAAACACCCTAATCTAGATAAAG
1201 GTCTGTTTCAGAAACCAACAGTGATGGCATTCTAAAGAGTCAGACGCCACAGGCATTCCCATTAAAGTCAGAAACTAGCC
1281 AAGGGCAAGCTATTATTCAGCAGTGTCCCGGCACTACTAACCCCTGCAACAAGCCAGATGAGGAACATAAGGAAGAATTA
1361 TAATTGTCATTATTTGTAGACAATAAAACTGCCTACCTGTAAAACCTAAGAATCAACTGAAGACCTGTTAAGAGTATTCT
1441 GTAAGTCAACCCAATGATACACATCATGTTCCTGTCCACATACTGGTTTTCCCCAAATCAGCTGATAAATTCAGTGTAAT
1521 TCCAATGAGATTGAAACTTTGGAATTGACAGTTCTAAAGTGCATTTGGGAGAGTGAATGTGTGAGAACACTAAGACCACT
1601 CTGAACGATGATAATGAGTTGGGGGGTGGACTGCTCGGGGGTGATCCTGCCAGATTCCCAGAGGATTCTCACGCCACCAT
1681 TACCTCACTCAGTGTGACCTGGAGGGGGTCAGACAGACGGGAGAGTCCAGAAACAGACCCAGGGCTACAGGAATTTAGTA
1761 TATGGTAAGAGGGATGTTTTAAGTGGGGAAAAAGGTGGATTATTTAATAAACAGCACTTTTAGACAACTAGCTATCAAAG
1841 CTAGATCTCAGCTGGGTGCGATGGCTCACGCCTGTAATCCCGGCACTTTGGGAGGCCAAGGTGGGTGGATCACTTGAGGT
1921 CAGGAGTTCGAGACCAGCCTGGCCAAGATGGCGAAACCCTGTGTCTACTAAAAATACAAAAACTAGCCAGGAATGGTGGC
2001 GCGCGCCTGTAATCCCAGTTACTTAGGAGGCTGAGGCAGGAGAATCACATCAACCTGGGAGGCGGAGGTTGCAGTGAGCT
2081 TAGATCATGCCACCATGCCACTGCACTCCAGCCTGGGTGACACAGCCAAAAAAAAAACCACTAAGTTAGATCTCTACCTC
2161 ACAGTGTCCATACAAATTAGTTCCAGAGGGAAGATATACCACAAAATTACTCAAAAATTTTTATACCTCTGGTGTGGGAC
2241 GGTCTTTTCTAAACTTTAACATGAGACTTAAAAGATATAATAAGGGAAAAGATAAGCAGATTTCGCAACCAAAAAATATC
2321 GAAAGTCTCTGTGTGATGGAAAACATCAAGGTTAAAACACAAATGACAGATATGGAAGAAAATATTTGCAGCACATAAAA
2401 AAATCAACGAGTACAATTACTTTAGGAGAAAAGCTTGCTTCAGGGTCCTTAGAGAAAGTCACTGGGGCCTGCCAAGCTGC
2481 CACCTAAAGACAAGAGTGAGAGGGCTGAGTTCTTCCAGGTCATCAGAGTTGTTGCTGCCCGTATTAGGCCACACAGTGGA
2561 ACCCCATTTATATCATAGCAGAAGAAATAGGATTATCAATGTGAACTGCTTAGCATGGTGCCTGGTATATACGAGAGCTC
2641 CACAAATGTGAGCTATAATCCTACTAGTAAAGGATGCTAAGCAGTTCCACTGTGGCAGGTGTCATTTGCTAGTAGAATTT
2721 GTAATCAAACAATAGGAGGGGAATCTGTGAACGCCTAGAAAATGAGCAGAATAAAGGATATTATCTTTGGAAGTCTTAAA
2801 AAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ucUCCG--UCCAAGGACCUAGUa 5'
            ||||  ||||   ||||||| 
Target 5' ggAGGCCAAGGTGGGTGGATCAc 3'
1891 - 1913 161.00 -20.90
2
miRNA  3' ucUCCG--UCCAA--------GGACCUAGUa 5'
            ||||  |||||        |:| ||||| 
Target 5' ggAGGCGGAGGTTGCAGTGAGCTTAGATCAt 3'
2058 - 2088 127.00 -16.90
3
miRNA  3' ucUCCGUCCAAGG--AC-CUAGUa 5'
            :|||||   ||  || ||||| 
Target 5' taGGGCAGACGCCAGTGAGATCAg 3'
194 - 217 125.00 -15.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30142969 14 COSMIC
COSN30145284 29 COSMIC
COSN30180058 37 COSMIC
COSN30105815 70 COSMIC
COSN29468006 85 COSMIC
COSN30476838 107 COSMIC
COSN31551965 166 COSMIC
COSN8481836 874 COSMIC
COSN1181958 960 COSMIC
COSN18968054 999 COSMIC
COSN21563432 1124 COSMIC
COSN21650365 1448 COSMIC
COSN25932096 2138 COSMIC
COSN20787600 2305 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs764449466 2 dbSNP
rs1173430808 8 dbSNP
rs1321952172 11 dbSNP
rs1405171365 13 dbSNP
rs775095725 13 dbSNP
rs752093232 14 dbSNP
rs1335841843 16 dbSNP
rs1171052762 26 dbSNP
rs1359229807 30 dbSNP
rs954098969 31 dbSNP
rs757770903 36 dbSNP
rs1367289084 37 dbSNP
rs1191906808 39 dbSNP
rs1228811099 43 dbSNP
rs1302415174 44 dbSNP
rs1479118099 47 dbSNP
rs1343060772 48 dbSNP
rs1221144290 53 dbSNP
rs927318454 55 dbSNP
rs539208561 63 dbSNP
rs1490128049 71 dbSNP
rs1275181194 73 dbSNP
rs117641837 77 dbSNP
rs1340037200 78 dbSNP
rs1038300960 80 dbSNP
rs1219346196 88 dbSNP
rs912671464 89 dbSNP
rs966495477 90 dbSNP
rs752832925 91 dbSNP
rs1404659394 92 dbSNP
rs994025127 97 dbSNP
rs1428370684 99 dbSNP
rs1181788905 100 dbSNP
rs925184766 115 dbSNP
rs1176847394 127 dbSNP
rs575646723 133 dbSNP
rs936642670 137 dbSNP
rs1423251950 138 dbSNP
rs1172213884 151 dbSNP
rs1473078471 152 dbSNP
rs1252254507 153 dbSNP
rs1249710946 154 dbSNP
rs756408535 163 dbSNP
rs1482013835 164 dbSNP
rs777986967 166 dbSNP
rs754038352 167 dbSNP
rs536356585 173 dbSNP
rs1018408898 178 dbSNP
rs1275986473 183 dbSNP
rs963762385 184 dbSNP
rs554682868 186 dbSNP
rs1473617224 189 dbSNP
rs1000916112 200 dbSNP
rs1373196521 202 dbSNP
rs1303958705 204 dbSNP
rs757420841 205 dbSNP
rs779507759 209 dbSNP
rs1333656101 230 dbSNP
rs1457943766 231 dbSNP
rs1414515675 237 dbSNP
rs1161054398 245 dbSNP
rs1471500544 254 dbSNP
rs1457186773 255 dbSNP
rs1407087126 261 dbSNP
rs11544524 262 dbSNP
rs139303864 266 dbSNP
rs1484234177 270 dbSNP
rs540258154 274 dbSNP
rs565168683 278 dbSNP
rs1202542964 290 dbSNP
rs989055432 294 dbSNP
rs1269667470 299 dbSNP
rs577076325 305 dbSNP
rs949068913 306 dbSNP
rs1387267969 310 dbSNP
rs35395194 311 dbSNP
rs1313964913 317 dbSNP
rs1230511402 319 dbSNP
rs1377684456 325 dbSNP
rs746412113 333 dbSNP
rs1266482 336 dbSNP
rs971932493 340 dbSNP
rs981556687 349 dbSNP
rs1004753510 367 dbSNP
rs1318801032 372 dbSNP
rs1037234339 375 dbSNP
rs1451273861 381 dbSNP
rs1348021898 394 dbSNP
rs1165291775 410 dbSNP
rs898725721 418 dbSNP
rs1411144852 426 dbSNP
rs562547770 438 dbSNP
rs927340844 440 dbSNP
rs1333664907 446 dbSNP
rs937373826 456 dbSNP
rs529776695 459 dbSNP
rs780513413 474 dbSNP
rs1038355998 481 dbSNP
rs1250266977 485 dbSNP
rs954006205 491 dbSNP
rs1266374032 504 dbSNP
rs1484049646 512 dbSNP
rs1183030751 519 dbSNP
rs919912580 520 dbSNP
rs747739264 521 dbSNP
rs1008234905 522 dbSNP
rs1019677412 528 dbSNP
rs1229148454 530 dbSNP
rs533933114 531 dbSNP
rs548299717 543 dbSNP
rs1266481 545 dbSNP
rs867699392 551 dbSNP
rs1368619231 554 dbSNP
rs943841984 555 dbSNP
rs978327810 563 dbSNP
rs1172074370 567 dbSNP
rs1458230186 570 dbSNP
rs1032198957 571 dbSNP
rs1190452321 596 dbSNP
rs527258386 603 dbSNP
rs1487712802 604 dbSNP
rs551921793 604 dbSNP
rs1291618434 606 dbSNP
rs1206480082 608 dbSNP
rs1345019814 619 dbSNP
rs762391599 621 dbSNP
rs543724676 626 dbSNP
rs1226847401 628 dbSNP
rs1010494018 638 dbSNP
rs1303713897 649 dbSNP
rs571876286 654 dbSNP
rs1393923979 655 dbSNP
rs772295293 656 dbSNP
rs981748763 663 dbSNP
rs77517333 668 dbSNP
rs187226454 682 dbSNP
rs1377776081 695 dbSNP
rs569098314 704 dbSNP
rs1037594719 705 dbSNP
rs114136210 719 dbSNP
rs1183402690 720 dbSNP
rs1484308704 721 dbSNP
rs34171711 726 dbSNP
rs1206567925 727 dbSNP
rs1195260878 730 dbSNP
rs1279689877 733 dbSNP
rs770977356 740 dbSNP
rs1049967800 753 dbSNP
rs1231336821 757 dbSNP
rs529471468 758 dbSNP
rs1323150375 768 dbSNP
rs1282376674 774 dbSNP
rs1008224995 779 dbSNP
rs377753562 781 dbSNP
rs1228803997 783 dbSNP
rs1019666214 787 dbSNP
rs1202332841 796 dbSNP
rs1326777094 800 dbSNP
rs1390255432 802 dbSNP
rs1257149167 804 dbSNP
rs1304145190 807 dbSNP
rs1467873841 808 dbSNP
rs1428223542 811 dbSNP
rs867675622 816 dbSNP
rs4773 826 dbSNP
rs1473792979 827 dbSNP
rs1362495784 828 dbSNP
rs999643553 834 dbSNP
rs1187658973 838 dbSNP
rs929946360 839 dbSNP
rs1258317532 843 dbSNP
rs982679008 849 dbSNP
rs912447732 850 dbSNP
rs189646208 856 dbSNP
rs573033748 865 dbSNP
rs1039972830 874 dbSNP
rs1277614796 878 dbSNP
rs1238235680 887 dbSNP
rs1341033777 889 dbSNP
rs1314219095 902 dbSNP
rs533895904 903 dbSNP
rs1404848892 906 dbSNP
rs1320811919 919 dbSNP
rs1459098166 920 dbSNP
rs558700636 924 dbSNP
rs990615710 925 dbSNP
rs191661734 926 dbSNP
rs970651777 927 dbSNP
rs981739001 930 dbSNP
rs1009208240 933 dbSNP
rs1020566760 939 dbSNP
rs907563803 951 dbSNP
rs74039155 956 dbSNP
rs1445564165 960 dbSNP
rs1003112425 965 dbSNP
rs973155171 972 dbSNP
rs533357829 989 dbSNP
rs1433962802 991 dbSNP
rs1267178549 992 dbSNP
rs1305637593 993 dbSNP
rs1295833870 996 dbSNP
rs1803097 997 dbSNP
rs1403329087 998 dbSNP
rs1367871048 1003 dbSNP
rs920344580 1004 dbSNP
rs183435812 1008 dbSNP
rs1318020341 1014 dbSNP
rs574683427 1017 dbSNP
rs1049956209 1020 dbSNP
rs1406351862 1026 dbSNP
rs1393433649 1027 dbSNP
rs890039416 1028 dbSNP
rs944296422 1029 dbSNP
rs1041052674 1030 dbSNP
rs1424650346 1036 dbSNP
rs1390862258 1043 dbSNP
rs1301199599 1048 dbSNP
rs902482269 1049 dbSNP
rs951405104 1055 dbSNP
rs1241766132 1056 dbSNP
rs1192150889 1057 dbSNP
rs1310464759 1073 dbSNP
rs1451968714 1074 dbSNP
rs542075114 1080 dbSNP
rs999952648 1092 dbSNP
rs1220136332 1096 dbSNP
rs982772027 1110 dbSNP
rs1235546794 1111 dbSNP
rs1215842003 1113 dbSNP
rs1337000522 1123 dbSNP
rs1269236584 1124 dbSNP
rs144216634 1125 dbSNP
rs943987720 1129 dbSNP
rs111333549 1142 dbSNP
rs1371767149 1150 dbSNP
rs772657639 1150 dbSNP
rs1059891 1153 dbSNP
rs1408307423 1161 dbSNP
rs188839854 1171 dbSNP
rs1245958228 1175 dbSNP
rs936454640 1183 dbSNP
rs1479160440 1186 dbSNP
rs1466089764 1195 dbSNP
rs1197056305 1198 dbSNP
rs1490153134 1200 dbSNP
rs1012025112 1216 dbSNP
rs376868432 1222 dbSNP
rs1435585476 1224 dbSNP
rs193081956 1246 dbSNP
rs531376727 1247 dbSNP
rs1325294713 1248 dbSNP
rs550987776 1249 dbSNP
rs1281748261 1262 dbSNP
rs569236475 1263 dbSNP
rs1351596052 1268 dbSNP
rs961698563 1276 dbSNP
rs1440035465 1281 dbSNP
rs1353996329 1286 dbSNP
rs79370519 1288 dbSNP
rs1377750375 1292 dbSNP
rs548386990 1293 dbSNP
rs1427493445 1294 dbSNP
rs1046514136 1297 dbSNP
rs953147266 1299 dbSNP
rs550128353 1301 dbSNP
rs911423387 1304 dbSNP
rs1456370151 1310 dbSNP
rs568247120 1311 dbSNP
rs566595791 1312 dbSNP
rs1210271353 1317 dbSNP
rs1003574414 1322 dbSNP
rs757367430 1326 dbSNP
rs1260898369 1327 dbSNP
rs1391210155 1330 dbSNP
rs1436303897 1340 dbSNP
rs1330257025 1349 dbSNP
rs1309675900 1355 dbSNP
rs1041275526 1356 dbSNP
rs924190359 1361 dbSNP
rs1373296810 1362 dbSNP
rs1284828772 1384 dbSNP
rs1293412456 1386 dbSNP
rs935312601 1392 dbSNP
rs184819672 1394 dbSNP
rs186580958 1398 dbSNP
rs1404100763 1400 dbSNP
rs1336340696 1406 dbSNP
rs1056019043 1407 dbSNP
rs1389098098 1408 dbSNP
rs893885276 1417 dbSNP
rs201472476 1418 dbSNP
rs779167339 1419 dbSNP
rs1417213914 1423 dbSNP
rs1407192577 1426 dbSNP
rs191369985 1427 dbSNP
rs1045140304 1434 dbSNP
rs370541720 1436 dbSNP
rs146537715 1446 dbSNP
rs894650022 1452 dbSNP
rs1240819570 1454 dbSNP
rs1226729100 1455 dbSNP
rs1465118753 1459 dbSNP
rs1003336281 1465 dbSNP
rs750866979 1469 dbSNP
rs1214150323 1470 dbSNP
rs556164195 1471 dbSNP
rs574820507 1475 dbSNP
rs994510639 1478 dbSNP
rs1027757874 1486 dbSNP
rs183860057 1491 dbSNP
rs1020073709 1508 dbSNP
rs528099618 1514 dbSNP
rs911660642 1515 dbSNP
rs41470046 1532 dbSNP
rs80337370 1547 dbSNP
rs1451398866 1555 dbSNP
rs564252922 1557 dbSNP
rs75363068 1565 dbSNP
rs1164145289 1566 dbSNP
rs1413752670 1570 dbSNP
rs543439072 1579 dbSNP
rs957875517 1584 dbSNP
rs562806535 1589 dbSNP
rs542239608 1590 dbSNP
rs1164486280 1591 dbSNP
rs1263433848 1591 dbSNP
rs913721282 1595 dbSNP
rs1053773434 1608 dbSNP
rs1247718758 1609 dbSNP
rs1225366524 1610 dbSNP
rs1357978931 1617 dbSNP
rs915270696 1619 dbSNP
rs948075657 1620 dbSNP
rs1229262299 1621 dbSNP
rs775679243 1621 dbSNP
rs1293705399 1623 dbSNP
rs1045089852 1624 dbSNP
rs906634933 1627 dbSNP
rs937664926 1628 dbSNP
rs1303604333 1635 dbSNP
rs767280367 1637 dbSNP
rs530346781 1638 dbSNP
rs1374381762 1649 dbSNP
rs1349885042 1650 dbSNP
rs1036646939 1653 dbSNP
rs1408104911 1660 dbSNP
rs1305720414 1668 dbSNP
rs1426274596 1669 dbSNP
rs1202107734 1671 dbSNP
rs1489989461 1673 dbSNP
rs1266480 1674 dbSNP
rs747328166 1688 dbSNP
rs1048579365 1689 dbSNP
rs548325521 1698 dbSNP
rs566729308 1704 dbSNP
rs768978842 1704 dbSNP
rs527930277 1709 dbSNP
rs552389961 1719 dbSNP
rs965771235 1720 dbSNP
rs1225137256 1723 dbSNP
rs79608148 1740 dbSNP
rs1007232687 1741 dbSNP
rs957970140 1754 dbSNP
rs1398009963 1760 dbSNP
rs1292430738 1770 dbSNP
rs1018669980 1772 dbSNP
rs1461153976 1779 dbSNP
rs1406389679 1785 dbSNP
rs989388614 1790 dbSNP
rs1179345322 1795 dbSNP
rs1429129514 1803 dbSNP
rs965816482 1805 dbSNP
rs1266479 1816 dbSNP
rs1248465056 1818 dbSNP
rs1180991849 1834 dbSNP
rs1031610117 1847 dbSNP
rs956963164 1855 dbSNP
rs556613950 1860 dbSNP
rs73494509 1861 dbSNP
rs1205270656 1870 dbSNP
rs141138889 1871 dbSNP
rs1282479037 1873 dbSNP
rs1239645375 1878 dbSNP
rs948023617 1882 dbSNP
rs565595169 1883 dbSNP
rs1390348090 1890 dbSNP
rs927712771 1892 dbSNP
rs980773433 1896 dbSNP
rs990530367 1903 dbSNP
rs928053217 1905 dbSNP
rs1159548609 1909 dbSNP
rs1455782214 1921 dbSNP
rs939458178 1922 dbSNP
rs931607459 1924 dbSNP
rs1048590894 1930 dbSNP
rs554148417 1931 dbSNP
rs1245107826 1935 dbSNP
rs897625875 1939 dbSNP
rs887285940 1946 dbSNP
rs189614171 1948 dbSNP
rs1461074268 1953 dbSNP
rs930511370 1954 dbSNP
rs754337951 1958 dbSNP
rs10048033 1959 dbSNP
rs1041542553 1959 dbSNP
rs1447572833 1963 dbSNP
rs1282651203 1968 dbSNP
rs889042887 1969 dbSNP
rs1449973182 1976 dbSNP
rs1376629086 1977 dbSNP
rs1229849976 1978 dbSNP
rs1315516437 1984 dbSNP
rs557551392 1987 dbSNP
rs1341339526 1998 dbSNP
rs1384304416 2000 dbSNP
rs145571485 2001 dbSNP
rs8033977 2002 dbSNP
rs1437909605 2003 dbSNP
rs372007367 2004 dbSNP
rs1235404442 2005 dbSNP
rs775295029 2006 dbSNP
rs1473957125 2017 dbSNP
rs1259467520 2019 dbSNP
rs1215801850 2023 dbSNP
rs760491448 2025 dbSNP
rs181617823 2033 dbSNP
rs989672260 2037 dbSNP
rs776956410 2041 dbSNP
rs574747759 2043 dbSNP
rs1270412751 2061 dbSNP
rs546711749 2064 dbSNP
rs112115112 2065 dbSNP
rs927999413 2068 dbSNP
rs543685038 2069 dbSNP
rs939381909 2072 dbSNP
rs972535545 2073 dbSNP
rs919350418 2075 dbSNP
rs1424105606 2085 dbSNP
rs966553784 2096 dbSNP
rs1169861211 2099 dbSNP
rs981991890 2110 dbSNP
rs1356103674 2114 dbSNP
rs1371097382 2120 dbSNP
rs758829514 2124 dbSNP
rs1192731022 2128 dbSNP
rs1219531835 2128 dbSNP
rs140079720 2128 dbSNP
rs200753351 2128 dbSNP
rs930437310 2135 dbSNP
rs1048955960 2138 dbSNP
rs1215932939 2138 dbSNP
rs889031574 2139 dbSNP
rs943290433 2141 dbSNP
rs777961407 2144 dbSNP
rs959186471 2164 dbSNP
rs555672185 2165 dbSNP
rs1347867293 2173 dbSNP
rs1337128967 2174 dbSNP
rs990976688 2180 dbSNP
rs1364273782 2181 dbSNP
rs1404944595 2189 dbSNP
rs901476523 2190 dbSNP
rs765215760 2192 dbSNP
rs552773536 2194 dbSNP
rs1299749988 2196 dbSNP
rs930279838 2198 dbSNP
rs984348978 2201 dbSNP
rs1396069559 2205 dbSNP
rs61746323 2208 dbSNP
rs892922117 2219 dbSNP
rs1197170369 2221 dbSNP
rs1477681237 2227 dbSNP
rs1041243605 2234 dbSNP
rs1443768660 2235 dbSNP
rs1206042330 2238 dbSNP
rs531856729 2241 dbSNP
rs550152729 2242 dbSNP
rs1326087278 2243 dbSNP
rs758409216 2251 dbSNP
rs1219122720 2255 dbSNP
rs568474315 2262 dbSNP
rs1440150824 2270 dbSNP
rs1376346162 2279 dbSNP
rs1337650356 2281 dbSNP
rs1002383806 2290 dbSNP
rs185166432 2297 dbSNP
rs766847690 2299 dbSNP
rs960950434 2300 dbSNP
rs972095900 2305 dbSNP
rs41515554 2306 dbSNP
rs952200152 2309 dbSNP
rs984603510 2310 dbSNP
rs959429536 2321 dbSNP
rs1462406384 2322 dbSNP
rs1369825129 2325 dbSNP
rs1209883743 2328 dbSNP
rs1432658645 2333 dbSNP
rs1322413798 2337 dbSNP
rs1318004972 2345 dbSNP
rs1326922049 2346 dbSNP
rs990539158 2350 dbSNP
rs1353056559 2353 dbSNP
rs1454763924 2365 dbSNP
rs1027333197 2368 dbSNP
rs1435735580 2374 dbSNP
rs755295400 2386 dbSNP
rs983100806 2390 dbSNP
rs1161185582 2391 dbSNP
rs1398950299 2396 dbSNP
rs749196715 2409 dbSNP
rs943195490 2410 dbSNP
rs1446030151 2411 dbSNP
rs1240921717 2412 dbSNP
rs1223679213 2422 dbSNP
rs781574206 2424 dbSNP
rs977405474 2426 dbSNP
rs748916292 2444 dbSNP
rs932777463 2445 dbSNP
rs1214267338 2448 dbSNP
rs1488279784 2450 dbSNP
rs1248307035 2459 dbSNP
rs923221850 2461 dbSNP
rs1312296211 2463 dbSNP
rs934314269 2480 dbSNP
rs1049851639 2482 dbSNP
rs915352830 2487 dbSNP
rs368688313 2490 dbSNP
rs1052829139 2492 dbSNP
rs565997091 2500 dbSNP
rs1451522176 2502 dbSNP
rs1426004120 2509 dbSNP
rs539222677 2510 dbSNP
rs1044140209 2538 dbSNP
rs905348417 2541 dbSNP
rs1480812008 2542 dbSNP
rs756962744 2547 dbSNP
rs1002331605 2548 dbSNP
rs1270240198 2555 dbSNP
rs1224741081 2563 dbSNP
rs527814682 2564 dbSNP
rs1265010028 2577 dbSNP
rs557952526 2585 dbSNP
rs1205453679 2586 dbSNP
rs1410071431 2601 dbSNP
rs1056752886 2609 dbSNP
rs1216598778 2612 dbSNP
rs576005472 2616 dbSNP
rs1283859811 2618 dbSNP
rs1406758025 2621 dbSNP
rs1387944204 2622 dbSNP
rs34970738 2633 dbSNP
rs533228489 2634 dbSNP
rs1462137104 2644 dbSNP
rs1026335334 2646 dbSNP
rs1477707220 2653 dbSNP
rs952214652 2663 dbSNP
rs1202226981 2668 dbSNP
rs984844518 2673 dbSNP
rs1014631185 2693 dbSNP
rs1385478277 2700 dbSNP
rs1481716292 2710 dbSNP
rs1249835777 2712 dbSNP
rs966059514 2714 dbSNP
rs1317056448 2720 dbSNP
rs745318473 2722 dbSNP
rs1404691455 2726 dbSNP
rs148887648 2730 dbSNP
rs1332266487 2731 dbSNP
rs1329319771 2732 dbSNP
rs977037854 2734 dbSNP
rs1287281338 2735 dbSNP
rs1391469718 2738 dbSNP
rs573301122 2740 dbSNP
rs1328855489 2746 dbSNP
rs540655980 2748 dbSNP
rs190410034 2750 dbSNP
rs76194302 2753 dbSNP
rs113316526 2754 dbSNP
rs546053833 2755 dbSNP
rs1042459556 2765 dbSNP
rs1159834126 2782 dbSNP
rs1208514652 2784 dbSNP
rs1420966537 2793 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084041. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep1 ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' ucuccguccaaggACCUAGUa 5'
                       ||||||| 
Target 5' ---------ugggUGGAUCAc 3'
1 - 12
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_006122 | 3UTR | CCAAGGUGGGUGGAUCACUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084041
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep1
Location of target site ENST00000360468.3 | 3UTR | UGGGUGGAUCACUUGAGGUCAGGAGUUCGAGACCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.524 4.3e-3 0.472 9.9e-3 24 Click to see details
GSE17306 Multiple myeloma -0.3 1.8e-2 0.073 3.1e-1 49 Click to see details
GSE32688 Pancreatic cancer 0.317 3.9e-2 0.219 1.1e-1 32 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.286 8.3e-2 0.317 6.1e-2 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.252 1.4e-1 -0.211 1.9e-1 20 Click to see details
GSE38226 Liver fibrosis 0.234 1.5e-1 0.044 4.2e-1 21 Click to see details
GSE19783 ER+ ER+ breast cancer 0.206 1.9e-1 0.295 1.0e-1 20 Click to see details
GSE19350 CNS germ cell tumors 0.209 2.6e-1 0.531 3.8e-2 12 Click to see details
GSE27834 Pluripotent stem cells -0.127 3.2e-1 -0.179 2.5e-1 16 Click to see details
GSE19536 Breast cancer 0.042 3.4e-1 0.145 7.5e-2 100 Click to see details
GSE42095 Differentiated embryonic stem cells -0.058 4.0e-1 0.000 5.0e-1 23 Click to see details
GSE21687 Ependynoma primary tumors -0.031 4.0e-1 0.068 3.0e-1 64 Click to see details
GSE19783 ER- ER- breast cancer 0.024 4.2e-1 0.133 1.2e-1 79 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.034 4.4e-1 0.108 3.0e-1 25 Click to see details
GSE17498 Multiple myeloma 0.021 4.5e-1 0.034 4.2e-1 40 Click to see details
GSE21849 B cell lymphoma -0.016 4.7e-1 0.421 1.1e-2 29 Click to see details
GSE26953 Aortic valvular endothelial cells 0.014 4.7e-1 0.166 2.2e-1 24 Click to see details
GSE28260 Renal cortex and medulla 0.015 4.8e-1 0.172 2.9e-1 13 Click to see details
GSE14794 Lymphoblastoid cells -0.005 4.8e-1 0.063 2.8e-1 90 Click to see details
GSE14794 Lymphoblastoid cells -0.005 4.8e-1 0.063 2.8e-1 90 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
194 hsa-miR-640 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT097121 TNPO1 transportin 1 2 2
MIRT115090 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 4
MIRT204603 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT204634 MOB4 MOB family member 4, phocein 2 8
MIRT344451 MTRNR2L1 MT-RNR2-like 1 2 2
MIRT405772 EIF5 eukaryotic translation initiation factor 5 2 2
MIRT445876 SENP6 SUMO1/sentrin specific peptidase 6 2 2
MIRT497418 FAM46A family with sequence similarity 46 member A 2 2
MIRT504394 HMX2 H6 family homeobox 2 2 4
MIRT504691 SLCO2B1 solute carrier organic anion transporter family member 2B1 2 8
MIRT512386 MTRNR2L3 MT-RNR2-like 3 2 6
MIRT513003 MAN1A2 mannosidase alpha class 1A member 2 2 2
MIRT513084 USP9X ubiquitin specific peptidase 9, X-linked 2 2
MIRT519122 ALDH2 aldehyde dehydrogenase 2 family (mitochondrial) 2 2
MIRT523836 F2RL1 F2R like trypsin receptor 1 2 2
MIRT565356 TMCC1 transmembrane and coiled-coil domain family 1 2 2
MIRT575895 Dis3 DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease 2 3
MIRT576894 Poteg POTE ankyrin domain family, member G 2 2
MIRT613780 RPS6 ribosomal protein S6 2 2
MIRT613934 POLR3A RNA polymerase III subunit A 2 2
MIRT614348 LOH12CR1 BLOC-1 related complex subunit 5 2 2
MIRT614534 NOA1 nitric oxide associated 1 2 2
MIRT617019 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT618247 MANEAL mannosidase endo-alpha like 2 2
MIRT619051 TTC4 tetratricopeptide repeat domain 4 2 2
MIRT619442 ZNF517 zinc finger protein 517 2 2
MIRT619723 FPR2 formyl peptide receptor 2 2 2
MIRT620179 TRIM72 tripartite motif containing 72 2 2
MIRT620370 ANKRD62 ankyrin repeat domain 62 2 2
MIRT621263 RTN2 reticulon 2 2 2
MIRT621463 APOH apolipoprotein H 2 2
MIRT621571 ZBTB43 zinc finger and BTB domain containing 43 2 2
MIRT621683 TSPYL1 TSPY like 1 2 2
MIRT622866 PDE7A phosphodiesterase 7A 2 2
MIRT624669 ARHGEF39 Rho guanine nucleotide exchange factor 39 2 2
MIRT625607 ZNF84 zinc finger protein 84 2 2
MIRT626111 IL23R interleukin 23 receptor 2 2
MIRT628380 CACNB2 calcium voltage-gated channel auxiliary subunit beta 2 2 2
MIRT628553 MELK maternal embryonic leucine zipper kinase 2 2
MIRT628671 C2orf72 chromosome 2 open reading frame 72 2 2
MIRT628747 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT628776 TMEM154 transmembrane protein 154 2 2
MIRT628918 ZNF430 zinc finger protein 430 2 2
MIRT629174 ALDOA aldolase, fructose-bisphosphate A 2 2
MIRT629209 C12orf66 chromosome 12 open reading frame 66 2 2
MIRT629267 SLC5A8 solute carrier family 5 member 8 2 2
MIRT629498 AS3MT arsenite methyltransferase 2 2
MIRT629665 USP1 ubiquitin specific peptidase 1 2 2
MIRT629760 STK25 serine/threonine kinase 25 2 2
MIRT630899 GATAD1 GATA zinc finger domain containing 1 2 2
MIRT631105 SLC15A2 solute carrier family 15 member 2 2 2
MIRT631112 ATCAY ATCAY, caytaxin 2 2
MIRT631450 DLEU1 deleted in lymphocytic leukemia 1 (non-protein coding) 2 2
MIRT631505 FFAR4 free fatty acid receptor 4 2 2
MIRT631580 ITGAL integrin subunit alpha L 2 2
MIRT631836 CMBL carboxymethylenebutenolidase homolog 2 2
MIRT632342 SWSAP1 SWIM-type zinc finger 7 associated protein 1 2 2
MIRT633214 ZNF584 zinc finger protein 584 2 2
MIRT633223 ZNF43 zinc finger protein 43 2 2
MIRT633480 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 2 2
MIRT633511 LRRC27 leucine rich repeat containing 27 2 2
MIRT633615 CWF19L1 CWF19 like 1, cell cycle control (S. pombe) 2 2
MIRT633652 SLC28A1 solute carrier family 28 member 1 2 2
MIRT633677 ZNF576 zinc finger protein 576 2 2
MIRT634196 TMOD2 tropomodulin 2 2 4
MIRT634388 PLSCR1 phospholipid scramblase 1 2 2
MIRT635817 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT635962 TTC31 tetratricopeptide repeat domain 31 2 2
MIRT636114 YPEL1 yippee like 1 2 2
MIRT636164 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT636768 CLUAP1 clusterin associated protein 1 2 2
MIRT637092 CXorf23 BCLAF1 and THRAP3 family member 3 2 2
MIRT637316 FAM9B family with sequence similarity 9 member B 2 2
MIRT637540 CHST6 carbohydrate sulfotransferase 6 2 2
MIRT637628 ZNF431 zinc finger protein 431 2 2
MIRT637826 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT637945 IVD isovaleryl-CoA dehydrogenase 2 2
MIRT637968 IRF1 interferon regulatory factor 1 2 2
MIRT638321 RNF11 ring finger protein 11 2 2
MIRT638386 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT639244 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT642608 APOPT1 apoptogenic 1, mitochondrial 2 2
MIRT642793 SLC1A5 solute carrier family 1 member 5 2 2
MIRT643847 LACTB lactamase beta 2 4
MIRT644705 ZNF321P zinc finger protein 321, pseudogene 2 2
MIRT645148 DIS3 DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease 2 3
MIRT646671 CCDC69 coiled-coil domain containing 69 2 2
MIRT647780 ASB8 ankyrin repeat and SOCS box containing 8 2 2
MIRT648554 WDR92 WD repeat domain 92 2 2
MIRT648990 MRPL49 mitochondrial ribosomal protein L49 2 2
MIRT649099 KCNMB1 potassium calcium-activated channel subfamily M regulatory beta subunit 1 2 2
MIRT650141 ZNF426 zinc finger protein 426 2 2
MIRT650791 GSR glutathione-disulfide reductase 2 2
MIRT654967 PLEKHA2 pleckstrin homology domain containing A2 2 2
MIRT655099 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT655516 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 2
MIRT656289 METTL14 methyltransferase like 14 2 2
MIRT656497 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 2
MIRT657074 JPH2 junctophilin 2 2 2
MIRT657314 HOOK3 hook microtubule tethering protein 3 2 2
MIRT657419 HIF1AN hypoxia inducible factor 1 alpha subunit inhibitor 2 4
MIRT659032 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 2 2
MIRT659535 CHCHD5 coiled-coil-helix-coiled-coil-helix domain containing 5 2 2
MIRT661532 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT662029 FUT2 fucosyltransferase 2 2 2
MIRT663206 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 2 2
MIRT663357 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT663557 CCR6 C-C motif chemokine receptor 6 2 2
MIRT663650 POLM DNA polymerase mu 2 2
MIRT663694 ABHD17B abhydrolase domain containing 17B 2 2
MIRT664370 CYB5A cytochrome b5 type A 2 2
MIRT664783 LIAS lipoic acid synthetase 2 4
MIRT665561 TXNL1 thioredoxin like 1 2 2
MIRT665950 TAOK1 TAO kinase 1 2 2
MIRT667338 MSANTD3 Myb/SANT DNA binding domain containing 3 2 2
MIRT667804 ITIH5 inter-alpha-trypsin inhibitor heavy chain family member 5 2 2
MIRT668804 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT669470 ARPC2 actin related protein 2/3 complex subunit 2 2 2
MIRT669599 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT669806 STOML1 stomatin like 1 2 2
MIRT669944 FBXL2 F-box and leucine rich repeat protein 2 2 2
MIRT670292 RBBP4 RB binding protein 4, chromatin remodeling factor 2 2
MIRT670381 EMP2 epithelial membrane protein 2 2 2
MIRT670481 DCUN1D2 defective in cullin neddylation 1 domain containing 2 2 2
MIRT670531 KIF1C kinesin family member 1C 2 4
MIRT670565 GLTP glycolipid transfer protein 2 2
MIRT670603 NPHP1 nephrocystin 1 2 2
MIRT670880 CYTIP cytohesin 1 interacting protein 2 2
MIRT670931 LIPG lipase G, endothelial type 2 2
MIRT671261 MTRNR2L5 MT-RNR2-like 5 2 2
MIRT671794 FLVCR1 feline leukemia virus subgroup C cellular receptor 1 2 2
MIRT671897 GBP4 guanylate binding protein 4 2 2
MIRT672000 SLC35F6 solute carrier family 35 member F6 2 4
MIRT672074 KIR3DX1 killer cell immunoglobulin like receptor, three Ig domains X1 2 2
MIRT672319 C9orf3 chromosome 9 open reading frame 3 2 2
MIRT672853 C22orf29 retrotransposon Gag like 10 2 2
MIRT673395 WNT7B Wnt family member 7B 2 2
MIRT673537 DEGS1 delta 4-desaturase, sphingolipid 1 2 2
MIRT674285 ZNF724P zinc finger protein 724 2 2
MIRT674494 TIRAP TIR domain containing adaptor protein 2 2
MIRT675460 NUBPL nucleotide binding protein like 2 2
MIRT675569 TRIP11 thyroid hormone receptor interactor 11 2 2
MIRT676068 TIMM50 translocase of inner mitochondrial membrane 50 2 2
MIRT676254 PBOV1 prostate and breast cancer overexpressed 1 2 2
MIRT676377 SEC24D SEC24 homolog D, COPII coat complex component 2 2
MIRT676758 SNX2 sorting nexin 2 2 2
MIRT676773 NPHS1 NPHS1, nephrin 2 2
MIRT676874 ENSA endosulfine alpha 2 2
MIRT676918 KLHDC8A kelch domain containing 8A 2 2
MIRT676944 S1PR3 sphingosine-1-phosphate receptor 3 2 2
MIRT676957 HFE hemochromatosis 2 2
MIRT676967 RNF19B ring finger protein 19B 2 2
MIRT676972 ZNF708 zinc finger protein 708 2 2
MIRT677042 ZNF34 zinc finger protein 34 2 2
MIRT677070 VMAC vimentin type intermediate filament associated coiled-coil protein 2 2
MIRT677093 MFSD11 major facilitator superfamily domain containing 11 2 4
MIRT677134 P2RX7 purinergic receptor P2X 7 2 2
MIRT677179 ZNF786 zinc finger protein 786 2 2
MIRT677228 C15orf40 chromosome 15 open reading frame 40 2 2
MIRT677320 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 2
MIRT677455 PDLIM3 PDZ and LIM domain 3 2 2
MIRT677809 MRPS10 mitochondrial ribosomal protein S10 2 2
MIRT677937 ZNF519 zinc finger protein 519 2 2
MIRT678063 UBN2 ubinuclein 2 2 4
MIRT678072 EIF2A eukaryotic translation initiation factor 2A 2 2
MIRT678252 FXN frataxin 2 2
MIRT678315 FBLIM1 filamin binding LIM protein 1 2 2
MIRT678367 XIAP X-linked inhibitor of apoptosis 2 4
MIRT678372 RNF115 ring finger protein 115 2 2
MIRT678410 ANKRD36 ankyrin repeat domain 36 2 2
MIRT678518 ZNF347 zinc finger protein 347 2 2
MIRT678566 CDK4 cyclin dependent kinase 4 2 2
MIRT678580 PPP1R3B protein phosphatase 1 regulatory subunit 3B 2 2
MIRT678820 PDE6A phosphodiesterase 6A 2 2
MIRT678917 XPOT exportin for tRNA 2 2
MIRT679217 MAN2A2 mannosidase alpha class 2A member 2 2 2
MIRT679437 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT679595 HILPDA hypoxia inducible lipid droplet associated 2 2
MIRT679755 TLR6 toll like receptor 6 2 2
MIRT679800 APOBEC3A apolipoprotein B mRNA editing enzyme catalytic subunit 3A 2 2
MIRT680057 CD96 CD96 molecule 2 2
MIRT680116 CCDC30 coiled-coil domain containing 30 2 4
MIRT680181 ZNF554 zinc finger protein 554 2 2
MIRT680439 WDR12 WD repeat domain 12 2 2
MIRT680789 ZNF578 zinc finger protein 578 2 2
MIRT692464 APEX2 apurinic/apyrimidinic endodeoxyribonuclease 2 2 2
MIRT702952 HIP1 huntingtin interacting protein 1 2 2
MIRT706016 ZSCAN2 zinc finger and SCAN domain containing 2 2 2
MIRT706032 F2R coagulation factor II thrombin receptor 2 2
MIRT706135 MTRNR2L10 MT-RNR2-like 10 2 2
MIRT706394 HAS2 hyaluronan synthase 2 2 2
MIRT713293 DCP2 decapping mRNA 2 2 2
MIRT716583 BRAP BRCA1 associated protein 2 2
MIRT720433 C19orf47 chromosome 19 open reading frame 47 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-640 Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer tissue and cell line (SKOV3)
hsa-miR-640 Cetuximab resistant High Colon Cancer cell line
hsa-miR-640 Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-640 Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-640 Mitoxantrone 4212 NSC279836 approved resistant High Breast Cancer cell line (BT-20, BT-474, BT-549, CAMA-1, HCC1143, HCC1395, HCC1569, HCC1806, HCC-1937, HCC1954, HCC202, HCC38, HCC70, Hs578T, MCF-7, MDA-MB-175VII, MDA-MB-231, MDA-MB-361, MDA-MB-415, MDA-MB-436, MDA-MB-468, SKBR3, T47D, UACC812, EVSA-T, MPE-600 , SK-BR-
hsa-miR-640 Sorafenib 216239 NSC747971 approved sensitive Low Clear Cell Renal Cell Carcinoma cell line (786-O)
hsa-mir-640 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-640 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-mir-640 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-640 Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-640 Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-640 Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR8)
hsa-miR-640 Oxaliplatin 6857599 NSC266046 approved sensitive cell line (IGROV-1)
hsa-miR-640 Cisplatin 5460033 NSC119875 approved sensitive cell line (IGROV-1)
hsa-miR-640 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission