pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4486 |
Genomic Coordinates | chr11: 19575310 - 19575372 |
Description | Homo sapiens miR-4486 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4486 | ||||||||||||
Sequence | 5| GCUGGGCGAGGCUGGCA |21 | ||||||||||||
Evidence | Experimental | ||||||||||||
Experiments | Illumina | ||||||||||||
SNPs in miRNA |
|
||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | AAED1 | ||||||||||||||||||||
Synonyms | C9orf21 | ||||||||||||||||||||
Description | AhpC/TSA antioxidant enzyme domain containing 1 | ||||||||||||||||||||
Transcript | NM_153698 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on AAED1 | |||||||||||||||||||||
3'UTR of AAED1 (miRNA target sites are highlighted) |
>AAED1|NM_153698|3'UTR 1 CTTAAAATGCACTCAGTCACTTTCAACTGGACCTTCTGGAATGTGACCTTCAATGCCTGGGTGTAATATCCTCGTGCAGT 81 GTCTAACCTGCTGTCCCTTCCCAGCCTTTGAGGAGTTAGGGAAGCATAAAGGGGGCTTGAACCTGTTGAATTGCATGCTG 161 GGAAGCATCAGTTGTCAAAATATGTTATATACTTCCATTTTATAACTTTTAACATTTTATACAAAAAAAATGAATATACA 241 AAATATAACTTTAAAAGCTATAAAATCATAAATACTCTAAATTATTTTACATTATGGTATATTCAGTCAATGAAAGAGTT 321 TTTTGGCAATATAAATTCTGACAGTATATAAGGGGACAGGAGAACAACACAAGACCATTATATTCAGTGAAGAAGGCAAA 401 ATATCAAATCTGTCAACAATGTAACTGCATTTTTATATGTATATATTTGTATTTTTGTATGCTTTGGAAAAAGACAGGAA 481 ATAAACACCAAAATGTTGCCAGTAGGTAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293/HeLa | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1067870. RNA binding protein: AGO2. Condition:Ago2 IP-seq (mitotic cells)
... - Kishore S; Gruber AR; Jedlinski DJ; Syed et al., 2013, Genome biology. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Kishore S; Gruber AR; Jedlinski DJ; Syed et al. - Genome biology, 2013
BACKGROUND: In recent years, a variety of small RNAs derived from other RNAs with well-known functions such as tRNAs and snoRNAs, have been identified. The functional relevance of these RNAs is largely unknown. To gain insight into the complexity of snoRNA processing and the functional relevance of snoRNA-derived small RNAs, we sequence long and short RNAs, small RNAs that co-precipitate with the Argonaute 2 protein and RNA fragments obtained in photoreactive nucleotide-enhanced crosslinking and immunoprecipitation (PAR-CLIP) of core snoRNA-associated proteins. RESULTS: Analysis of these data sets reveals that many loci in the human genome reproducibly give rise to C/D box-like snoRNAs, whose expression and evolutionary conservation are typically less pronounced relative to the snoRNAs that are currently cataloged. We further find that virtually all C/D box snoRNAs are specifically processed inside the regions of terminal complementarity, retaining in the mature form only 4-5 nucleotides upstream of the C box and 2-5 nucleotides downstream of the D box. Sequencing of the total and Argonaute 2-associated populations of small RNAs reveals that despite their cellular abundance, C/D box-derived small RNAs are not efficiently incorporated into the Ago2 protein. CONCLUSIONS: We conclude that the human genome encodes a large number of snoRNAs that are processed along the canonical pathway and expressed at relatively low levels. Generation of snoRNA-derived processing products with alternative, particularly miRNA-like, functions appears to be uncommon.
LinkOut: [PMID: 23706177]
|
CLIP-seq Support 1 for dataset GSM1067870 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293/HeLa / Ago2 IP-seq (mitotic cells) |
Location of target site | ENST00000375234.3 | 3UTR | AGGCUGGAGUGCAAUGGCUC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23706177 / GSE43666 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
108 hsa-miR-4486 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT254654 | NF2 | neurofibromin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT458684 | MRI1 | methylthioribose-1-phosphate isomerase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470845 | PLXND1 | plexin D1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493011 | NANOS1 | nanos C2HC-type zinc finger 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT497264 | GRK6 | G protein-coupled receptor kinase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT497675 | SYNGR1 | synaptogyrin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498219 | TLN2 | talin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498310 | BCL11B | B-cell CLL/lymphoma 11B | ![]() |
![]() |
2 | 2 | ||||||
MIRT504048 | TOMM5 | translocase of outer mitochondrial membrane 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT519959 | ZCCHC8 | zinc finger CCHC-type containing 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531521 | NOM1 | nucleolar protein with MIF4G domain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533144 | WNT10A | Wnt family member 10A | ![]() |
![]() |
2 | 2 | ||||||
MIRT533541 | TPR | translocated promoter region, nuclear basket protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT533681 | TMEM86A | transmembrane protein 86A | ![]() |
![]() |
2 | 2 | ||||||
MIRT540321 | PIGR | polymeric immunoglobulin receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT540719 | GUF1 | GUF1 homolog, GTPase | ![]() |
![]() |
2 | 2 | ||||||
MIRT541566 | ZNF43 | zinc finger protein 43 | ![]() |
![]() |
2 | 4 | ||||||
MIRT541787 | TBCCD1 | TBCC domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541925 | ORC1 | origin recognition complex subunit 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT542232 | FUT9 | fucosyltransferase 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542285 | POLR3K | RNA polymerase III subunit K | ![]() |
![]() |
2 | 2 | ||||||
MIRT542299 | QTRTD1 | queuine tRNA-ribosyltransferase accessory subunit 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT542368 | PAICS | phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase | ![]() |
![]() |
2 | 2 | ||||||
MIRT542441 | C3 | complement C3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT542475 | APOC3 | apolipoprotein C3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542535 | MRPS10 | mitochondrial ribosomal protein S10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542640 | TIMM8A | translocase of inner mitochondrial membrane 8A | ![]() |
![]() |
2 | 2 | ||||||
MIRT542788 | PLEKHA3 | pleckstrin homology domain containing A3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT552104 | PPP1R1A | protein phosphatase 1 regulatory inhibitor subunit 1A | ![]() |
![]() |
2 | 2 | ||||||
MIRT564913 | YTHDF1 | YTH N6-methyladenosine RNA binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568606 | ACVR2A | activin A receptor type 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT607389 | LANCL3 | LanC like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT607451 | ZNF543 | zinc finger protein 543 | ![]() |
![]() |
2 | 2 | ||||||
MIRT610058 | MYBPC1 | myosin binding protein C, slow type | ![]() |
![]() |
2 | 2 | ||||||
MIRT610793 | KLK2 | kallikrein related peptidase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617176 | GOSR2 | golgi SNAP receptor complex member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT620579 | WBSCR27 | methyltransferase like 27 | ![]() |
![]() |
2 | 4 | ||||||
MIRT622085 | SRPX2 | sushi repeat containing protein, X-linked 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622542 | PXMP4 | peroxisomal membrane protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT630009 | PDE6B | phosphodiesterase 6B | ![]() |
![]() |
2 | 2 | ||||||
MIRT631813 | PTDSS2 | phosphatidylserine synthase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT632721 | MSANTD4 | Myb/SANT DNA binding domain containing 4 with coiled-coils | ![]() |
![]() |
2 | 2 | ||||||
MIRT632757 | MED28 | mediator complex subunit 28 | ![]() |
![]() |
2 | 2 | ||||||
MIRT634821 | ASB6 | ankyrin repeat and SOCS box containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635255 | FBXL20 | F-box and leucine rich repeat protein 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT637082 | SELPLG | selectin P ligand | ![]() |
![]() |
2 | 2 | ||||||
MIRT637357 | ZNF460 | zinc finger protein 460 | ![]() |
![]() |
2 | 2 | ||||||
MIRT637472 | DEFB105B | defensin beta 105B | ![]() |
![]() |
2 | 4 | ||||||
MIRT637504 | DEFB105A | defensin beta 105A | ![]() |
![]() |
2 | 4 | ||||||
MIRT639022 | AAK1 | AP2 associated kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641012 | ANKFY1 | ankyrin repeat and FYVE domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642170 | HEBP2 | heme binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648977 | ACAD8 | acyl-CoA dehydrogenase family member 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650515 | UFM1 | ubiquitin fold modifier 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650949 | INMT | indolethylamine N-methyltransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT658354 | FAM65B | RHO family interacting cell polarization regulator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT660736 | ALG14 | ALG14, UDP-N-acetylglucosaminyltransferase subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT662191 | MEI1 | meiotic double-stranded break formation protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663045 | SLC16A4 | solute carrier family 16 member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT664811 | IRAK3 | interleukin 1 receptor associated kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665161 | SF3A1 | splicing factor 3a subunit 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT665346 | YES1 | YES proto-oncogene 1, Src family tyrosine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT666493 | SBNO1 | strawberry notch homolog 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT666545 | RNF115 | ring finger protein 115 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669351 | BMP3 | bone morphogenetic protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669904 | KIAA0754 | KIAA0754 | ![]() |
![]() |
2 | 4 | ||||||
MIRT670323 | CEP57L1 | centrosomal protein 57 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670430 | ELP2 | elongator acetyltransferase complex subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670672 | KIAA1551 | KIAA1551 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670746 | HOOK3 | hook microtubule tethering protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670998 | PTGIS | prostaglandin I2 synthase | ![]() |
![]() |
2 | 2 | ||||||
MIRT671290 | RPL37A | ribosomal protein L37a | ![]() |
![]() |
2 | 2 | ||||||
MIRT671469 | AGPAT6 | glycerol-3-phosphate acyltransferase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671833 | STIL | STIL, centriolar assembly protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT673006 | TAF1 | TATA-box binding protein associated factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675881 | CSTF1 | cleavage stimulation factor subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT678625 | OLFML2A | olfactomedin like 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT678790 | NUPL2 | nucleoporin like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT679560 | LIN9 | lin-9 DREAM MuvB core complex component | ![]() |
![]() |
2 | 2 | ||||||
MIRT681032 | AAED1 | AhpC/TSA antioxidant enzyme domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682480 | LIX1L | limb and CNS expressed 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT682758 | MDM2 | MDM2 proto-oncogene | ![]() |
![]() |
2 | 2 | ||||||
MIRT682810 | TMCO1 | transmembrane and coiled-coil domains 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682867 | C9orf156 | tRNA methyltransferase O | ![]() |
![]() |
2 | 2 | ||||||
MIRT689233 | RPS19 | ribosomal protein S19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689305 | C5AR2 | complement component 5a receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689363 | ZNF101 | zinc finger protein 101 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689629 | NAA30 | N(alpha)-acetyltransferase 30, NatC catalytic subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT689654 | RBM23 | RNA binding motif protein 23 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690148 | PPIL6 | peptidylprolyl isomerase like 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691407 | DNA2 | DNA replication helicase/nuclease 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691847 | OSCAR | osteoclast associated, immunoglobulin-like receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT692234 | ALDH1B1 | aldehyde dehydrogenase 1 family member B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT694320 | NLRP9 | NLR family pyrin domain containing 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT694365 | CHST6 | carbohydrate sulfotransferase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT696215 | LYZ | lysozyme | ![]() |
![]() |
2 | 2 | ||||||
MIRT697230 | ZYG11A | zyg-11 family member A, cell cycle regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT700487 | PTPRF | protein tyrosine phosphatase, receptor type F | ![]() |
![]() |
2 | 2 | ||||||
MIRT700612 | PRKCA | protein kinase C alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT702456 | KIAA1467 | family with sequence similarity 234 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT702990 | HERPUD2 | HERPUD family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703998 | EIF5A2 | eukaryotic translation initiation factor 5A2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT704701 | CHRFAM7A | CHRNA7 (exons 5-10) and FAM7A (exons A-E) fusion | ![]() |
![]() |
2 | 2 | ||||||
MIRT712481 | FSTL3 | follistatin like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712781 | ZNF154 | zinc finger protein 154 | ![]() |
![]() |
2 | 2 | ||||||
MIRT714369 | HP1BP3 | heterochromatin protein 1 binding protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT722570 | C1orf95 | stum, mechanosensory transduction mediator homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT722839 | C17orf102 | chromosome 17 open reading frame 102 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|