pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4640 |
Genomic Coordinates | chr6: 30890883 - 30890972 |
Description | Homo sapiens miR-4640 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4640-5p | ||||||||||||||||||||||||
Sequence | 9| UGGGCCAGGGAGCAGCUGGUGGG |31 | ||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||
Experiments | Illumina | ||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Biomarker Information |
|
---|
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | EIF4EBP1 | ||||||||||||||||||||
Synonyms | 4E-BP1, 4EBP1, BP-1, PHAS-I | ||||||||||||||||||||
Description | eukaryotic translation initiation factor 4E binding protein 1 | ||||||||||||||||||||
Transcript | NM_004095 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on EIF4EBP1 | |||||||||||||||||||||
3'UTR of EIF4EBP1 (miRNA target sites are highlighted) |
>EIF4EBP1|NM_004095|3'UTR 1 AGCACCAGCCATCGTGTGGAGCACTACCAAGGGGCCCCTCAGGGCCTTCCTGGGAGGAGTCCCACCAGCCAGGCCTTATG 81 AAAGTGATCATACTGGGCAGGCGTTGGCGTGGGGTCGGACACCCCAGCCCTTTCTCCCTCACTCAGGGCACCTGCCCCCT 161 CCTCTTCGTGAACACCAGCAGATACCTCCTTGTGCCTCCACTGATGCAGGAGCTGCCACCCCAAGGGGAGTGACCCCTGC 241 CAGCACACCCTGCAGCCAAGGGCCAGGAAGTGGACAAGAACGAACCCTTCCTTCCGAATGATCAGCAGTTCCAGCCCCTC 321 GCTGCTGGGGGCGCAACCACCCCTTCCTTAGGTTGATGTGCTTGGGAAAGCTCCCTCCCCCTCCTTCCCCAAGAGAGGAA 401 ATAAAAGCCACCTTCGCCCTAGGGCCAAGAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293/HeLa | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1067870. RNA binding protein: AGO2. Condition:Ago2 IP-seq (mitotic cells)
... - Kishore S; Gruber AR; Jedlinski DJ; Syed et al., 2013, Genome biology. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Kishore S; Gruber AR; Jedlinski DJ; Syed et al. - Genome biology, 2013
BACKGROUND: In recent years, a variety of small RNAs derived from other RNAs with well-known functions such as tRNAs and snoRNAs, have been identified. The functional relevance of these RNAs is largely unknown. To gain insight into the complexity of snoRNA processing and the functional relevance of snoRNA-derived small RNAs, we sequence long and short RNAs, small RNAs that co-precipitate with the Argonaute 2 protein and RNA fragments obtained in photoreactive nucleotide-enhanced crosslinking and immunoprecipitation (PAR-CLIP) of core snoRNA-associated proteins. RESULTS: Analysis of these data sets reveals that many loci in the human genome reproducibly give rise to C/D box-like snoRNAs, whose expression and evolutionary conservation are typically less pronounced relative to the snoRNAs that are currently cataloged. We further find that virtually all C/D box snoRNAs are specifically processed inside the regions of terminal complementarity, retaining in the mature form only 4-5 nucleotides upstream of the C box and 2-5 nucleotides downstream of the D box. Sequencing of the total and Argonaute 2-associated populations of small RNAs reveals that despite their cellular abundance, C/D box-derived small RNAs are not efficiently incorporated into the Ago2 protein. CONCLUSIONS: We conclude that the human genome encodes a large number of snoRNAs that are processed along the canonical pathway and expressed at relatively low levels. Generation of snoRNA-derived processing products with alternative, particularly miRNA-like, functions appears to be uncommon.
LinkOut: [PMID: 23706177]
|
CLIP-seq Support 1 for dataset GSM1067870 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293/HeLa / Ago2 IP-seq (mitotic cells) |
Location of target site | ENST00000338825.4 | 3UTR | GGCCCAGGCUGGAGUGCAAU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23706177 / GSE43666 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
87 hsa-miR-4640-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT100106 | ABT1 | activator of basal transcription 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT248144 | LMBR1L | limb development membrane protein 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT327062 | KLHL15 | kelch like family member 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT347231 | GATAD2A | GATA zinc finger domain containing 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT450221 | CENPN | centromere protein N | ![]() |
![]() |
2 | 2 | ||||||
MIRT451264 | NDUFA11 | NADH:ubiquinone oxidoreductase subunit A11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452701 | C1orf226 | chromosome 1 open reading frame 226 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453212 | CERS1 | ceramide synthase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454822 | POLR2J3 | RNA polymerase II subunit J3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454883 | RAD50 | RAD50 double strand break repair protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT455783 | TAF8 | TATA-box binding protein associated factor 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455858 | TMEM254 | transmembrane protein 254 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457615 | UPK3BL | uroplakin 3B like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457822 | ITPRIP | inositol 1,4,5-trisphosphate receptor interacting protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT458344 | NOC2L | NOC2 like nucleolar associated transcriptional repressor | ![]() |
![]() |
2 | 2 | ||||||
MIRT458376 | ITM2C | integral membrane protein 2C | ![]() |
![]() |
2 | 2 | ||||||
MIRT458928 | SAMD4B | sterile alpha motif domain containing 4B | ![]() |
![]() |
2 | 2 | ||||||
MIRT459066 | WFIKKN2 | WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT460138 | ASB16 | ankyrin repeat and SOCS box containing 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT460818 | FSTL4 | follistatin like 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT461285 | COX10 | COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT462738 | EFNB1 | ephrin B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT464556 | UBTF | upstream binding transcription factor, RNA polymerase I | ![]() |
![]() |
2 | 2 | ||||||
MIRT477910 | DUSP2 | dual specificity phosphatase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479073 | CNNM4 | cyclin and CBS domain divalent metal cation transport mediator 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT479534 | CDC5L | cell division cycle 5 like | ![]() |
![]() |
2 | 4 | ||||||
MIRT485628 | EEPD1 | endonuclease/exonuclease/phosphatase family domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489896 | PPIC | peptidylprolyl isomerase C | ![]() |
![]() |
2 | 4 | ||||||
MIRT490737 | SRCIN1 | SRC kinase signaling inhibitor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491201 | MLLT1 | MLLT1, super elongation complex subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT492681 | PHYHIP | phytanoyl-CoA 2-hydroxylase interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT494593 | ATG7 | autophagy related 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495061 | PADI3 | peptidyl arginine deiminase 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT496623 | TMEM67 | transmembrane protein 67 | ![]() |
![]() |
2 | 2 | ||||||
MIRT497177 | ZBTB40 | zinc finger and BTB domain containing 40 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498217 | TLN2 | talin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498306 | BCL11B | B-cell CLL/lymphoma 11B | ![]() |
![]() |
2 | 2 | ||||||
MIRT499668 | NPHP3 | nephrocystin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT508080 | ANKRD52 | ankyrin repeat domain 52 | ![]() |
![]() |
2 | 2 | ||||||
MIRT509707 | ANKRD23 | ankyrin repeat domain 23 | ![]() |
![]() |
2 | 2 | ||||||
MIRT509841 | FOS | Fos proto-oncogene, AP-1 transcription factor subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT512814 | ARRDC2 | arrestin domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT513353 | SLIT1 | slit guidance ligand 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT514293 | FXYD5 | FXYD domain containing ion transport regulator 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT516598 | FAM89A | family with sequence similarity 89 member A | ![]() |
![]() |
2 | 4 | ||||||
MIRT516616 | DARS2 | aspartyl-tRNA synthetase 2, mitochondrial | ![]() |
![]() |
2 | 2 | ||||||
MIRT518348 | CCL5 | C-C motif chemokine ligand 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT520130 | WSB1 | WD repeat and SOCS box containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT522072 | ORAI2 | ORAI calcium release-activated calcium modulator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT526461 | OSBPL5 | oxysterol binding protein like 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT528278 | MBL2 | mannose binding lectin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT534844 | RAB15 | RAB15, member RAS oncogene family | ![]() |
![]() |
2 | 4 | ||||||
MIRT542245 | HSPA4L | heat shock protein family A (Hsp70) member 4 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT543299 | ZNF585B | zinc finger protein 585B | ![]() |
![]() |
2 | 2 | ||||||
MIRT552456 | ZNF410 | zinc finger protein 410 | ![]() |
![]() |
2 | 2 | ||||||
MIRT553641 | TJAP1 | tight junction associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT557103 | HOXA3 | homeobox A3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570782 | FANCA | Fanconi anemia complementation group A | ![]() |
![]() |
2 | 2 | ||||||
MIRT630912 | ZMAT2 | zinc finger matrin-type 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT631034 | ZNF878 | zinc finger protein 878 | ![]() |
![]() |
2 | 2 | ||||||
MIRT639017 | AAK1 | AP2 associated kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648596 | ZYG11B | zyg-11 family member B, cell cycle regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT648939 | ATP5A1 | ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle | ![]() |
![]() |
2 | 2 | ||||||
MIRT652834 | TACO1 | translational activator of cytochrome c oxidase I | ![]() |
![]() |
2 | 2 | ||||||
MIRT659347 | CSRP1 | cysteine and glycine rich protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT664163 | APOBEC3F | apolipoprotein B mRNA editing enzyme catalytic subunit 3F | ![]() |
![]() |
2 | 2 | ||||||
MIRT670511 | ZSCAN22 | zinc finger and SCAN domain containing 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671246 | TMEM41B | transmembrane protein 41B | ![]() |
![]() |
2 | 2 | ||||||
MIRT672120 | ATP6V0A2 | ATPase H+ transporting V0 subunit a2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT672313 | CD3D | CD3d molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT672543 | BRMS1L | breast cancer metastasis-suppressor 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT673036 | SGPL1 | sphingosine-1-phosphate lyase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT673814 | DARS | aspartyl-tRNA synthetase | ![]() |
![]() |
2 | 2 | ||||||
MIRT674858 | GINM1 | glycoprotein integral membrane 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674970 | SH3BP2 | SH3 domain binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675185 | KIF1C | kinesin family member 1C | ![]() |
![]() |
2 | 2 | ||||||
MIRT675219 | UGDH | UDP-glucose 6-dehydrogenase | ![]() |
![]() |
2 | 2 | ||||||
MIRT675558 | MED16 | mediator complex subunit 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682566 | EIF4EBP1 | eukaryotic translation initiation factor 4E binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT684640 | PDE4C | phosphodiesterase 4C | ![]() |
![]() |
2 | 2 | ||||||
MIRT689722 | ATXN2 | ataxin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693594 | SLC39A1 | solute carrier family 39 member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT704745 | CDKN2B | cyclin dependent kinase inhibitor 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT712779 | ZNF154 | zinc finger protein 154 | ![]() |
![]() |
2 | 2 | ||||||
MIRT718118 | OTOF | otoferlin | ![]() |
![]() |
2 | 2 | ||||||
MIRT720115 | SAMD4A | sterile alpha motif domain containing 4A | ![]() |
![]() |
2 | 2 | ||||||
MIRT720275 | EIF1AD | eukaryotic translation initiation factor 1A domain containing | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|