pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-873 |
Genomic Coordinates | chr9: 28888879 - 28888955 |
Synonyms | MIRN873, hsa-mir-873, MIR873 |
Description | Homo sapiens miR-873 stem-loop |
Comment | This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques . |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | ||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-873-3p | |||||||||||||||||||||
Sequence | 46| GGAGACUGAUGAGUUCCCGGGA |67 | |||||||||||||||||||||
Evidence | Not_experimental | |||||||||||||||||||||
Experiments | ||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | CA6 | ||||||||||||||||||||
Synonyms | CA-VI, GUSTIN | ||||||||||||||||||||
Description | carbonic anhydrase 6 | ||||||||||||||||||||
Transcript | NM_001215 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on CA6 | |||||||||||||||||||||
3'UTR of CA6 (miRNA target sites are highlighted) |
>CA6|NM_001215|3'UTR 1 GGAAAGCTAAGAGGAAGATTCAATATTAACTAGCTTGAAGCCTGACCTAGCCAGAAGTGCCTGTCCGCTGCAGCCGCACC 81 CTACCTTGTCTAAGAAACCATGTGTGTCTGGAACACGCTGCTCCCCCTGGGGCAGCTGTTGGGATTCTGATTAAAAGAGG 161 GGAAACGATCATCCTGGACAGGAAGTGAGATGGCTTCAGTTCATGAGACGGGATCTGAGTTAGACATCACCAGTGGAAAT 241 TGATTGGAATAGAAACTTAAAGGAAATGGAACCCTAACTATTCTCCCATCAAATCATATATGTTGACCTGTCTGAATTAT 321 AAACCAGCCTGACCTTTCCTTTAGCATTAGATGTAATAAAATAACTTTGGAAATTTGTCATTTAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293/HeLa |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1067869. RNA binding protein: AGO2. Condition:Ago2 IP-seq (asynchronous cells)
... - Kishore S; Gruber AR; Jedlinski DJ; Syed et al., 2013, Genome biology. |
Article |
- Kishore S; Gruber AR; Jedlinski DJ; Syed et al. - Genome biology, 2013
BACKGROUND: In recent years, a variety of small RNAs derived from other RNAs with well-known functions such as tRNAs and snoRNAs, have been identified. The functional relevance of these RNAs is largely unknown. To gain insight into the complexity of snoRNA processing and the functional relevance of snoRNA-derived small RNAs, we sequence long and short RNAs, small RNAs that co-precipitate with the Argonaute 2 protein and RNA fragments obtained in photoreactive nucleotide-enhanced crosslinking and immunoprecipitation (PAR-CLIP) of core snoRNA-associated proteins. RESULTS: Analysis of these data sets reveals that many loci in the human genome reproducibly give rise to C/D box-like snoRNAs, whose expression and evolutionary conservation are typically less pronounced relative to the snoRNAs that are currently cataloged. We further find that virtually all C/D box snoRNAs are specifically processed inside the regions of terminal complementarity, retaining in the mature form only 4-5 nucleotides upstream of the C box and 2-5 nucleotides downstream of the D box. Sequencing of the total and Argonaute 2-associated populations of small RNAs reveals that despite their cellular abundance, C/D box-derived small RNAs are not efficiently incorporated into the Ago2 protein. CONCLUSIONS: We conclude that the human genome encodes a large number of snoRNAs that are processed along the canonical pathway and expressed at relatively low levels. Generation of snoRNA-derived processing products with alternative, particularly miRNA-like, functions appears to be uncommon.
LinkOut: [PMID: 23706177]
|
CLIP-seq Support 1 for dataset GSM1067869 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293/HeLa / Ago2 IP-seq (asynchronous cells) |
Location of target site | ENST00000480186.3 | 3UTR | UCACUCUGUCACCCAGGCUGGAAU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23706177 / GSE43666 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
108 hsa-miR-873-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT081178 | MIDN | midnolin | ![]() |
![]() |
2 | 4 | ||||||
MIRT109809 | ZFX | zinc finger protein, X-linked | ![]() |
![]() |
2 | 4 | ||||||
MIRT242383 | TMC5 | transmembrane channel like 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT444003 | METRN | meteorin, glial cell differentiation regulator | ![]() |
![]() |
2 | 4 | ||||||
MIRT444097 | SEPHS1 | selenophosphate synthetase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446158 | RPL12 | ribosomal protein L12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446859 | SAMD9L | sterile alpha motif domain containing 9 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT447275 | FZD5 | frizzled class receptor 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT447391 | TMPRSS15 | transmembrane protease, serine 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT448817 | FKBP1A | FK506 binding protein 1A | ![]() |
![]() |
2 | 4 | ||||||
MIRT450582 | HIST1H2BG | histone cluster 1 H2B family member g | ![]() |
![]() |
2 | 2 | ||||||
MIRT451776 | USP36 | ubiquitin specific peptidase 36 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457961 | ABCC5 | ATP binding cassette subfamily C member 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT458424 | KLHL38 | kelch like family member 38 | ![]() |
![]() |
2 | 4 | ||||||
MIRT461383 | SLFN12L | schlafen family member 12 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT467793 | SLC2A14 | solute carrier family 2 member 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT476517 | GABRB1 | gamma-aminobutyric acid type A receptor beta1 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT480290 | C7orf73 | short transmembrane mitochondrial protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT482745 | HES7 | hes family bHLH transcription factor 7 | ![]() |
![]() |
2 | 10 | ||||||
MIRT483189 | HIST1H2AH | histone cluster 1 H2A family member h | ![]() |
![]() |
2 | 6 | ||||||
MIRT486545 | DCTN4 | dynactin subunit 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT486581 | ZNF619 | zinc finger protein 619 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492604 | POLR3E | RNA polymerase III subunit E | ![]() |
![]() |
2 | 2 | ||||||
MIRT494130 | DCAF7 | DDB1 and CUL4 associated factor 7 | ![]() |
![]() |
2 | 6 | ||||||
MIRT496023 | ZBED3 | zinc finger BED-type containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT497121 | NBEAL1 | neurobeachin like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT497400 | TMEM245 | transmembrane protein 245 | ![]() |
![]() |
2 | 2 | ||||||
MIRT501410 | RANBP10 | RAN binding protein 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT510947 | PPTC7 | PTC7 protein phosphatase homolog | ![]() |
![]() |
2 | 6 | ||||||
MIRT512494 | ARID2 | AT-rich interaction domain 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT512595 | ZNF783 | zinc finger family member 783 | ![]() |
![]() |
2 | 2 | ||||||
MIRT512612 | CNTN4 | contactin 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT517808 | UGDH | UDP-glucose 6-dehydrogenase | ![]() |
![]() |
2 | 6 | ||||||
MIRT520686 | TMED7 | transmembrane p24 trafficking protein 7 | ![]() |
![]() |
2 | 4 | ||||||
MIRT526179 | HEPH | hephaestin | ![]() |
![]() |
2 | 2 | ||||||
MIRT532568 | CSTF1 | cleavage stimulation factor subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533979 | TADA2A | transcriptional adaptor 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT538622 | CCSER2 | coiled-coil serine rich protein 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT539703 | EIF3H | eukaryotic translation initiation factor 3 subunit H | ![]() |
![]() |
2 | 2 | ||||||
MIRT539806 | GAPVD1 | GTPase activating protein and VPS9 domains 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540422 | FAM83F | family with sequence similarity 83 member F | ![]() |
![]() |
2 | 2 | ||||||
MIRT540506 | CXCL10 | C-X-C motif chemokine ligand 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540619 | F2RL2 | coagulation factor II thrombin receptor like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542423 | ZNF331 | zinc finger protein 331 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542454 | AKR7A2 | aldo-keto reductase family 7 member A2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT543383 | CC2D2A | coiled-coil and C2 domain containing 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT544777 | CSTF2T | cleavage stimulation factor subunit 2 tau variant | ![]() |
![]() |
2 | 4 | ||||||
MIRT544923 | ERCC4 | ERCC excision repair 4, endonuclease catalytic subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT549768 | ZNF611 | zinc finger protein 611 | ![]() |
![]() |
2 | 4 | ||||||
MIRT551242 | COLEC10 | collectin subfamily member 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT560474 | ENSA | endosulfine alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT569738 | GPR173 | G protein-coupled receptor 173 | ![]() |
![]() |
2 | 2 | ||||||
MIRT571297 | CHCHD4 | coiled-coil-helix-coiled-coil-helix domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572345 | CKAP2L | cytoskeleton associated protein 2 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT573112 | ERBB2IP | erbb2 interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT607744 | ANGPT4 | angiopoietin 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT607903 | SPRYD4 | SPRY domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT611744 | SERPING1 | serpin family G member 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT615101 | BNC2 | basonuclin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT619124 | CD40LG | CD40 ligand | ![]() |
![]() |
2 | 2 | ||||||
MIRT625572 | ANKRD42 | ankyrin repeat domain 42 | ![]() |
![]() |
2 | 2 | ||||||
MIRT629038 | KLLN | killin, p53-regulated DNA replication inhibitor | ![]() |
![]() |
2 | 2 | ||||||
MIRT633986 | SLC35E2 | solute carrier family 35 member E2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635675 | COX18 | COX18, cytochrome c oxidase assembly factor | ![]() |
![]() |
2 | 4 | ||||||
MIRT637471 | DEFB105B | defensin beta 105B | ![]() |
![]() |
2 | 4 | ||||||
MIRT637503 | DEFB105A | defensin beta 105A | ![]() |
![]() |
2 | 4 | ||||||
MIRT639735 | MAP2K2 | mitogen-activated protein kinase kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT640730 | C9orf64 | chromosome 9 open reading frame 64 | ![]() |
![]() |
2 | 2 | ||||||
MIRT645364 | C9orf47 | chromosome 9 open reading frame 47 | ![]() |
![]() |
2 | 2 | ||||||
MIRT647938 | RNF152 | ring finger protein 152 | ![]() |
![]() |
2 | 2 | ||||||
MIRT649400 | SH2D4A | SH2 domain containing 4A | ![]() |
![]() |
2 | 2 | ||||||
MIRT656860 | KIN | Kin17 DNA and RNA binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT663470 | POFUT2 | protein O-fucosyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663507 | NKAPL | NFKB activating protein like | ![]() |
![]() |
2 | 4 | ||||||
MIRT667690 | KNSTRN | kinetochore localized astrin/SPAG5 binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT677403 | PCNP | PEST proteolytic signal containing nuclear protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT678682 | SCUBE3 | signal peptide, CUB domain and EGF like domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT678789 | NUPL2 | nucleoporin like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT680649 | KIAA1456 | KIAA1456 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682450 | MTX3 | metaxin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682740 | CA6 | carbonic anhydrase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT684421 | TUFT1 | tuftelin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690535 | TRAPPC2 | trafficking protein particle complex 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690595 | C17orf105 | chromosome 17 open reading frame 105 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690771 | PLA2G2C | phospholipase A2 group IIC | ![]() |
![]() |
2 | 2 | ||||||
MIRT692233 | ALDH1B1 | aldehyde dehydrogenase 1 family member B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693667 | MXRA7 | matrix remodeling associated 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695551 | CLPB | ClpB homolog, mitochondrial AAA ATPase chaperonin | ![]() |
![]() |
2 | 2 | ||||||
MIRT695870 | C19orf52 | translocase of inner mitochondrial membrane 29 | ![]() |
![]() |
2 | 2 | ||||||
MIRT696214 | LYZ | lysozyme | ![]() |
![]() |
2 | 2 | ||||||
MIRT698368 | TMED4 | transmembrane p24 trafficking protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700795 | PHTF2 | putative homeodomain transcription factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701640 | MYLK3 | myosin light chain kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT702989 | HERPUD2 | HERPUD family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703627 | FBXL3 | F-box and leucine rich repeat protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703783 | FAM102B | family with sequence similarity 102 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT704293 | DDX19B | DEAD-box helicase 19B | ![]() |
![]() |
2 | 2 | ||||||
MIRT704828 | CDC73 | cell division cycle 73 | ![]() |
![]() |
2 | 2 | ||||||
MIRT705014 | CAMK2N1 | calcium/calmodulin dependent protein kinase II inhibitor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT708480 | OLR1 | oxidized low density lipoprotein receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT710770 | PHF7 | PHD finger protein 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT718918 | TRIM66 | tripartite motif containing 66 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720390 | ZNF549 | zinc finger protein 549 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720593 | TTC39C | tetratricopeptide repeat domain 39C | ![]() |
![]() |
2 | 2 | ||||||
MIRT723515 | SIGLEC8 | sialic acid binding Ig like lectin 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT724458 | PRKX | protein kinase, X-linked | ![]() |
![]() |
2 | 2 | ||||||
MIRT737267 | UMAD1 | UBAP1-MVB12-associated (UMA) domain containing 1 | ![]() |
![]() |
![]() |
3 | 0 | |||||
MIRT737356 | ZIC2 | Zic family member 2 | ![]() |
![]() |
![]() |
![]() |
4 | 0 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|