pre-miRNA Information
pre-miRNA hsa-mir-4436b-1   
Genomic Coordinates chr2: 110086433 - 110086523
Description Homo sapiens miR-4436b-1 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-4436b-2   
Genomic Coordinates chr2: 110284853 - 110284943
Description Homo sapiens miR-4436b-2 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4436b-3p
Sequence 60| CAGGGCAGGAAGAAGUGGACAA |81
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs760150076 9 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FOLR1   
Synonyms FBP, FOLR
Description folate receptor 1
Transcript NM_000802   
Other Transcripts NM_016724 , NM_016725 , NM_016729   
Expression
Putative miRNA Targets on FOLR1
3'UTR of FOLR1
(miRNA target sites are highlighted)
>FOLR1|NM_000802|3'UTR
   1 CCTCCTTTTACCTTCTGATACCTGGAAATCCCTGCCCTGTTCAGCCCCACAGCTCCCAACTATTTGGTTCCTGCTCCATG
  81 GTCGGGCCTCTGACAGCCACTTTGAATAAACCAGACACCGCACATGTGTCTTGAGAATTATTTGGAAAAAAAAAAAAAAA
 161 AAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' aacaggugaagAAGGACGGGAc 5'
                     | |||||||| 
Target 5' atacctggaaaTCCCTGCCCTg 3'
18 - 39 147.00 -19.66
2
miRNA  3' aacaGGUGAA-GAAGGACGGGac 5'
              |:|:||  |||||||:|  
Target 5' ccaaCTATTTGGTTCCTGCTCca 3'
56 - 78 130.00 -16.10
3
miRNA  3' aaCAG-GUGAAGAAGGACGG-GAc 5'
            |||  :| |||  | ||| || 
Target 5' tgGTCGGGCCTCTGACAGCCACTt 3'
79 - 102 92.00 -12.01
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
306026 27 ClinVar
306027 123 ClinVar
COSN30464847 3 COSMIC
COSN13348358 26 COSMIC
COSN30447460 33 COSMIC
COSN30529200 48 COSMIC
COSN31554895 120 COSMIC
COSN26578482 121 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs764297811 2 dbSNP
rs751976542 3 dbSNP
rs922318709 13 dbSNP
rs1373082445 21 dbSNP
rs1803570 23 dbSNP
rs886048643 26 dbSNP
rs1408899528 31 dbSNP
rs757826979 36 dbSNP
rs367814110 38 dbSNP
rs1346855611 39 dbSNP
rs1351275854 43 dbSNP
rs918010760 44 dbSNP
rs1353588621 45 dbSNP
rs1407233145 48 dbSNP
rs1216595259 51 dbSNP
rs949357231 57 dbSNP
rs1166798883 66 dbSNP
rs1405836052 75 dbSNP
rs933748006 77 dbSNP
rs74674719 81 dbSNP
rs374669370 85 dbSNP
rs867191286 86 dbSNP
rs1198149368 87 dbSNP
rs1443356431 98 dbSNP
rs1267805540 104 dbSNP
rs529267619 112 dbSNP
rs547449252 120 dbSNP
rs1266639992 121 dbSNP
rs566189195 122 dbSNP
rs886048644 123 dbSNP
rs932161299 124 dbSNP
rs894397225 125 dbSNP
rs1051495168 128 dbSNP
rs190467709 129 dbSNP
rs1437117926 136 dbSNP
rs1387745759 140 dbSNP
rs1156757514 142 dbSNP
rs1458614338 146 dbSNP
rs1412308476 147 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control HITS-CLIP data was present in GSM1048188. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_ptb_knockdown ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
CLIP-seq Support 1 for dataset GSM1048187
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_control
Location of target site ENST00000393676.3 | 3UTR | UUUACCUUCUGAUACCUGGAAAUCCCUGCCCUGUUCAGCCCCACAGCUCCCAACUAUUUGGUUCCUGCUCCAUGGUCGGGCCUCUGACAGCCACUUUGAAUAAACCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1048188
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_ptb_knockdown
Location of target site ENST00000393676.3 | 3UTR | UUUACCUUCUGAUACCUGGAAAUCCCUGCCCUGUUCAGCCCCACAGCUCCCAACUAUUUGGUUCCUGCUCCAUGGUCGGGCCUCUGACAGCCACUUUGAAUAAACCAGACACCGCACA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
87 hsa-miR-4436b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT066957 ATXN7L3B ataxin 7 like 3B 2 8
MIRT119284 NABP1 nucleic acid binding protein 1 2 6
MIRT128915 KMT2A lysine methyltransferase 2A 2 2
MIRT150116 MIDN midnolin 2 2
MIRT173040 YTHDF3 YTH N6-methyladenosine RNA binding protein 3 2 2
MIRT253117 BCL2L12 BCL2 like 12 2 2
MIRT256997 RGMB repulsive guidance molecule family member b 2 2
MIRT259746 SNX12 sorting nexin 12 2 2
MIRT267278 TMEM109 transmembrane protein 109 2 2
MIRT441934 C1orf109 chromosome 1 open reading frame 109 2 2
MIRT443625 CPSF2 cleavage and polyadenylation specific factor 2 2 2
MIRT445757 AGO1 argonaute 1, RISC catalytic component 2 2
MIRT447835 CTIF cap binding complex dependent translation initiation factor 2 2
MIRT451230 ZNF444 zinc finger protein 444 2 2
MIRT451966 TMPRSS5 transmembrane protease, serine 5 2 2
MIRT453127 HOXC4 homeobox C4 2 2
MIRT454604 RPL13A ribosomal protein L13a 2 2
MIRT455176 SUV39H1 suppressor of variegation 3-9 homolog 1 2 2
MIRT455547 GJB1 gap junction protein beta 1 2 2
MIRT458197 ATP6V0A2 ATPase H+ transporting V0 subunit a2 2 2
MIRT458356 NOC2L NOC2 like nucleolar associated transcriptional repressor 2 2
MIRT458923 DNM2 dynamin 2 2 2
MIRT461013 SYT7 synaptotagmin 7 2 2
MIRT461643 ZSWIM4 zinc finger SWIM-type containing 4 2 2
MIRT461997 PACSIN1 protein kinase C and casein kinase substrate in neurons 1 2 2
MIRT462367 BCL7B BCL tumor suppressor 7B 2 2
MIRT464915 TXNIP thioredoxin interacting protein 2 2
MIRT466311 TIMM22 translocase of inner mitochondrial membrane 22 2 2
MIRT466591 TBC1D2B TBC1 domain family member 2B 2 2
MIRT467045 SRSF1 serine and arginine rich splicing factor 1 2 2
MIRT468750 SDC2 syndecan 2 2 2
MIRT468943 RPS24 ribosomal protein S24 2 2
MIRT469474 REEP5 receptor accessory protein 5 2 2
MIRT469913 PTRF caveolae associated protein 1 2 2
MIRT473325 MEX3A mex-3 RNA binding family member A 2 2
MIRT473643 MARK2 microtubule affinity regulating kinase 2 2 2
MIRT474064 LMNB2 lamin B2 2 2
MIRT474357 KMT2D lysine methyltransferase 2D 2 2
MIRT475394 ICMT isoprenylcysteine carboxyl methyltransferase 2 4
MIRT476335 GLTSCR1L BRD4 interacting chromatin remodeling complex associated protein like 2 2
MIRT478651 CTDNEP1 CTD nuclear envelope phosphatase 1 2 2
MIRT479585 CDC42SE1 CDC42 small effector 1 2 2
MIRT479943 CBX5 chromobox 5 2 2
MIRT482001 AMOTL2 angiomotin like 2 2 2
MIRT482043 AMER1 APC membrane recruitment protein 1 2 2
MIRT483070 EXT2 exostosin glycosyltransferase 2 2 6
MIRT484323 KCNH1 potassium voltage-gated channel subfamily H member 1 2 4
MIRT487528 GXYLT2 glucoside xylosyltransferase 2 2 2
MIRT489636 ALS2CL ALS2 C-terminal like 2 2
MIRT490693 SSTR1 somatostatin receptor 1 2 2
MIRT490871 UPK2 uroplakin 2 2 2
MIRT492582 PPM1L protein phosphatase, Mg2+/Mn2+ dependent 1L 2 2
MIRT492945 NEUROD2 neuronal differentiation 2 2 2
MIRT498675 SOD2 superoxide dismutase 2 2 4
MIRT499349 RAB25 RAB25, member RAS oncogene family 2 2
MIRT502338 GIGYF1 GRB10 interacting GYF protein 1 2 4
MIRT502976 CCNL1 cyclin L1 2 8
MIRT503706 NUP62 nucleoporin 62 2 2
MIRT505567 SMUG1 single-strand-selective monofunctional uracil-DNA glycosylase 1 2 2
MIRT507808 CDKN1B cyclin dependent kinase inhibitor 1B 2 2
MIRT513242 FBXO41 F-box protein 41 2 6
MIRT513586 EVX1 even-skipped homeobox 1 2 2
MIRT525036 FRK fyn related Src family tyrosine kinase 2 2
MIRT531035 TDGF1P3 teratocarcinoma-derived growth factor 1 pseudogene 3 2 2
MIRT531939 RBMS2 RNA binding motif single stranded interacting protein 2 2 2
MIRT534912 PUM2 pumilio RNA binding family member 2 2 2
MIRT535717 N4BP1 NEDD4 binding protein 1 2 2
MIRT540498 ZMAT4 zinc finger matrin-type 4 2 4
MIRT541465 AURKA aurora kinase A 2 2
MIRT554328 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 2 2
MIRT561572 SLC6A9 solute carrier family 6 member 9 2 2
MIRT564715 ZNF322P1 zinc finger protein 322 pseudogene 1 2 2
MIRT576176 Hmox1 heme oxygenase 1 2 2
MIRT629712 XKR4 XK related 4 2 2
MIRT636182 THBD thrombomodulin 2 2
MIRT646315 MPHOSPH8 M-phase phosphoprotein 8 2 2
MIRT649174 IQSEC1 IQ motif and Sec7 domain 1 2 2
MIRT666945 PMEPA1 prostate transmembrane protein, androgen induced 1 2 2
MIRT684057 FOLR1 folate receptor 1 2 2
MIRT687585 MAU2 MAU2 sister chromatid cohesion factor 2 2
MIRT689953 ZNF185 zinc finger protein 185 with LIM domain 2 2
MIRT704071 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT704327 DCUN1D5 defective in cullin neddylation 1 domain containing 5 2 2
MIRT705406 ATP1B3 ATPase Na+/K+ transporting subunit beta 3 2 2
MIRT710488 CDH5 cadherin 5 2 2
MIRT718241 LCE1A late cornified envelope 1A 2 2
MIRT723182 CDCA4 cell division cycle associated 4 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4436b-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-4436b-3p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission