pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4436b-1 |
Genomic Coordinates | chr2: 110086433 - 110086523 |
Description | Homo sapiens miR-4436b-1 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
pre-miRNA | hsa-mir-4436b-2 |
Genomic Coordinates | chr2: 110284853 - 110284943 |
Description | Homo sapiens miR-4436b-2 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||
---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4436b-3p | ||||||
Sequence | 60| CAGGGCAGGAAGAAGUGGACAA |81 | ||||||
Evidence | Experimental | ||||||
Experiments | Illumina | ||||||
SNPs in miRNA |
|
||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | FOLR1 | ||||||||||||||||||||
Synonyms | FBP, FOLR | ||||||||||||||||||||
Description | folate receptor 1 | ||||||||||||||||||||
Transcript | NM_000802 | ||||||||||||||||||||
Other Transcripts | NM_016724 , NM_016725 , NM_016729 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on FOLR1 | |||||||||||||||||||||
3'UTR of FOLR1 (miRNA target sites are highlighted) |
>FOLR1|NM_000802|3'UTR 1 CCTCCTTTTACCTTCTGATACCTGGAAATCCCTGCCCTGTTCAGCCCCACAGCTCCCAACTATTTGGTTCCTGCTCCATG 81 GTCGGGCCTCTGACAGCCACTTTGAATAAACCAGACACCGCACATGTGTCTTGAGAATTATTTGGAAAAAAAAAAAAAAA 161 AAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Hela |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control
HITS-CLIP data was present in GSM1048188. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_ptb_knockdown
... - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell. |
Article |
- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al. - Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
|
CLIP-seq Support 1 for dataset GSM1048187 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | Hela / Hela_AGO2_CLIP_control |
Location of target site | ENST00000393676.3 | 3UTR | UUUACCUUCUGAUACCUGGAAAUCCCUGCCCUGUUCAGCCCCACAGCUCCCAACUAUUUGGUUCCUGCUCCAUGGUCGGGCCUCUGACAGCCACUUUGAAUAAACCA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23313552 / GSE42701 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM1048188 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | Hela / Hela_AGO2_CLIP_ptb_knockdown |
Location of target site | ENST00000393676.3 | 3UTR | UUUACCUUCUGAUACCUGGAAAUCCCUGCCCUGUUCAGCCCCACAGCUCCCAACUAUUUGGUUCCUGCUCCAUGGUCGGGCCUCUGACAGCCACUUUGAAUAAACCAGACACCGCACA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23313552 / GSE42701 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
87 hsa-miR-4436b-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT066957 | ATXN7L3B | ataxin 7 like 3B | ![]() |
![]() |
2 | 8 | ||||||
MIRT119284 | NABP1 | nucleic acid binding protein 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT128915 | KMT2A | lysine methyltransferase 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT150116 | MIDN | midnolin | ![]() |
![]() |
2 | 2 | ||||||
MIRT173040 | YTHDF3 | YTH N6-methyladenosine RNA binding protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT253117 | BCL2L12 | BCL2 like 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT256997 | RGMB | repulsive guidance molecule family member b | ![]() |
![]() |
2 | 2 | ||||||
MIRT259746 | SNX12 | sorting nexin 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT267278 | TMEM109 | transmembrane protein 109 | ![]() |
![]() |
2 | 2 | ||||||
MIRT441934 | C1orf109 | chromosome 1 open reading frame 109 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443625 | CPSF2 | cleavage and polyadenylation specific factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT445757 | AGO1 | argonaute 1, RISC catalytic component | ![]() |
![]() |
2 | 2 | ||||||
MIRT447835 | CTIF | cap binding complex dependent translation initiation factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT451230 | ZNF444 | zinc finger protein 444 | ![]() |
![]() |
2 | 2 | ||||||
MIRT451966 | TMPRSS5 | transmembrane protease, serine 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453127 | HOXC4 | homeobox C4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454604 | RPL13A | ribosomal protein L13a | ![]() |
![]() |
2 | 2 | ||||||
MIRT455176 | SUV39H1 | suppressor of variegation 3-9 homolog 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455547 | GJB1 | gap junction protein beta 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT458197 | ATP6V0A2 | ATPase H+ transporting V0 subunit a2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT458356 | NOC2L | NOC2 like nucleolar associated transcriptional repressor | ![]() |
![]() |
2 | 2 | ||||||
MIRT458923 | DNM2 | dynamin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT461013 | SYT7 | synaptotagmin 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT461643 | ZSWIM4 | zinc finger SWIM-type containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT461997 | PACSIN1 | protein kinase C and casein kinase substrate in neurons 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT462367 | BCL7B | BCL tumor suppressor 7B | ![]() |
![]() |
2 | 2 | ||||||
MIRT464915 | TXNIP | thioredoxin interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT466311 | TIMM22 | translocase of inner mitochondrial membrane 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT466591 | TBC1D2B | TBC1 domain family member 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT467045 | SRSF1 | serine and arginine rich splicing factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468750 | SDC2 | syndecan 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468943 | RPS24 | ribosomal protein S24 | ![]() |
![]() |
2 | 2 | ||||||
MIRT469474 | REEP5 | receptor accessory protein 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT469913 | PTRF | caveolae associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT473325 | MEX3A | mex-3 RNA binding family member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT473643 | MARK2 | microtubule affinity regulating kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT474064 | LMNB2 | lamin B2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT474357 | KMT2D | lysine methyltransferase 2D | ![]() |
![]() |
2 | 2 | ||||||
MIRT475394 | ICMT | isoprenylcysteine carboxyl methyltransferase | ![]() |
![]() |
2 | 4 | ||||||
MIRT476335 | GLTSCR1L | BRD4 interacting chromatin remodeling complex associated protein like | ![]() |
![]() |
2 | 2 | ||||||
MIRT478651 | CTDNEP1 | CTD nuclear envelope phosphatase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479585 | CDC42SE1 | CDC42 small effector 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479943 | CBX5 | chromobox 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT482001 | AMOTL2 | angiomotin like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT482043 | AMER1 | APC membrane recruitment protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT483070 | EXT2 | exostosin glycosyltransferase 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT484323 | KCNH1 | potassium voltage-gated channel subfamily H member 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT487528 | GXYLT2 | glucoside xylosyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489636 | ALS2CL | ALS2 C-terminal like | ![]() |
![]() |
2 | 2 | ||||||
MIRT490693 | SSTR1 | somatostatin receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490871 | UPK2 | uroplakin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492582 | PPM1L | protein phosphatase, Mg2+/Mn2+ dependent 1L | ![]() |
![]() |
2 | 2 | ||||||
MIRT492945 | NEUROD2 | neuronal differentiation 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498675 | SOD2 | superoxide dismutase 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT499349 | RAB25 | RAB25, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT502338 | GIGYF1 | GRB10 interacting GYF protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT502976 | CCNL1 | cyclin L1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT503706 | NUP62 | nucleoporin 62 | ![]() |
![]() |
2 | 2 | ||||||
MIRT505567 | SMUG1 | single-strand-selective monofunctional uracil-DNA glycosylase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT507808 | CDKN1B | cyclin dependent kinase inhibitor 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT513242 | FBXO41 | F-box protein 41 | ![]() |
![]() |
2 | 6 | ||||||
MIRT513586 | EVX1 | even-skipped homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT525036 | FRK | fyn related Src family tyrosine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT531035 | TDGF1P3 | teratocarcinoma-derived growth factor 1 pseudogene 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531939 | RBMS2 | RNA binding motif single stranded interacting protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT534912 | PUM2 | pumilio RNA binding family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT535717 | N4BP1 | NEDD4 binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540498 | ZMAT4 | zinc finger matrin-type 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT541465 | AURKA | aurora kinase A | ![]() |
![]() |
2 | 2 | ||||||
MIRT554328 | SH3GLB1 | SH3 domain containing GRB2 like, endophilin B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT561572 | SLC6A9 | solute carrier family 6 member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564715 | ZNF322P1 | zinc finger protein 322 pseudogene 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT576176 | Hmox1 | heme oxygenase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT629712 | XKR4 | XK related 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT636182 | THBD | thrombomodulin | ![]() |
![]() |
2 | 2 | ||||||
MIRT646315 | MPHOSPH8 | M-phase phosphoprotein 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT649174 | IQSEC1 | IQ motif and Sec7 domain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT666945 | PMEPA1 | prostate transmembrane protein, androgen induced 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT684057 | FOLR1 | folate receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT687585 | MAU2 | MAU2 sister chromatid cohesion factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT689953 | ZNF185 | zinc finger protein 185 with LIM domain | ![]() |
![]() |
2 | 2 | ||||||
MIRT704071 | SRCAP | Snf2 related CREBBP activator protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT704327 | DCUN1D5 | defective in cullin neddylation 1 domain containing 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT705406 | ATP1B3 | ATPase Na+/K+ transporting subunit beta 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT710488 | CDH5 | cadherin 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT718241 | LCE1A | late cornified envelope 1A | ![]() |
![]() |
2 | 2 | ||||||
MIRT723182 | CDCA4 | cell division cycle associated 4 | ![]() |
![]() |
2 | 2 |