pre-miRNA Information
pre-miRNA hsa-mir-3160-1   
Genomic Coordinates chr11: 46451805 - 46451889
Description Homo sapiens miR-3160-1 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-3160-2   
Genomic Coordinates chr11: 46451807 - 46451887
Description Homo sapiens miR-3160-2 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3160-3p
Sequence 54| AGAGCUGAGACUAGAAAGCCCA |75
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30582333 1 COSMIC
COSN1535547 3 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1396368683 1 dbSNP
rs1162409303 2 dbSNP
rs1404378453 12 dbSNP
rs1171960732 14 dbSNP
rs1324633375 16 dbSNP
rs1187765019 16 dbSNP
rs1300058326 19 dbSNP
rs1432898407 21 dbSNP
rs1011279103 22 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GSG2
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048188. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_ptb_knockdown ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' acccgaAAGAUCAGAGUCGAGa 5'
                | | | ||||||||| 
Target 5' ------UGCGA-UCUCAGCUCa 3'
1 - 15
Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
CLIP-seq Support 1 for dataset GSM1048188
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_ptb_knockdown
Location of target site ENST00000325418.4 | 3UTR | UGCGAUCUCAGCUCACUGCAACCUCCGCCUCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
Click to see details
118 hsa-miR-3160-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT066658 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT075318 SF3B3 splicing factor 3b subunit 3 2 4
MIRT077083 EIF1 eukaryotic translation initiation factor 1 2 2
MIRT100381 HSPA1B heat shock protein family A (Hsp70) member 1B 2 6
MIRT135259 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 4
MIRT184913 ZNF268 zinc finger protein 268 2 2
MIRT218862 CDKN1A cyclin dependent kinase inhibitor 1A 2 2
MIRT446580 FPR2 formyl peptide receptor 2 2 2
MIRT448834 FGD4 FYVE, RhoGEF and PH domain containing 4 2 2
MIRT449455 RNF13 ring finger protein 13 2 2
MIRT452284 CARD8 caspase recruitment domain family member 8 2 2
MIRT452628 FAM162A family with sequence similarity 162 member A 2 2
MIRT453454 GLG1 golgi glycoprotein 1 2 2
MIRT454188 AP1S3 adaptor related protein complex 1 sigma 3 subunit 2 6
MIRT454434 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT454575 NT5DC3 5'-nucleotidase domain containing 3 2 2
MIRT455555 TRAF1 TNF receptor associated factor 1 2 6
MIRT455841 MPL MPL proto-oncogene, thrombopoietin receptor 2 6
MIRT455969 BCAS4 breast carcinoma amplified sequence 4 2 4
MIRT456805 SIGLEC14 sialic acid binding Ig like lectin 14 2 2
MIRT457320 DUSP19 dual specificity phosphatase 19 2 2
MIRT457366 POFUT2 protein O-fucosyltransferase 2 2 2
MIRT457684 ZNF587 zinc finger protein 587 2 2
MIRT458158 LYRM4 LYR motif containing 4 2 6
MIRT458641 SGPP2 sphingosine-1-phosphate phosphatase 2 2 2
MIRT459134 FADS6 fatty acid desaturase 6 2 2
MIRT459153 NARF nuclear prelamin A recognition factor 2 4
MIRT460460 NOM1 nucleolar protein with MIF4G domain 1 2 4
MIRT460974 STK17B serine/threonine kinase 17b 2 2
MIRT461439 ACSBG1 acyl-CoA synthetase bubblegum family member 1 2 2
MIRT461507 NEDD4L neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase 2 2
MIRT462490 GSR glutathione-disulfide reductase 2 2
MIRT462638 PHF5A PHD finger protein 5A 2 2
MIRT463279 ZFX zinc finger protein, X-linked 2 2
MIRT463360 ZFAND4 zinc finger AN1-type containing 4 2 2
MIRT465777 TMOD3 tropomodulin 3 2 2
MIRT466143 TMEM120B transmembrane protein 120B 2 2
MIRT468401 SETD3 SET domain containing 3 2 2
MIRT468998 RNPS1 RNA binding protein with serine rich domain 1 2 2
MIRT471574 PARD6B par-6 family cell polarity regulator beta 2 2
MIRT472108 NME2 NME/NM23 nucleoside diphosphate kinase 2 2 2
MIRT472125 NME1-NME2 NME1-NME2 readthrough 2 2
MIRT473020 MRPS14 mitochondrial ribosomal protein S14 2 2
MIRT473083 MORN4 MORN repeat containing 4 2 2
MIRT475598 HMGB2 high mobility group box 2 2 4
MIRT475937 GXYLT2 glucoside xylosyltransferase 2 2 8
MIRT476117 GPR157 G protein-coupled receptor 157 2 2
MIRT476406 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT478003 DNAL1 dynein axonemal light chain 1 2 2
MIRT487969 IQSEC2 IQ motif and Sec7 domain 2 2 2
MIRT489418 TUBB2A tubulin beta 2A class IIa 2 2
MIRT491522 IL10RA interleukin 10 receptor subunit alpha 2 2
MIRT492673 PLEC plectin 2 2
MIRT493545 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT513085 USP9X ubiquitin specific peptidase 9, X-linked 2 2
MIRT514009 CECR2 CECR2, histone acetyl-lysine reader 2 4
MIRT516683 ZNF860 zinc finger protein 860 2 2
MIRT518392 ZNF250 zinc finger protein 250 2 2
MIRT522683 LUZP1 leucine zipper protein 1 2 6
MIRT524488 CEP97 centrosomal protein 97 2 2
MIRT527457 CLEC12B C-type lectin domain family 12 member B 2 2
MIRT527705 IL17REL interleukin 17 receptor E like 2 2
MIRT531647 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT532381 UMPS uridine monophosphate synthetase 2 2
MIRT532588 MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 2 2
MIRT533555 TPM4 tropomyosin 4 2 2
MIRT548371 ENTPD5 ectonucleoside triphosphate diphosphohydrolase 5 2 4
MIRT550250 PVR poliovirus receptor 2 2
MIRT552555 ZFP36L2 ZFP36 ring finger protein like 2 2 4
MIRT554113 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 2 2
MIRT554131 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 2 2
MIRT561344 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT561638 RUNX3 runt related transcription factor 3 2 2
MIRT566497 PBX2P1 PBX homeobox 2 pseudogene 1 2 2
MIRT570583 OTUD7B OTU deubiquitinase 7B 2 2
MIRT572731 MCTS1 MCTS1, re-initiation and release factor 2 2
MIRT574041 PEX26 peroxisomal biogenesis factor 26 2 2
MIRT575231 Fut1 fucosyltransferase 1 2 2
MIRT606811 BICD2 BICD cargo adaptor 2 2 2
MIRT621016 CLSTN3 calsyntenin 3 2 2
MIRT637852 PDCL3 phosducin like 3 2 2
MIRT640477 ZNF557 zinc finger protein 557 2 2
MIRT642827 LINC00346 long intergenic non-protein coding RNA 346 2 2
MIRT643887 IMP4 IMP4, U3 small nucleolar ribonucleoprotein 2 2
MIRT664874 PCNXL2 pecanex homolog 2 2 2
MIRT680528 PRIM2 DNA primase subunit 2 2 2
MIRT680648 KIAA1456 KIAA1456 2 2
MIRT680807 ZNF578 zinc finger protein 578 2 2
MIRT680921 STX2 syntaxin 2 2 2
MIRT681112 CEP57L1 centrosomal protein 57 like 1 2 2
MIRT681147 INTS7 integrator complex subunit 7 2 2
MIRT681966 TFCP2 transcription factor CP2 2 2
MIRT684316 GTF3C4 general transcription factor IIIC subunit 4 2 2
MIRT684906 GSG2 histone H3 associated protein kinase 2 2
MIRT685499 MED16 mediator complex subunit 16 2 2
MIRT685929 MOCS3 molybdenum cofactor synthesis 3 2 2
MIRT686875 SLC25A32 solute carrier family 25 member 32 2 2
MIRT688204 FNIP1 folliculin interacting protein 1 2 2
MIRT688791 CCNB1 cyclin B1 2 2
MIRT689227 RPS19 ribosomal protein S19 2 2
MIRT690470 ZNF33A zinc finger protein 33A 2 2
MIRT691982 PLCXD1 phosphatidylinositol specific phospholipase C X domain containing 1 2 2
MIRT694006 PPIL4 peptidylprolyl isomerase like 4 2 2
MIRT694529 TRIM72 tripartite motif containing 72 2 2
MIRT695420 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 2 2
MIRT695784 HSD17B12 hydroxysteroid 17-beta dehydrogenase 12 2 2
MIRT697799 UBXN2A UBX domain protein 2A 2 2
MIRT698275 TMEM2 transmembrane protein 2 2 2
MIRT698317 TMEM136 transmembrane protein 136 2 2
MIRT699971 RREB1 ras responsive element binding protein 1 2 2
MIRT700717 PNO1 partner of NOB1 homolog 2 2
MIRT701721 MTMR12 myotubularin related protein 12 2 2
MIRT701879 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT702959 HIF1A hypoxia inducible factor 1 alpha subunit 2 2
MIRT706178 ZNF716 zinc finger protein 716 2 2
MIRT706463 SPRED1 sprouty related EVH1 domain containing 1 2 2
MIRT718154 TTC33 tetratricopeptide repeat domain 33 2 2
MIRT718711 ANKRD18A ankyrin repeat domain 18A 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3160-3p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-3160-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-3160-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-3160-3p Tripterygium wilfordii Hook F resistant tissue
hsa-miR-3160-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3160-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission