pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-124-1 |
Genomic Coordinates | chr8: 9903388 - 9903472 |
Description | Homo sapiens miR-124-1 stem-loop |
Comment | miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations. |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
pre-miRNA | hsa-mir-124-2 |
Genomic Coordinates | chr8: 64379149 - 64379257 |
Description | Homo sapiens miR-124-2 stem-loop |
Comment | miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations. |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
pre-miRNA | hsa-mir-124-3 |
Genomic Coordinates | chr20: 63178500 - 63178586 |
Description | Homo sapiens miR-124-3 stem-loop |
Comment | miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations. |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-124-5p | ||||||||||||||||||||||||||||||
Sequence | 14| CGUGUUCACAGCGGACCUUGAU |35 | ||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||
Experiments | Cloned | ||||||||||||||||||||||||||||||
Editing Events in miRNAs |
|
||||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Biomarker Information |
|
---|
Gene Information | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | POTED | ||||||||||
Synonyms | A26B3, ANKRD21, CT104.1, POTE, POTE-21, POTE21 | ||||||||||
Description | POTE ankyrin domain family member D | ||||||||||
Transcript | NM_174981 | ||||||||||
Expression | |||||||||||
Putative miRNA Targets on POTED | |||||||||||
3'UTR of POTED (miRNA target sites are highlighted) |
>POTED|NM_174981|3'UTR
1 GTACAGTGGACAGCTTAGG
Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||
DRVs in gene 3'UTRs | |||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | Hela | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1048188. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_ptb_knockdown
... - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al. - Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
|
CLIP-seq Support 1 for dataset GSM1048188 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | Hela / Hela_AGO2_CLIP_ptb_knockdown |
Location of target site | ENST00000299443.5 | 3UTR | UUGGGUUGGUUCCAAGUCUUUGCUGUUGUGAACA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23313552 / GSE42701 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
65 hsa-miR-124-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT064177 | KIAA1804 | mitogen-activated protein kinase kinase kinase 21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT069736 | FOXG1 | forkhead box G1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT086429 | NABP1 | nucleic acid binding protein 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT105334 | SLC7A2 | solute carrier family 7 member 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT110455 | PLEKHA1 | pleckstrin homology domain containing A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT172998 | YTHDF3 | YTH N6-methyladenosine RNA binding protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT196428 | TAOK1 | TAO kinase 1 | ![]() |
![]() |
2 | 14 | ||||||
MIRT325704 | CSTF2 | cleavage stimulation factor subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT365670 | TSC22D3 | TSC22 domain family member 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT365873 | XIAP | X-linked inhibitor of apoptosis | ![]() |
![]() |
2 | 2 | ||||||
MIRT404126 | ASB1 | ankyrin repeat and SOCS box containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT404626 | LCOR | ligand dependent nuclear receptor corepressor | ![]() |
![]() |
2 | 2 | ||||||
MIRT405284 | ARF1 | ADP ribosylation factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT406099 | PAGR1 | PAXIP1 associated glutamate rich protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446627 | SDC3 | syndecan 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446906 | RGS5 | regulator of G protein signaling 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT461790 | FXR2 | FMR1 autosomal homolog 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT463982 | WEE1 | WEE1 G2 checkpoint kinase | ![]() |
![]() |
2 | 4 | ||||||
MIRT464204 | VGLL4 | vestigial like family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472790 | MTMR4 | myotubularin related protein 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT473485 | MCFD2 | multiple coagulation factor deficiency 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT481124 | AZIN1 | antizyme inhibitor 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT485060 | SUCO | SUN domain containing ossification factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT487343 | HLA-DRA | major histocompatibility complex, class II, DR alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT491948 | VPS52 | VPS52, GARP complex subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT497208 | CDH7 | cadherin 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT497476 | TOR1AIP2 | torsin 1A interacting protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT528203 | NELFE | negative elongation factor complex member E | ![]() |
![]() |
2 | 2 | ||||||
MIRT529255 | TRIM4 | tripartite motif containing 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT530096 | PSAPL1 | prosaposin like 1 (gene/pseudogene) | ![]() |
![]() |
2 | 2 | ||||||
MIRT530597 | C7orf33 | chromosome 7 open reading frame 33 | ![]() |
![]() |
2 | 4 | ||||||
MIRT534980 | PSAT1 | phosphoserine aminotransferase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT538326 | CSGALNACT1 | chondroitin sulfate N-acetylgalactosaminyltransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT561237 | ZNF652 | zinc finger protein 652 | ![]() |
![]() |
2 | 2 | ||||||
MIRT562035 | KRAS | KRAS proto-oncogene, GTPase | ![]() |
![]() |
2 | 2 | ||||||
MIRT563120 | THAP5 | THAP domain containing 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563538 | RBM41 | RNA binding motif protein 41 | ![]() |
![]() |
2 | 2 | ||||||
MIRT566037 | REV3L | REV3 like, DNA directed polymerase zeta catalytic subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT566505 | PAWR | pro-apoptotic WT1 regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT566745 | MRPL35 | mitochondrial ribosomal protein L35 | ![]() |
![]() |
2 | 2 | ||||||
MIRT566850 | LRRC58 | leucine rich repeat containing 58 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568077 | CELF2 | CUGBP Elav-like family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT576826 | Tgfbr3 | transforming growth factor, beta receptor III | ![]() |
![]() |
2 | 2 | ||||||
MIRT608870 | NR2E1 | nuclear receptor subfamily 2 group E member 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT611997 | VAC14 | Vac14, PIKFYVE complex component | ![]() |
![]() |
2 | 2 | ||||||
MIRT614054 | FAM89A | family with sequence similarity 89 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT618800 | SPATA21 | spermatogenesis associated 21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT619389 | RSPH3 | radial spoke head 3 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT622282 | SH3TC2 | SH3 domain and tetratricopeptide repeats 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT624026 | EN2 | engrailed homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT626000 | MPEG1 | macrophage expressed 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641792 | USP32 | ubiquitin specific peptidase 32 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651599 | WDFY2 | WD repeat and FYVE domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT659662 | CDC73 | cell division cycle 73 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663010 | KIAA1586 | KIAA1586 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663561 | ASTN2 | astrotactin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669312 | C16orf72 | chromosome 16 open reading frame 72 | ![]() |
![]() |
2 | 2 | ||||||
MIRT685216 | POTED | POTE ankyrin domain family member D | ![]() |
![]() |
2 | 2 | ||||||
MIRT695757 | ZNF117 | zinc finger protein 117 | ![]() |
![]() |
2 | 2 | ||||||
MIRT697909 | TXNRD1 | thioredoxin reductase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT707181 | RPH3A | rabphilin 3A | ![]() |
![]() |
2 | 2 | ||||||
MIRT707214 | TRIM13 | tripartite motif containing 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT707478 | SLCO4C1 | solute carrier organic anion transporter family member 4C1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT719507 | LMAN2L | lectin, mannose binding 2 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT755814 | PARP1 | poly(ADP-ribose) polymerase 1 | 2 | 1 |
miRNA-Drug Associations | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|