pre-miRNA Information
pre-miRNA hsa-mir-6752   
Genomic Coordinates chr11: 67490245 - 67490315
Description Homo sapiens miR-6752 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6752-3p
Sequence 51| UCCCUGCCCCCAUACUCCCAG |71
Evidence Experimental
Experiments Meta-analysis
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs760443460 2 dbSNP
rs746450218 4 dbSNP
rs897972135 4 dbSNP
rs766020814 10 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PDHB   
Synonyms PDHBD, PDHE1-B, PDHE1B, PHE1B
Description pyruvate dehydrogenase E1 beta subunit
Transcript NM_000925   
Other Transcripts NM_001173468   
Expression
Putative miRNA Targets on PDHB
3'UTR of PDHB
(miRNA target sites are highlighted)
>PDHB|NM_000925|3'UTR
   1 TTTGGACTTGAATATCAAGTCGTTGAAATTTATTTGAAATACTTGCTGGCACTGCACCTGGATTTGTACTGCAAGACCTG
  81 ACTATTCATAACGGAAAACGATTTCTAAAGCAACAGCAGGTATTTTTGTACAGGGAAGTTTAAATGTGTTTGTGTATGGA
 161 AAACTCTCCACTCTCCTCCCCTAGATGCCATGCTTCCTTTTGTCTGTTACGGTTGCCATGTTCTTTGAATAACAAATTAT
 241 ATAACATTTTATCCTCTCTCACCACAAGGACAAAGTATGGATGTGGCAGAGTCCTCATGAAAGATGTATCCAAACAAGAT
 321 AACTTATATGTATAAAATTAAAGCATATAATATACATTTACTGTTAGTTTGTTTTGATAAGGAATAAAGGAATTTCTAAC
 401 ATGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' gacccUCAUACC--C-CCGUCCCu 5'
               |||||||  | ||||| | 
Target 5' gacaaAGTATGGATGTGGCAGAGt 3'
269 - 292 130.00 -15.10
2
miRNA  3' gacccucauaccccCGUCCcu 5'
                        |||||  
Target 5' tttctaaagcaacaGCAGGta 3'
102 - 122 100.00 -5.90
3
miRNA  3' gacccucauacccccGUCCCU------ 5'
                         ||||||      
Target 5' gcaggtatttttgtaCAGGGAAGTTTA 3'
116 - 142 82.00 -10.82
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
991895 7 ClinVar
899977 77 ClinVar
346403 92 ClinVar
346402 99 ClinVar
899976 160 ClinVar
899975 173 ClinVar
346401 199 ClinVar
903459 201 ClinVar
1208382 204 ClinVar
346400 243 ClinVar
346399 296 ClinVar
903458 328 ClinVar
346398 353 ClinVar
346397 356 ClinVar
346396 360 ClinVar
902608 365 ClinVar
346395 367 ClinVar
COSN228580 1 COSMIC
COSN30521345 16 COSMIC
COSN30166840 72 COSMIC
COSN30162092 79 COSMIC
COSN18728284 99 COSMIC
COSN31572933 122 COSMIC
COSN31564559 129 COSMIC
COSN16340471 156 COSMIC
COSN31561031 192 COSMIC
COSN1954682 345 COSMIC
COSN27723019 360 COSMIC
COSN1954680 366 COSMIC
COSN16058677 367 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs780059698 4 dbSNP
rs1386862916 5 dbSNP
rs374476885 7 dbSNP
rs1287803524 8 dbSNP
rs1419929280 14 dbSNP
rs748490971 14 dbSNP
rs1346937052 18 dbSNP
rs370072205 22 dbSNP
rs547747406 31 dbSNP
rs1393051554 34 dbSNP
rs751173808 43 dbSNP
rs781681934 46 dbSNP
rs1455774154 48 dbSNP
rs1268089899 49 dbSNP
rs1003377708 52 dbSNP
rs1485175090 53 dbSNP
rs1377862340 57 dbSNP
rs763659400 69 dbSNP
rs758137448 71 dbSNP
rs754190213 72 dbSNP
rs1301739057 76 dbSNP
rs766780930 77 dbSNP
rs1189089606 80 dbSNP
rs761142168 84 dbSNP
rs1281858855 85 dbSNP
rs773743199 86 dbSNP
rs767589310 87 dbSNP
rs761809361 88 dbSNP
rs4228 92 dbSNP
rs1012192856 94 dbSNP
rs1373355574 95 dbSNP
rs1264429723 96 dbSNP
rs555536762 97 dbSNP
rs7230 99 dbSNP
rs745760468 100 dbSNP
rs547008035 101 dbSNP
rs1426748473 106 dbSNP
rs140169849 112 dbSNP
rs780817297 115 dbSNP
rs1179178002 116 dbSNP
rs1194980191 116 dbSNP
rs746496960 117 dbSNP
rs1278602243 120 dbSNP
rs1236653341 124 dbSNP
rs1213515328 125 dbSNP
rs1439309387 128 dbSNP
rs971188572 130 dbSNP
rs755440612 136 dbSNP
rs1224805946 139 dbSNP
rs1397223612 149 dbSNP
rs1327609065 150 dbSNP
rs777401294 151 dbSNP
rs886486487 157 dbSNP
rs1175903185 171 dbSNP
rs546485141 173 dbSNP
rs369712686 175 dbSNP
rs1332774812 179 dbSNP
rs1353541792 181 dbSNP
rs1314457298 185 dbSNP
rs1396446163 190 dbSNP
rs1325931358 197 dbSNP
rs1395520542 198 dbSNP
rs886058777 199 dbSNP
rs375277648 201 dbSNP
rs146644840 204 dbSNP
rs756497263 205 dbSNP
rs1431892654 206 dbSNP
rs1475148143 210 dbSNP
rs750876078 211 dbSNP
rs1308004105 221 dbSNP
rs866161531 229 dbSNP
rs1190498665 234 dbSNP
rs767911301 239 dbSNP
rs1206790610 241 dbSNP
rs1126722 243 dbSNP
rs367907119 253 dbSNP
rs904367634 258 dbSNP
rs1448778075 259 dbSNP
rs1341069230 261 dbSNP
rs1258121611 264 dbSNP
rs1232196743 268 dbSNP
rs1332568218 274 dbSNP
rs530847041 285 dbSNP
rs1200918505 290 dbSNP
rs947611909 295 dbSNP
rs7231 296 dbSNP
rs1334905351 302 dbSNP
rs1397449903 304 dbSNP
rs548321877 307 dbSNP
rs1326630386 309 dbSNP
rs1389867739 311 dbSNP
rs1402778769 318 dbSNP
rs989068745 319 dbSNP
rs1326098350 321 dbSNP
rs1461042635 322 dbSNP
rs764281059 323 dbSNP
rs763235215 327 dbSNP
rs1219751824 330 dbSNP
rs956615626 330 dbSNP
rs923708204 332 dbSNP
rs1165438796 335 dbSNP
rs528568497 337 dbSNP
rs1051520732 343 dbSNP
rs1473430848 347 dbSNP
rs775884188 350 dbSNP
rs1274016985 352 dbSNP
rs1126735 353 dbSNP
rs1126737 356 dbSNP
rs886058776 360 dbSNP
rs1458795094 361 dbSNP
rs1238483375 363 dbSNP
rs1212693384 364 dbSNP
rs1023863848 365 dbSNP
rs1274534298 366 dbSNP
rs886058775 367 dbSNP
rs1012098109 368 dbSNP
rs973656736 370 dbSNP
rs770760887 371 dbSNP
rs1450067384 372 dbSNP
rs752036587 374 dbSNP
rs1221356795 375 dbSNP
rs577439548 375 dbSNP
rs1234629503 377 dbSNP
rs747019479 390 dbSNP
rs1330843592 395 dbSNP
rs1440452986 396 dbSNP
rs1392325643 400 dbSNP
rs1325635875 401 dbSNP
rs1406441428 405 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048188. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_ptb_knockdown ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' gaCCCUCAUACCCCCGUcccu 5'
            |||||  | | ||||    
Target 5' uuGGGAGGCU-GAGGCA---- 3'
21 - 36
Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
CLIP-seq Support 1 for dataset GSM1048188
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_ptb_knockdown
Location of target site ENST00000474765.1 | 3UTR | AUGCCUAUAAUCCCAGCACUUUGGGAGGCUGAGGCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
110 hsa-miR-6752-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT152341 TNFSF9 TNF superfamily member 9 2 2
MIRT273594 SP1 Sp1 transcription factor 2 2
MIRT291927 TPM4 tropomyosin 4 2 4
MIRT311186 ANKRD33B ankyrin repeat domain 33B 2 4
MIRT378521 CDKN1A cyclin dependent kinase inhibitor 1A 2 4
MIRT452467 SORCS2 sortilin related VPS10 domain containing receptor 2 2 2
MIRT478636 CTDNEP1 CTD nuclear envelope phosphatase 1 2 2
MIRT496343 TMEM81 transmembrane protein 81 2 2
MIRT496646 MFAP3 microfibril associated protein 3 2 2
MIRT496711 DNAJC30 DnaJ heat shock protein family (Hsp40) member C30 2 2
MIRT499242 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT519777 ZNF354B zinc finger protein 354B 2 6
MIRT520883 STX17 syntaxin 17 2 2
MIRT522476 ZAK mitogen-activated protein kinase kinase kinase 20 2 2
MIRT523587 G3BP2 G3BP stress granule assembly factor 2 2 6
MIRT525240 KCNJ12 potassium voltage-gated channel subfamily J member 12 2 2
MIRT527025 PABPN1L poly(A) binding protein nuclear 1 like, cytoplasmic 2 2
MIRT527709 IL17REL interleukin 17 receptor E like 2 2
MIRT530778 GPD1 glycerol-3-phosphate dehydrogenase 1 2 2
MIRT531883 SCN1B sodium voltage-gated channel beta subunit 1 2 2
MIRT533043 ZBTB46 zinc finger and BTB domain containing 46 2 2
MIRT535062 PPP2R5D protein phosphatase 2 regulatory subunit B'delta 2 4
MIRT536512 KCTD15 potassium channel tetramerization domain containing 15 2 2
MIRT543793 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 2 2
MIRT563977 HCFC1 host cell factor C1 2 2
MIRT569472 MAN2A2 mannosidase alpha class 2A member 2 2 2
MIRT570600 NFIX nuclear factor I X 2 2
MIRT571402 MED4 mediator complex subunit 4 2 2
MIRT608418 PPIC peptidylprolyl isomerase C 2 6
MIRT608928 REXO2 RNA exonuclease 2 2 4
MIRT609357 ZNF664 zinc finger protein 664 2 2
MIRT611189 WBSCR17 polypeptide N-acetylgalactosaminyltransferase 17 2 4
MIRT615266 DPF2 double PHD fingers 2 2 2
MIRT615408 VDAC2 voltage dependent anion channel 2 2 2
MIRT616323 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT616566 ZNF512B zinc finger protein 512B 2 2
MIRT616745 TAZ tafazzin 2 2
MIRT617316 MBOAT1 membrane bound O-acyltransferase domain containing 1 2 2
MIRT620030 NFAM1 NFAT activating protein with ITAM motif 1 2 2
MIRT621166 RTTN rotatin 2 2
MIRT623501 KCNQ3 potassium voltage-gated channel subfamily Q member 3 2 2
MIRT623524 KCNK10 potassium two pore domain channel subfamily K member 10 2 2
MIRT629683 TNFAIP8L1 TNF alpha induced protein 8 like 1 2 2
MIRT630795 TGIF2 TGFB induced factor homeobox 2 2 2
MIRT634638 HIP1 huntingtin interacting protein 1 2 4
MIRT636788 RAB40B RAB40B, member RAS oncogene family 2 2
MIRT640332 DAAM2 dishevelled associated activator of morphogenesis 2 2 2
MIRT640557 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 2
MIRT643319 TMEM151B transmembrane protein 151B 2 2
MIRT643991 DUSP28 dual specificity phosphatase 28 2 2
MIRT644618 CD300E CD300e molecule 2 2
MIRT646445 XRCC2 X-ray repair cross complementing 2 2 2
MIRT648020 SLCO4C1 solute carrier organic anion transporter family member 4C1 2 2
MIRT648077 ZMIZ2 zinc finger MIZ-type containing 2 2 2
MIRT649618 ITPKC inositol-trisphosphate 3-kinase C 2 2
MIRT650414 ZNF442 zinc finger protein 442 2 2
MIRT650850 SEMA4G semaphorin 4G 2 2
MIRT654694 PSMB5 proteasome subunit beta 5 2 2
MIRT655512 PAIP2B poly(A) binding protein interacting protein 2B 2 2
MIRT657620 GRAP2 GRB2-related adaptor protein 2 2 2
MIRT658009 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 2 2
MIRT658329 FAM83F family with sequence similarity 83 member F 2 2
MIRT658832 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT658920 DPY19L4 dpy-19 like 4 2 2
MIRT661058 RPL18A ribosomal protein L18a 2 2
MIRT662342 MYLK3 myosin light chain kinase 3 2 2
MIRT663451 FBXO2 F-box protein 2 2 2
MIRT676752 SGTB small glutamine rich tetratricopeptide repeat containing beta 2 4
MIRT684705 LRRD1 leucine rich repeats and death domain containing 1 2 2
MIRT687247 PDHB pyruvate dehydrogenase E1 beta subunit 2 2
MIRT693881 NT5C2 5'-nucleotidase, cytosolic II 2 2
MIRT693922 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT695921 ZNF174 zinc finger protein 174 2 2
MIRT702867 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT708863 TMSB4X thymosin beta 4, X-linked 2 2
MIRT708936 CRY2 cryptochrome circadian clock 2 2 2
MIRT709476 FAXC failed axon connections homolog 2 2
MIRT709752 UBD ubiquitin D 2 2
MIRT710128 VANGL2 VANGL planar cell polarity protein 2 2 2
MIRT710274 FAM107A family with sequence similarity 107 member A 2 2
MIRT711146 TMEM174 transmembrane protein 174 2 2
MIRT712582 ATP2B4 ATPase plasma membrane Ca2+ transporting 4 2 2
MIRT712648 TXNL4A thioredoxin like 4A 2 2
MIRT713325 TMEM44 transmembrane protein 44 2 2
MIRT713413 PEX16 peroxisomal biogenesis factor 16 2 2
MIRT713891 RNF19B ring finger protein 19B 2 2
MIRT714549 COL14A1 collagen type XIV alpha 1 chain 2 2
MIRT714809 ARHGEF19 Rho guanine nucleotide exchange factor 19 2 2
MIRT714840 SCAMP2 secretory carrier membrane protein 2 2 2
MIRT715779 DDX42 DEAD-box helicase 42 2 2
MIRT715795 TBL3 transducin beta like 3 2 2
MIRT716088 RNF150 ring finger protein 150 2 2
MIRT716712 IMP4 IMP4, U3 small nucleolar ribonucleoprotein 2 2
MIRT716737 APOL6 apolipoprotein L6 2 2
MIRT717069 MTMR6 myotubularin related protein 6 2 2
MIRT718185 HLCS holocarboxylase synthetase 2 2
MIRT719386 SECTM1 secreted and transmembrane 1 2 2
MIRT720679 SLC39A13 solute carrier family 39 member 13 2 2
MIRT721315 FAM58A cyclin Q 2 2
MIRT721396 LDLRAD4 low density lipoprotein receptor class A domain containing 4 2 2
MIRT721896 ITPR2 inositol 1,4,5-trisphosphate receptor type 2 2 2
MIRT722442 ZBTB7B zinc finger and BTB domain containing 7B 2 2
MIRT723009 FADS1 fatty acid desaturase 1 2 2
MIRT723675 CTC1 CST telomere replication complex component 1 2 2
MIRT723774 ROBO4 roundabout guidance receptor 4 2 2
MIRT723814 OR1L8 olfactory receptor family 1 subfamily L member 8 2 2
MIRT723959 TMEM184A transmembrane protein 184A 2 2
MIRT724449 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT724798 C1D C1D nuclear receptor corepressor 2 2
MIRT725626 CAMKV CaM kinase like vesicle associated 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-6752-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-6752-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)

Error report submission