pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6752 |
Genomic Coordinates | chr11: 67490245 - 67490315 |
Description | Homo sapiens miR-6752 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6752-3p | |||||||||||||||
Sequence | 51| UCCCUGCCCCCAUACUCCCAG |71 | |||||||||||||||
Evidence | Experimental | |||||||||||||||
Experiments | Meta-analysis | |||||||||||||||
SNPs in miRNA |
|
|||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | PDHB | ||||||||||||||||||||
Synonyms | PDHBD, PDHE1-B, PDHE1B, PHE1B | ||||||||||||||||||||
Description | pyruvate dehydrogenase E1 beta subunit | ||||||||||||||||||||
Transcript | NM_000925 | ||||||||||||||||||||
Other Transcripts | NM_001173468 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on PDHB | |||||||||||||||||||||
3'UTR of PDHB (miRNA target sites are highlighted) |
>PDHB|NM_000925|3'UTR 1 TTTGGACTTGAATATCAAGTCGTTGAAATTTATTTGAAATACTTGCTGGCACTGCACCTGGATTTGTACTGCAAGACCTG 81 ACTATTCATAACGGAAAACGATTTCTAAAGCAACAGCAGGTATTTTTGTACAGGGAAGTTTAAATGTGTTTGTGTATGGA 161 AAACTCTCCACTCTCCTCCCCTAGATGCCATGCTTCCTTTTGTCTGTTACGGTTGCCATGTTCTTTGAATAACAAATTAT 241 ATAACATTTTATCCTCTCTCACCACAAGGACAAAGTATGGATGTGGCAGAGTCCTCATGAAAGATGTATCCAAACAAGAT 321 AACTTATATGTATAAAATTAAAGCATATAATATACATTTACTGTTAGTTTGTTTTGATAAGGAATAAAGGAATTTCTAAC 401 ATGAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | Hela | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1048188. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_ptb_knockdown
... - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al. - Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
|
CLIP-seq Support 1 for dataset GSM1048188 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | Hela / Hela_AGO2_CLIP_ptb_knockdown |
Location of target site | ENST00000474765.1 | 3UTR | AUGCCUAUAAUCCCAGCACUUUGGGAGGCUGAGGCA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23313552 / GSE42701 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
110 hsa-miR-6752-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT152341 | TNFSF9 | TNF superfamily member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT273594 | SP1 | Sp1 transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT291927 | TPM4 | tropomyosin 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT311186 | ANKRD33B | ankyrin repeat domain 33B | ![]() |
![]() |
2 | 4 | ||||||
MIRT378521 | CDKN1A | cyclin dependent kinase inhibitor 1A | ![]() |
![]() |
2 | 4 | ||||||
MIRT452467 | SORCS2 | sortilin related VPS10 domain containing receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT478636 | CTDNEP1 | CTD nuclear envelope phosphatase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496343 | TMEM81 | transmembrane protein 81 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496646 | MFAP3 | microfibril associated protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496711 | DNAJC30 | DnaJ heat shock protein family (Hsp40) member C30 | ![]() |
![]() |
2 | 2 | ||||||
MIRT499242 | VAV3 | vav guanine nucleotide exchange factor 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT519777 | ZNF354B | zinc finger protein 354B | ![]() |
![]() |
2 | 6 | ||||||
MIRT520883 | STX17 | syntaxin 17 | ![]() |
![]() |
2 | 2 | ||||||
MIRT522476 | ZAK | mitogen-activated protein kinase kinase kinase 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT523587 | G3BP2 | G3BP stress granule assembly factor 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT525240 | KCNJ12 | potassium voltage-gated channel subfamily J member 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT527025 | PABPN1L | poly(A) binding protein nuclear 1 like, cytoplasmic | ![]() |
![]() |
2 | 2 | ||||||
MIRT527709 | IL17REL | interleukin 17 receptor E like | ![]() |
![]() |
2 | 2 | ||||||
MIRT530778 | GPD1 | glycerol-3-phosphate dehydrogenase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531883 | SCN1B | sodium voltage-gated channel beta subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533043 | ZBTB46 | zinc finger and BTB domain containing 46 | ![]() |
![]() |
2 | 2 | ||||||
MIRT535062 | PPP2R5D | protein phosphatase 2 regulatory subunit B'delta | ![]() |
![]() |
2 | 4 | ||||||
MIRT536512 | KCTD15 | potassium channel tetramerization domain containing 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT543793 | RALGAPB | Ral GTPase activating protein non-catalytic beta subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT563977 | HCFC1 | host cell factor C1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569472 | MAN2A2 | mannosidase alpha class 2A member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570600 | NFIX | nuclear factor I X | ![]() |
![]() |
2 | 2 | ||||||
MIRT571402 | MED4 | mediator complex subunit 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT608418 | PPIC | peptidylprolyl isomerase C | ![]() |
![]() |
2 | 6 | ||||||
MIRT608928 | REXO2 | RNA exonuclease 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT609357 | ZNF664 | zinc finger protein 664 | ![]() |
![]() |
2 | 2 | ||||||
MIRT611189 | WBSCR17 | polypeptide N-acetylgalactosaminyltransferase 17 | ![]() |
![]() |
2 | 4 | ||||||
MIRT615266 | DPF2 | double PHD fingers 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT615408 | VDAC2 | voltage dependent anion channel 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT616323 | AGO3 | argonaute 3, RISC catalytic component | ![]() |
![]() |
2 | 2 | ||||||
MIRT616566 | ZNF512B | zinc finger protein 512B | ![]() |
![]() |
2 | 2 | ||||||
MIRT616745 | TAZ | tafazzin | ![]() |
![]() |
2 | 2 | ||||||
MIRT617316 | MBOAT1 | membrane bound O-acyltransferase domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT620030 | NFAM1 | NFAT activating protein with ITAM motif 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT621166 | RTTN | rotatin | ![]() |
![]() |
2 | 2 | ||||||
MIRT623501 | KCNQ3 | potassium voltage-gated channel subfamily Q member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT623524 | KCNK10 | potassium two pore domain channel subfamily K member 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT629683 | TNFAIP8L1 | TNF alpha induced protein 8 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT630795 | TGIF2 | TGFB induced factor homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT634638 | HIP1 | huntingtin interacting protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT636788 | RAB40B | RAB40B, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT640332 | DAAM2 | dishevelled associated activator of morphogenesis 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT640557 | SMCR8 | Smith-Magenis syndrome chromosome region, candidate 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT643319 | TMEM151B | transmembrane protein 151B | ![]() |
![]() |
2 | 2 | ||||||
MIRT643991 | DUSP28 | dual specificity phosphatase 28 | ![]() |
![]() |
2 | 2 | ||||||
MIRT644618 | CD300E | CD300e molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT646445 | XRCC2 | X-ray repair cross complementing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648020 | SLCO4C1 | solute carrier organic anion transporter family member 4C1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648077 | ZMIZ2 | zinc finger MIZ-type containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT649618 | ITPKC | inositol-trisphosphate 3-kinase C | ![]() |
![]() |
2 | 2 | ||||||
MIRT650414 | ZNF442 | zinc finger protein 442 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650850 | SEMA4G | semaphorin 4G | ![]() |
![]() |
2 | 2 | ||||||
MIRT654694 | PSMB5 | proteasome subunit beta 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT655512 | PAIP2B | poly(A) binding protein interacting protein 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT657620 | GRAP2 | GRB2-related adaptor protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT658009 | GALNT10 | polypeptide N-acetylgalactosaminyltransferase 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT658329 | FAM83F | family with sequence similarity 83 member F | ![]() |
![]() |
2 | 2 | ||||||
MIRT658832 | SRCAP | Snf2 related CREBBP activator protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT658920 | DPY19L4 | dpy-19 like 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT661058 | RPL18A | ribosomal protein L18a | ![]() |
![]() |
2 | 2 | ||||||
MIRT662342 | MYLK3 | myosin light chain kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663451 | FBXO2 | F-box protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT676752 | SGTB | small glutamine rich tetratricopeptide repeat containing beta | ![]() |
![]() |
2 | 4 | ||||||
MIRT684705 | LRRD1 | leucine rich repeats and death domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT687247 | PDHB | pyruvate dehydrogenase E1 beta subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT693881 | NT5C2 | 5'-nucleotidase, cytosolic II | ![]() |
![]() |
2 | 2 | ||||||
MIRT693922 | HNRNPA1L2 | heterogeneous nuclear ribonucleoprotein A1-like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695921 | ZNF174 | zinc finger protein 174 | ![]() |
![]() |
2 | 2 | ||||||
MIRT702867 | HNRNPA1 | heterogeneous nuclear ribonucleoprotein A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT708863 | TMSB4X | thymosin beta 4, X-linked | ![]() |
![]() |
2 | 2 | ||||||
MIRT708936 | CRY2 | cryptochrome circadian clock 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT709476 | FAXC | failed axon connections homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT709752 | UBD | ubiquitin D | ![]() |
![]() |
2 | 2 | ||||||
MIRT710128 | VANGL2 | VANGL planar cell polarity protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT710274 | FAM107A | family with sequence similarity 107 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT711146 | TMEM174 | transmembrane protein 174 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712582 | ATP2B4 | ATPase plasma membrane Ca2+ transporting 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712648 | TXNL4A | thioredoxin like 4A | ![]() |
![]() |
2 | 2 | ||||||
MIRT713325 | TMEM44 | transmembrane protein 44 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713413 | PEX16 | peroxisomal biogenesis factor 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713891 | RNF19B | ring finger protein 19B | ![]() |
![]() |
2 | 2 | ||||||
MIRT714549 | COL14A1 | collagen type XIV alpha 1 chain | ![]() |
![]() |
2 | 2 | ||||||
MIRT714809 | ARHGEF19 | Rho guanine nucleotide exchange factor 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT714840 | SCAMP2 | secretory carrier membrane protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715779 | DDX42 | DEAD-box helicase 42 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715795 | TBL3 | transducin beta like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT716088 | RNF150 | ring finger protein 150 | ![]() |
![]() |
2 | 2 | ||||||
MIRT716712 | IMP4 | IMP4, U3 small nucleolar ribonucleoprotein | ![]() |
![]() |
2 | 2 | ||||||
MIRT716737 | APOL6 | apolipoprotein L6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT717069 | MTMR6 | myotubularin related protein 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT718185 | HLCS | holocarboxylase synthetase | ![]() |
![]() |
2 | 2 | ||||||
MIRT719386 | SECTM1 | secreted and transmembrane 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720679 | SLC39A13 | solute carrier family 39 member 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT721315 | FAM58A | cyclin Q | ![]() |
![]() |
2 | 2 | ||||||
MIRT721396 | LDLRAD4 | low density lipoprotein receptor class A domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT721896 | ITPR2 | inositol 1,4,5-trisphosphate receptor type 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT722442 | ZBTB7B | zinc finger and BTB domain containing 7B | ![]() |
![]() |
2 | 2 | ||||||
MIRT723009 | FADS1 | fatty acid desaturase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT723675 | CTC1 | CST telomere replication complex component 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT723774 | ROBO4 | roundabout guidance receptor 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT723814 | OR1L8 | olfactory receptor family 1 subfamily L member 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT723959 | TMEM184A | transmembrane protein 184A | ![]() |
![]() |
2 | 2 | ||||||
MIRT724449 | OPA3 | OPA3, outer mitochondrial membrane lipid metabolism regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT724798 | C1D | C1D nuclear receptor corepressor | ![]() |
![]() |
2 | 2 | ||||||
MIRT725626 | CAMKV | CaM kinase like vesicle associated | ![]() |
![]() |
2 | 2 |