pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-3192 |
Genomic Coordinates | chr20: 18470615 - 18470691 |
Description | Homo sapiens miR-3192 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-3192-5p | |||||||||||||||||||||||||||
Sequence | 10| UCUGGGAGGUUGUAGCAGUGGAA |32 | |||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||
Experiments | Illumina | |||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | LRIG2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | LIG-2, LIG2, UFS2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | leucine rich repeats and immunoglobulin like domains 2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_014813 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on LRIG2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of LRIG2 (miRNA target sites are highlighted) |
>LRIG2|NM_014813|3'UTR 1 AACTCACTTCAGGATGAAATCTGGGCAGAGACTTATTAATTAATTTTGCATTTACTACCTCAGAGCTCAGAAGAAACTCC 81 GAAGTCAGCATTTGCTTTACTCTTTCTTTATGATTGCATCTGACCGCACCAAGGTGGGCCATGCGTTGTTTGGTCTTATA 161 CCTGATGAAGAAATGGCAACAGCTGACAGAAATGGGTACAGCTCATCAAAAATGTGCAGCACCGGCAGAGGGAAGATACG 241 GGGCAAATGTGCTTCCTGATGCTTCCATGGGGATGTGCCCTGGTGTGCATCTGCTTGTCAGGAAGAGTCACATTGCTGCT 321 TAACATGCTGGATTGCCCTAGTCTTCAGAATGGTCCTGAGAAAACATCACTACTTCGATGTTCTACTTTGCTTTCCAAGG 401 AGCAAAAATAACTTTGGAGCCTTCTGGGAAGTGTGCCTGGGATTCTTCAGTGGTTTCAGGCAGATAGTTGAGACTGGGGC 481 TTTGATATTCAAGGTCTTTGGCAAGAATCCCAGGCTTGACCAACTGGTACCAGGTCAAAGATTTTTGTATTCTTGTGAAT 561 TTTTTTTTTTGTCCCTATTGCCCAGGGATGTCATTGTAAATATATGTGCATTTATAAATAATTTTTGTATTCATTGACCA 641 TATGTGTTGGCTGCAATGTAAATATTTTTGATATGCCAAAATTATATGTAATATCCAGTTATAATATTGACAAGTAGCTT 721 CTCAGATCACAGATTTTAAATAACTCAATTTAGTGAGATCTAAAAATTTTATTTAAAGTATAAAAACTGTGGCTCACACC 801 TGTAATCCCAGCATTTTGAGAGGCTAAGGTGGGAGGATTGCTTGAGGCCAGGAATTTGAGACCAGGCTGGGCAACATGGT 881 GAGACCCTGTGTCTGCAAAAAAATAAATTAAAAAAATAGGTGGACATTGTGGCATGCTGCTGTAGTCCTAGCTACTTGGG 961 AGGCTGAGGTGGGAGGGTCACTTGAGCCCGGGAAATCAAGGCTGCAGTGAGCTGTGTGAAGCCACTGCATCCCAGCCTGG 1041 GTGACAGAGTGAGGCCCTGGCTCAAAAGTAAAATAAATAAATAAAAAGTTTTAAAAACTTAAAAAAAAAAAAAAAAAAAA 1121 AAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | Hela | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1048188. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_ptb_knockdown
... - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al. - Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
|
CLIP-seq Support 1 for dataset GSM1048188 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | Hela / Hela_AGO2_CLIP_ptb_knockdown |
Location of target site | ENST00000361127.5 | 3UTR | AUCUCCGCCUCCCAGGUUCAAGCGA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23313552 / GSE42701 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
167 hsa-miR-3192-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT058548 | CTTNBP2NL | CTTNBP2 N-terminal like | ![]() |
![]() |
2 | 2 | ||||||
MIRT139892 | BTF3L4 | basic transcription factor 3 like 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT207395 | MAT2A | methionine adenosyltransferase 2A | ![]() |
![]() |
2 | 6 | ||||||
MIRT294640 | ZNF548 | zinc finger protein 548 | ![]() |
![]() |
2 | 2 | ||||||
MIRT324251 | GAPVD1 | GTPase activating protein and VPS9 domains 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT441475 | BEST3 | bestrophin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT445233 | SRGAP2 | SLIT-ROBO Rho GTPase activating protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446763 | ZNF491 | zinc finger protein 491 | ![]() |
![]() |
2 | 2 | ||||||
MIRT451003 | EPS15L1 | epidermal growth factor receptor pathway substrate 15 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452436 | QDPR | quinoid dihydropteridine reductase | ![]() |
![]() |
2 | 2 | ||||||
MIRT452582 | ZFP69B | ZFP69 zinc finger protein B | ![]() |
![]() |
2 | 2 | ||||||
MIRT452950 | DISC1 | disrupted in schizophrenia 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453309 | ZNF394 | zinc finger protein 394 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453810 | KBTBD12 | kelch repeat and BTB domain containing 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454101 | TMEM209 | transmembrane protein 209 | ![]() |
![]() |
2 | 2 | ||||||
MIRT456228 | LIX1L | limb and CNS expressed 1 like | ![]() |
![]() |
2 | 4 | ||||||
MIRT456738 | TMEM239 | transmembrane protein 239 | ![]() |
![]() |
2 | 2 | ||||||
MIRT456806 | SIGLEC14 | sialic acid binding Ig like lectin 14 | ![]() |
![]() |
2 | 4 | ||||||
MIRT457499 | SLC35F6 | solute carrier family 35 member F6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT458037 | MRPL12 | mitochondrial ribosomal protein L12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459041 | ZNF490 | zinc finger protein 490 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459135 | FADS6 | fatty acid desaturase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT460126 | CXCL16 | C-X-C motif chemokine ligand 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT460506 | FAM105A | family with sequence similarity 105 member A | ![]() |
![]() |
2 | 6 | ||||||
MIRT460944 | NOA1 | nitric oxide associated 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT461101 | OPA3 | OPA3, outer mitochondrial membrane lipid metabolism regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT462641 | PHF5A | PHD finger protein 5A | ![]() |
![]() |
2 | 2 | ||||||
MIRT463584 | ZBTB38 | zinc finger and BTB domain containing 38 | ![]() |
![]() |
2 | 2 | ||||||
MIRT466567 | TBL1XR1 | transducin beta like 1 X-linked receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT467090 | SRRD | SRR1 domain containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT471093 | PIK3C2B | phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT472596 | NACC1 | nucleus accumbens associated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT473084 | MORN4 | MORN repeat containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT475977 | GTPBP2 | GTP binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT477054 | FAM210A | family with sequence similarity 210 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT478303 | DDX19A | DEAD-box helicase 19A | ![]() |
![]() |
2 | 4 | ||||||
MIRT478489 | CYP20A1 | cytochrome P450 family 20 subfamily A member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT478500 | CYP1B1 | cytochrome P450 family 1 subfamily B member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT478858 | CRISPLD2 | cysteine rich secretory protein LCCL domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479096 | CNNM4 | cyclin and CBS domain divalent metal cation transport mediator 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479180 | CLSPN | claspin | ![]() |
![]() |
2 | 2 | ||||||
MIRT479215 | CLCC1 | chloride channel CLIC like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT481176 | AVL9 | AVL9 cell migration associated | ![]() |
![]() |
2 | 6 | ||||||
MIRT483032 | KHSRP | KH-type splicing regulatory protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT485150 | RASL10B | RAS like family 10 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT486104 | SLC7A5 | solute carrier family 7 member 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT486319 | SIPA1 | signal-induced proliferation-associated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489443 | IFNLR1 | interferon lambda receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489585 | SSBP2 | single stranded DNA binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489702 | SCAMP4 | secretory carrier membrane protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490184 | TMEM63C | transmembrane protein 63C | ![]() |
![]() |
2 | 2 | ||||||
MIRT491211 | MLLT1 | MLLT1, super elongation complex subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT491276 | DHX40 | DEAH-box helicase 40 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495162 | CNGA2 | cyclic nucleotide gated channel alpha 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT495222 | DSCR3 | DSCR3 arrestin fold containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT496820 | CHRNB2 | cholinergic receptor nicotinic beta 2 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT498602 | KRT8 | keratin 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT500003 | HIST1H2BD | histone cluster 1 H2B family member d | ![]() |
![]() |
2 | 4 | ||||||
MIRT502065 | KRAS | KRAS proto-oncogene, GTPase | ![]() |
![]() |
2 | 2 | ||||||
MIRT508197 | SLC35E1 | solute carrier family 35 member E1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT508477 | FAM71F2 | family with sequence similarity 71 member F2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT509635 | RRP7A | ribosomal RNA processing 7 homolog A | ![]() |
![]() |
2 | 4 | ||||||
MIRT511039 | NRF1 | nuclear respiratory factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT516684 | ZNF860 | zinc finger protein 860 | ![]() |
![]() |
2 | 4 | ||||||
MIRT518394 | ZNF250 | zinc finger protein 250 | ![]() |
![]() |
2 | 2 | ||||||
MIRT518907 | CDC14B | cell division cycle 14B | ![]() |
![]() |
2 | 2 | ||||||
MIRT520502 | TRAM2 | translocation associated membrane protein 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT521459 | RAD51 | RAD51 recombinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT522354 | NCKIPSD | NCK interacting protein with SH3 domain | ![]() |
![]() |
2 | 4 | ||||||
MIRT522594 | MAPK1IP1L | mitogen-activated protein kinase 1 interacting protein 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT523267 | HIST1H2AE | histone cluster 1 H2A family member e | ![]() |
![]() |
2 | 2 | ||||||
MIRT523532 | GLUL | glutamate-ammonia ligase | ![]() |
![]() |
2 | 4 | ||||||
MIRT524186 | DFFA | DNA fragmentation factor subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT526842 | PHC1 | polyhomeotic homolog 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT528729 | FAM26E | calcium homeostasis modulator family member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540695 | BMP3 | bone morphogenetic protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544483 | TRIM4 | tripartite motif containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT551566 | LETM1 | leucine zipper and EF-hand containing transmembrane protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563619 | ZNF277 | zinc finger protein 277 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564467 | SLC35E2 | solute carrier family 35 member E2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565031 | VAV2 | vav guanine nucleotide exchange factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570294 | ARPC3 | actin related protein 2/3 complex subunit 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572932 | VDAC2 | voltage dependent anion channel 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573501 | IQSEC3 | IQ motif and Sec7 domain 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573675 | HES6 | hes family bHLH transcription factor 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT609619 | TRPC4AP | transient receptor potential cation channel subfamily C member 4 associated protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT611966 | PKD1 | polycystin 1, transient receptor potential channel interacting | ![]() |
![]() |
2 | 2 | ||||||
MIRT613930 | HIVEP3 | human immunodeficiency virus type I enhancer binding protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617733 | ATCAY | ATCAY, caytaxin | ![]() |
![]() |
2 | 4 | ||||||
MIRT618878 | MBL2 | mannose binding lectin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT627590 | SHROOM3 | shroom family member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628516 | ZNF878 | zinc finger protein 878 | ![]() |
![]() |
2 | 2 | ||||||
MIRT633964 | GRWD1 | glutamate rich WD repeat containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT634530 | NEGR1 | neuronal growth regulator 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635455 | APOLD1 | apolipoprotein L domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT636412 | MTHFD2 | methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase | ![]() |
![]() |
2 | 2 | ||||||
MIRT639672 | PPEF2 | protein phosphatase with EF-hand domain 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT642667 | RGS6 | regulator of G protein signaling 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT644080 | A4GALT | alpha 1,4-galactosyltransferase (P blood group) | ![]() |
![]() |
2 | 2 | ||||||
MIRT647318 | RPH3AL | rabphilin 3A like (without C2 domains) | ![]() |
![]() |
2 | 2 | ||||||
MIRT647942 | RNF152 | ring finger protein 152 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648687 | AP1M1 | adaptor related protein complex 1 mu 1 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT648817 | ZNF689 | zinc finger protein 689 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650347 | TREM1 | triggering receptor expressed on myeloid cells 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650374 | MOCS3 | molybdenum cofactor synthesis 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT655935 | NDUFA4P1 | NDUFA4, mitochondrial complex associated pseudogene 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663778 | PEX26 | peroxisomal biogenesis factor 26 | ![]() |
![]() |
2 | 2 | ||||||
MIRT664297 | HINT1 | histidine triad nucleotide binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665842 | TIAL1 | TIA1 cytotoxic granule associated RNA binding protein like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT668929 | COL9A2 | collagen type IX alpha 2 chain | ![]() |
![]() |
2 | 2 | ||||||
MIRT669673 | ACAP2 | ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669907 | KIAA0754 | KIAA0754 | ![]() |
![]() |
2 | 4 | ||||||
MIRT670248 | TRIM13 | tripartite motif containing 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670368 | ULBP3 | UL16 binding protein 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT670642 | BVES | blood vessel epicardial substance | ![]() |
![]() |
2 | 2 | ||||||
MIRT670749 | HOOK3 | hook microtubule tethering protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671184 | ZNF891 | zinc finger protein 891 | ![]() |
![]() |
2 | 2 | ||||||
MIRT673946 | ZNF500 | zinc finger protein 500 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674682 | PLCE1 | phospholipase C epsilon 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT677912 | HIST1H2BN | histone cluster 1 H2B family member n | ![]() |
![]() |
2 | 2 | ||||||
MIRT678876 | FAM118A | family with sequence similarity 118 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT679528 | RAB36 | RAB36, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT680589 | ZNF573 | zinc finger protein 573 | ![]() |
![]() |
2 | 2 | ||||||
MIRT680650 | KIAA1456 | KIAA1456 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681149 | INTS7 | integrator complex subunit 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681177 | IBA57 | IBA57 homolog, iron-sulfur cluster assembly | ![]() |
![]() |
2 | 2 | ||||||
MIRT681234 | DUSP19 | dual specificity phosphatase 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681626 | F2RL2 | coagulation factor II thrombin receptor like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681643 | SCRG1 | stimulator of chondrogenesis 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681926 | KAT7 | lysine acetyltransferase 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682050 | MRPS10 | mitochondrial ribosomal protein S10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682156 | SMS | spermine synthase | ![]() |
![]() |
2 | 2 | ||||||
MIRT683555 | HAVCR1 | hepatitis A virus cellular receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT684304 | TRUB2 | TruB pseudouridine synthase family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT684458 | MFSD4 | major facilitator superfamily domain containing 4A | ![]() |
![]() |
2 | 2 | ||||||
MIRT685986 | CCDC77 | coiled-coil domain containing 77 | ![]() |
![]() |
2 | 2 | ||||||
MIRT686782 | AZF1 | azoospermia factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT687329 | OSMR | oncostatin M receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT687629 | LRIG2 | leucine rich repeats and immunoglobulin like domains 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT688792 | CCNB1 | cyclin B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689756 | PRR13 | proline rich 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690823 | SGSM2 | small G protein signaling modulator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691310 | ZNF681 | zinc finger protein 681 | ![]() |
![]() |
2 | 2 | ||||||
MIRT692676 | ZMYM1 | zinc finger MYM-type containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693508 | MOB3A | MOB kinase activator 3A | ![]() |
![]() |
2 | 2 | ||||||
MIRT694657 | C14orf119 | chromosome 14 open reading frame 119 | ![]() |
![]() |
2 | 2 | ||||||
MIRT694889 | ZNF417 | zinc finger protein 417 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695740 | ZNF117 | zinc finger protein 117 | ![]() |
![]() |
2 | 2 | ||||||
MIRT697101 | GPKOW | G-patch domain and KOW motifs | ![]() |
![]() |
2 | 2 | ||||||
MIRT698968 | SPAST | spastin | ![]() |
![]() |
2 | 2 | ||||||
MIRT700379 | RAB33B | RAB33B, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT703930 | EPG5 | ectopic P-granules autophagy protein 5 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT706234 | SYT15 | synaptotagmin 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT706494 | SEPT6 | septin 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT710451 | BTNL3 | butyrophilin like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711684 | ATF7IP | activating transcription factor 7 interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT711997 | F9 | coagulation factor IX | ![]() |
![]() |
2 | 2 | ||||||
MIRT712727 | NCAPG2 | non-SMC condensin II complex subunit G2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713111 | TMBIM4 | transmembrane BAX inhibitor motif containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713156 | YWHAZ | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta | ![]() |
![]() |
2 | 2 | ||||||
MIRT713440 | AJAP1 | adherens junctions associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713830 | NUP98 | nucleoporin 98 | ![]() |
![]() |
2 | 2 | ||||||
MIRT714979 | RAB21 | RAB21, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT717411 | ZCCHC24 | zinc finger CCHC-type containing 24 | ![]() |
![]() |
2 | 2 | ||||||
MIRT718433 | ZNF85 | zinc finger protein 85 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720575 | SDHAF2 | succinate dehydrogenase complex assembly factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT725098 | TMEM120B | transmembrane protein 120B | ![]() |
![]() |
2 | 2 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|