pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-23a |
Genomic Coordinates | chr19: 13836587 - 13836659 |
Synonyms | MIRN23A, hsa-mir-23a, miRNA23A, MIR23A |
Description | Homo sapiens miR-23a stem-loop |
Comment | This miRNA was previously named miR-23 . This finding was later retracted after the discovery that the regulated gene was human homolog of ES1 (HES1), whose function is unknown. |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-23a-5p | |||||||||
Sequence | 9| GGGGUUCCUGGGGAUGGGAUUU |30 | |||||||||
Evidence | Experimental | |||||||||
Experiments | Cloned | |||||||||
SNPs in miRNA |
|
|||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | FAM151B | ||||||||||||||||||||
Synonyms | UNQ9217 | ||||||||||||||||||||
Description | family with sequence similarity 151 member B | ||||||||||||||||||||
Transcript | NM_205548 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on FAM151B | |||||||||||||||||||||
3'UTR of FAM151B (miRNA target sites are highlighted) |
>FAM151B|NM_205548|3'UTR 1 GAAGAAGATTCTCAATTATTTCCTGTGTTTTGGTTTCATAATCCTTCTCTCCATTGGTCTGAATTAATTACCATATAAAT 81 TATGGTTATTGATTGACGTTCCAAGTCATCTAATCAAGAAACGTTTATTGTATGCTTACTCTGTGGGCATATGTCCTTAT 161 AATAGTGCACTTACATAAAAGATTTGGAAAGAAGAGATTTATTTACACACGTGGCCTAGTCTAATAATAATTCAGGAAAA 241 TGATACTCTGCACCCCTTCATAAAAATAGTTTTGATAAACTAAAGATGATTGGCAGAATCCATATGTCATAAAACAGGTA 321 TAAATCACATGTGCTTGGCACTTGCATTACAGAGATTATGAAAAATATGGTACTCTTTTCCTTTTTCCTAGAAAACTGGT 401 TATTTTAGAGATAACAAAAAAGGAAGAGGGCTTTTAAAATGTTTTTAATTTTCACAGGGGTCAGCAGCTGTCTCATATCA 481 AGATCTATTAATCCATTTCCTGAAACTGTAGATTAAATTAGATAGATCTAGAATTTCCATGTGATTGAGAAGCATGCTAG 561 TGGCTAAGTGTTTTTTTTATATTTCTTATTTCTATAGTATCTGATTTATAGTGGACAATATACTGTTGGAGAGCAGTTTT 641 AGTCTTTGTTATGTATCATTTGTTTTCCAAGTTTCTTACTGCCACCACCTTCATTCAGGTCCTTGTTCTACTAGTAAAAC 721 TTTATGAACTAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | Hela | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1048188. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_ptb_knockdown
... - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al. - Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
|
CLIP-seq Support 1 for dataset GSM1048188 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | Hela / Hela_AGO2_CLIP_ptb_knockdown |
Location of target site | ENST00000282226.4 | 3UTR | AGGAGAACCGCUUGAACCCAGGAGGCAGAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23313552 / GSE42701 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
131 hsa-miR-23a-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT038958 | ATF1 | activating transcription factor 1 | ![]() |
1 | 1 | |||||||
MIRT057661 | LCOR | ligand dependent nuclear receptor corepressor | ![]() |
![]() |
2 | 2 | ||||||
MIRT395438 | NFKBID | NFKB inhibitor delta | ![]() |
![]() |
2 | 2 | ||||||
MIRT463884 | WNT7B | Wnt family member 7B | ![]() |
![]() |
2 | 4 | ||||||
MIRT475804 | HDGF | heparin binding growth factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT478528 | CTNS | cystinosin, lysosomal cystine transporter | ![]() |
![]() |
2 | 2 | ||||||
MIRT479278 | CHD4 | chromodomain helicase DNA binding protein 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT492564 | PPM1L | protein phosphatase, Mg2+/Mn2+ dependent 1L | ![]() |
![]() |
2 | 2 | ||||||
MIRT500353 | ZNF385A | zinc finger protein 385A | ![]() |
![]() |
2 | 2 | ||||||
MIRT509788 | CHAF1B | chromatin assembly factor 1 subunit B | ![]() |
![]() |
2 | 4 | ||||||
MIRT511566 | HIST3H2BB | histone cluster 3 H2B family member b | ![]() |
![]() |
2 | 4 | ||||||
MIRT525450 | GPATCH2L | G-patch domain containing 2 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT539558 | CNKSR3 | CNKSR family member 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT540034 | DNAJC28 | DnaJ heat shock protein family (Hsp40) member C28 | ![]() |
![]() |
2 | 4 | ||||||
MIRT540225 | SAMD5 | sterile alpha motif domain containing 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540242 | RGS17 | regulator of G protein signaling 17 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540871 | ZBTB24 | zinc finger and BTB domain containing 24 | ![]() |
![]() |
2 | 2 | ||||||
MIRT559065 | C19orf47 | chromosome 19 open reading frame 47 | ![]() |
![]() |
2 | 4 | ||||||
MIRT560685 | HIST1H1T | histone cluster 1 H1 family member t | ![]() |
![]() |
2 | 2 | ||||||
MIRT565593 | SLC35G1 | solute carrier family 35 member G1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565642 | SKI | SKI proto-oncogene | ![]() |
![]() |
2 | 2 | ||||||
MIRT576747 | Tmem127 | transmembrane protein 127 | ![]() |
![]() |
2 | 2 | ||||||
MIRT607712 | LIMS1 | LIM zinc finger domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT615682 | NAV2 | neuron navigator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617337 | ZSCAN2 | zinc finger and SCAN domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617378 | FAM227A | family with sequence similarity 227 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT620855 | SERPING1 | serpin family G member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT625112 | SLC1A5 | solute carrier family 1 member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT625124 | NUP93 | nucleoporin 93 | ![]() |
![]() |
2 | 2 | ||||||
MIRT625898 | LINC00632 | long intergenic non-protein coding RNA 632 | ![]() |
![]() |
2 | 2 | ||||||
MIRT626016 | XRCC2 | X-ray repair cross complementing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT626481 | ADAT1 | adenosine deaminase, tRNA specific 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT626573 | MED7 | mediator complex subunit 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT626814 | PRR11 | proline rich 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628136 | HM13 | histocompatibility minor 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT630771 | MSANTD3 | Myb/SANT DNA binding domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT633133 | C6orf132 | chromosome 6 open reading frame 132 | ![]() |
![]() |
2 | 2 | ||||||
MIRT636950 | APTX | aprataxin | ![]() |
![]() |
2 | 2 | ||||||
MIRT637802 | GGPS1 | geranylgeranyl diphosphate synthase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT638622 | GSR | glutathione-disulfide reductase | ![]() |
![]() |
2 | 4 | ||||||
MIRT642196 | SMAGP | small cell adhesion glycoprotein | ![]() |
![]() |
2 | 2 | ||||||
MIRT645121 | HES2 | hes family bHLH transcription factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT645344 | AGTPBP1 | ATP/GTP binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT646564 | ALDH5A1 | aldehyde dehydrogenase 5 family member A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT649243 | TRIM65 | tripartite motif containing 65 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651810 | USP49 | ubiquitin specific peptidase 49 | ![]() |
![]() |
2 | 2 | ||||||
MIRT652137 | TRPM7 | transient receptor potential cation channel subfamily M member 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT652668 | TIMELESS | timeless circadian clock | ![]() |
![]() |
2 | 2 | ||||||
MIRT655894 | NEK9 | NIMA related kinase 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT656564 | LYRM7 | LYR motif containing 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT657194 | IKZF3 | IKAROS family zinc finger 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT657907 | GDE1 | glycerophosphodiester phosphodiesterase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT660207 | BMPR1A | bone morphogenetic protein receptor type 1A | ![]() |
![]() |
2 | 2 | ||||||
MIRT660619 | ANKS4B | ankyrin repeat and sterile alpha motif domain containing 4B | ![]() |
![]() |
2 | 2 | ||||||
MIRT660826 | AGO3 | argonaute 3, RISC catalytic component | ![]() |
![]() |
2 | 2 | ||||||
MIRT660986 | ABHD2 | abhydrolase domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662232 | PGBD4 | piggyBac transposable element derived 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663691 | ZNF347 | zinc finger protein 347 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665577 | TUBD1 | tubulin delta 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT666149 | SP2 | Sp2 transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT666310 | SLC22A3 | solute carrier family 22 member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT666457 | SCRG1 | stimulator of chondrogenesis 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT667716 | KIAA1468 | KIAA1468 | ![]() |
![]() |
2 | 2 | ||||||
MIRT668329 | FKBP5 | FK506 binding protein 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT668370 | FBXO47 | F-box protein 47 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669304 | C17orf75 | chromosome 17 open reading frame 75 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669538 | ALG9 | ALG9, alpha-1,2-mannosyltransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT671681 | ADK | adenosine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT672177 | MRE11A | MRE11 homolog, double strand break repair nuclease | ![]() |
![]() |
2 | 2 | ||||||
MIRT673604 | HPSE | heparanase | ![]() |
![]() |
2 | 2 | ||||||
MIRT673749 | ZNF333 | zinc finger protein 333 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674807 | FAM229B | family with sequence similarity 229 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT675286 | ARL10 | ADP ribosylation factor like GTPase 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675391 | SVOP | SV2 related protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT675788 | MED28 | mediator complex subunit 28 | ![]() |
![]() |
2 | 2 | ||||||
MIRT676151 | OGFOD1 | 2-oxoglutarate and iron dependent oxygenase domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT676499 | GJD3 | gap junction protein delta 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT676621 | CSNK1E | casein kinase 1 epsilon | ![]() |
![]() |
2 | 2 | ||||||
MIRT676644 | GTDC1 | glycosyltransferase like domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT676711 | METTL14 | methyltransferase like 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT676809 | SHROOM4 | shroom family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT677036 | FOXO3 | forkhead box O3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT677062 | NT5C2 | 5'-nucleotidase, cytosolic II | ![]() |
![]() |
2 | 2 | ||||||
MIRT677086 | SMIM15 | small integral membrane protein 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT677193 | MURC | caveolae associated protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT677273 | SNRPD1 | small nuclear ribonucleoprotein D1 polypeptide | ![]() |
![]() |
2 | 2 | ||||||
MIRT677345 | POC1A | POC1 centriolar protein A | ![]() |
![]() |
2 | 2 | ||||||
MIRT677504 | SLC10A6 | solute carrier family 10 member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT677526 | OCIAD2 | OCIA domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT677661 | UGGT1 | UDP-glucose glycoprotein glucosyltransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT677727 | SSR1 | signal sequence receptor subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT677803 | PNPLA3 | patatin like phospholipase domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT678144 | SLC4A4 | solute carrier family 4 member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT678376 | VTA1 | vesicle trafficking 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT678708 | DHTKD1 | dehydrogenase E1 and transketolase domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT678868 | FAM118A | family with sequence similarity 118 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT679039 | LACTB | lactamase beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT679081 | PURB | purine rich element binding protein B | ![]() |
![]() |
2 | 2 | ||||||
MIRT679137 | SYK | spleen associated tyrosine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT679299 | SSBP2 | single stranded DNA binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT679741 | CABP4 | calcium binding protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT679946 | AS3MT | arsenite methyltransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT679976 | E2F2 | E2F transcription factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT683628 | MTO1 | mitochondrial tRNA translation optimization 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT683901 | PSMB9 | proteasome subunit beta 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT684172 | MOG | myelin oligodendrocyte glycoprotein | ![]() |
![]() |
2 | 2 | ||||||
MIRT684231 | C20orf144 | chromosome 20 open reading frame 144 | ![]() |
![]() |
2 | 2 | ||||||
MIRT685403 | C1orf158 | chromosome 1 open reading frame 158 | ![]() |
![]() |
2 | 2 | ||||||
MIRT686253 | ZBTB8B | zinc finger and BTB domain containing 8B | ![]() |
![]() |
2 | 2 | ||||||
MIRT687513 | NCKAP1 | NCK associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT688243 | FITM2 | fat storage inducing transmembrane protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT688315 | FAM151B | family with sequence similarity 151 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT688733 | CNDP1 | carnosine dipeptidase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689031 | ANGPTL3 | angiopoietin like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT698207 | TMEM248 | transmembrane protein 248 | ![]() |
![]() |
2 | 2 | ||||||
MIRT699859 | SAR1A | secretion associated Ras related GTPase 1A | ![]() |
![]() |
2 | 2 | ||||||
MIRT709954 | TRUB2 | TruB pseudouridine synthase family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711541 | MSH3 | mutS homolog 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712077 | WDR37 | WD repeat domain 37 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715312 | POLR2E | RNA polymerase II subunit E | ![]() |
![]() |
2 | 2 | ||||||
MIRT715725 | PIAS2 | protein inhibitor of activated STAT 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715748 | HSD11B1L | hydroxysteroid 11-beta dehydrogenase 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT717604 | DSTYK | dual serine/threonine and tyrosine protein kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT717875 | CYP20A1 | cytochrome P450 family 20 subfamily A member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT718042 | NIPAL2 | NIPA like domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT718829 | CDT1 | chromatin licensing and DNA replication factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT724037 | CAMK2N2 | calcium/calmodulin dependent protein kinase II inhibitor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT733305 | TNF | tumor necrosis factor | ![]() |
1 | 0 | |||||||
MIRT734941 | HSPA1B | heat shock protein family A (Hsp70) member 1B | ![]() |
![]() |
![]() |
3 | 0 | |||||
MIRT737343 | IGF2 | insulin like growth factor 2 | ![]() |
![]() |
![]() |
3 | 0 | |||||
MIRT737546 | PTEN | phosphatase and tensin homolog | ![]() |
![]() |
2 | 0 |
miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|