pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-3678 |
Genomic Coordinates | chr17: 75406069 - 75406162 |
Description | Homo sapiens miR-3678 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-3678-3p | ||||||||||||||||||||||||||||||
Sequence | 69| CUGCAGAGUUUGUACGGACCGG |90 | ||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||
Experiments | Illumina | ||||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | CPS1 | ||||||||||||||||||||
Synonyms | CPSASE1, PHN | ||||||||||||||||||||
Description | carbamoyl-phosphate synthase 1 | ||||||||||||||||||||
Transcript | NM_001122633 | ||||||||||||||||||||
Other Transcripts | NM_001122634 , NM_001875 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on CPS1 | |||||||||||||||||||||
3'UTR of CPS1 (miRNA target sites are highlighted) |
>CPS1|NM_001122633|3'UTR 1 AGATGCAGACACCCCAGCCCCATTATTAAATCAACCTGAGCCACATGTTATCTAAAGGAACTGATTCACAACTTTCTCAG 81 AGATGAATATTGATAACTAAACTTCATTTCAGTTTACTTTGTTATGCCTTAATATTCTGTGTCTTTTGCAATTAAATTGT 161 CAGTCACTTCTTCAAAACCTTACAGTCCTTCCTAAGTTACTCTTCATGAGATTTCATCCATTTACTAATACTGTATTTTT 241 GGTGGACTAGGCTTGCCTATGTGCTTATGTGTAGCTTTTTACTTTTTATGGTGCTGATTAATGGTGATCAAGGTAGGAAA 321 AGTTGCTGTTCTATTTTCTGAACTCTTTCTATACTTTAAGATACTCTATTTTTAAAACACTATCTGCAAACTCAGGACAC 401 TTTAACAGGGCAGAATACTCTAAAAACTTGATAAAATTAAATATAGATTTAATTTATGAACCTTCCATCATGATGTTTGT 481 GTATTGCTTCTTTTTGGATCCTCATTCTCACCCATTTGGCTAATCCAGGAATATTGTTATCCCTTCCCATTATATTGAAG 561 TTGAGAAATGTGACAGAGGCATTTAGAGTATGGACTTTTCTTTTCTTTTTCTTTTTCTTTTTTTCTTTTTGAGATGGAGT 641 CACACTCTCCAGGCTGGAGTGCAGTGGCACAATCTCGGCTCACTGCAATTTCCGTCTCCCAAGTTCAAGCGATTCTCCTG 721 CTTTAGACTATGGATTTCTTTAAGGAATACTGGTTTGCAGTTTTGTTTTCTGGACTATATCAGCAGATGGTAGACAGTGT 801 TTATGTAGATGTGTTGTTGTTTTTATCATTGGATTTTAACTTGGCCCGAGTGAAATAATCAGATTTTTGTCATTCACACT 881 CTCCCCCAGTTTTGGAATAACTTGGAAGTAAGGTTCATTCCCTTAAGACGATGGATTCTGTTGAACTATGGGGTCCCACA 961 CTGCACTATTAATTCCACCCACTGTAAGGGCAAGGACACCATTCCTTCTACATATAAGAAAAAAGTCTCTCCCCAAGGGC 1041 AGCCTTTGTTACTTTTAAATATTTTCTGTTATTACAAGTGCTCTAATTGTGAACTTTTAAATAAAATACTATTAAGAGGT 1121 AAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Hela |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1048188. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_ptb_knockdown
... - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell. |
Article |
- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al. - Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
|
CLIP-seq Support 1 for dataset GSM1048188 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | Hela / Hela_AGO2_CLIP_ptb_knockdown |
Location of target site | ENST00000430249.2 | 3UTR | UAUACUUUAAGAUACUCUAUUUUUAAAACACUAUCUGCAAACUCAGGACACUUUAACAGGGCAGAAUACUCUAAA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23313552 / GSE42701 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
86 hsa-miR-3678-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT074327 | TNRC6A | trinucleotide repeat containing 6A | ![]() |
![]() |
2 | 10 | ||||||
MIRT107705 | CLTA | clathrin light chain A | ![]() |
![]() |
2 | 2 | ||||||
MIRT114113 | AGO1 | argonaute 1, RISC catalytic component | ![]() |
![]() |
2 | 2 | ||||||
MIRT155293 | IFNAR2 | interferon alpha and beta receptor subunit 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT159171 | NRBP1 | nuclear receptor binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT185795 | ZNF678 | zinc finger protein 678 | ![]() |
![]() |
2 | 2 | ||||||
MIRT282672 | SYNM | synemin | ![]() |
![]() |
2 | 2 | ||||||
MIRT294386 | ZNF264 | zinc finger protein 264 | ![]() |
![]() |
2 | 2 | ||||||
MIRT295818 | CHMP4B | charged multivesicular body protein 4B | ![]() |
![]() |
2 | 2 | ||||||
MIRT332777 | CAPRIN1 | cell cycle associated protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT334112 | PPP6R3 | protein phosphatase 6 regulatory subunit 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT340971 | IPO5 | importin 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT354679 | CDV3 | CDV3 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT366662 | PLP2 | proteolipid protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT404272 | PLEKHA8 | pleckstrin homology domain containing A8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT447536 | RNF165 | ring finger protein 165 | ![]() |
![]() |
2 | 2 | ||||||
MIRT449139 | UQCRB | ubiquinol-cytochrome c reductase binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT451301 | LGALS3BP | galectin 3 binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT451488 | FOPNL | FGFR1OP N-terminal like | ![]() |
![]() |
2 | 2 | ||||||
MIRT455198 | GNL1 | G protein nucleolar 1 (putative) | ![]() |
![]() |
2 | 2 | ||||||
MIRT459215 | MRPS21 | mitochondrial ribosomal protein S21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT461764 | MPDU1 | mannose-P-dolichol utilization defect 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT463273 | ZFX | zinc finger protein, X-linked | ![]() |
![]() |
2 | 2 | ||||||
MIRT464862 | UBB | ubiquitin B | ![]() |
![]() |
2 | 8 | ||||||
MIRT464950 | TWIST1 | twist family bHLH transcription factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT467378 | SON | SON DNA binding protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT469282 | RHOA | ras homolog family member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT470293 | PPTC7 | PTC7 protein phosphatase homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT470639 | POM121C | POM121 transmembrane nucleoporin C | ![]() |
![]() |
2 | 2 | ||||||
MIRT477163 | FABP3 | fatty acid binding protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT477686 | EFHD2 | EF-hand domain family member D2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479725 | CCNF | cyclin F | ![]() |
![]() |
2 | 2 | ||||||
MIRT481726 | APH1A | aph-1 homolog A, gamma-secretase subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT485673 | CCDC64 | BICD family like cargo adaptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498280 | PADI2 | peptidyl arginine deiminase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT499921 | GPX8 | glutathione peroxidase 8 (putative) | ![]() |
![]() |
2 | 2 | ||||||
MIRT503616 | SLC25A36 | solute carrier family 25 member 36 | ![]() |
![]() |
2 | 4 | ||||||
MIRT506927 | IGDCC4 | immunoglobulin superfamily DCC subclass member 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT507348 | FAM129A | family with sequence similarity 129 member A | ![]() |
![]() |
2 | 6 | ||||||
MIRT508265 | DYNLL2 | dynein light chain LC8-type 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT508284 | YES1 | YES proto-oncogene 1, Src family tyrosine kinase | ![]() |
![]() |
2 | 4 | ||||||
MIRT509353 | COPS8 | COP9 signalosome subunit 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT510892 | RAB1A | RAB1A, member RAS oncogene family | ![]() |
![]() |
2 | 4 | ||||||
MIRT511882 | GAS1 | growth arrest specific 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT511990 | E2F1 | E2F transcription factor 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT512239 | ARPP19 | cAMP regulated phosphoprotein 19 | ![]() |
![]() |
2 | 4 | ||||||
MIRT512392 | BUB1 | BUB1 mitotic checkpoint serine/threonine kinase | ![]() |
![]() |
2 | 4 | ||||||
MIRT514086 | EPS15L1 | epidermal growth factor receptor pathway substrate 15 like 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT514358 | UBBP4 | ubiquitin B pseudogene 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT523149 | HNRNPU | heterogeneous nuclear ribonucleoprotein U | ![]() |
![]() |
2 | 2 | ||||||
MIRT525511 | FSIP2 | fibrous sheath interacting protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT526333 | SH3TC2 | SH3 domain and tetratricopeptide repeats 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT529962 | ZNF71 | zinc finger protein 71 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530337 | GABRB3 | gamma-aminobutyric acid type A receptor beta3 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT530884 | PHOX2A | paired like homeobox 2a | ![]() |
![]() |
2 | 2 | ||||||
MIRT533097 | YOD1 | YOD1 deubiquitinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT533250 | VCAM1 | vascular cell adhesion molecule 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT534786 | RAB8B | RAB8B, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT537917 | DSTYK | dual serine/threonine and tyrosine protein kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT547799 | JARID2 | jumonji and AT-rich interaction domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT548714 | CRK | CRK proto-oncogene, adaptor protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT555509 | PMEPA1 | prostate transmembrane protein, androgen induced 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT555984 | NFYB | nuclear transcription factor Y subunit beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT557942 | FAM222B | family with sequence similarity 222 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT560830 | ZNF786 | zinc finger protein 786 | ![]() |
![]() |
2 | 2 | ||||||
MIRT562720 | ZNF714 | zinc finger protein 714 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565337 | TMEM104 | transmembrane protein 104 | ![]() |
![]() |
2 | 2 | ||||||
MIRT614453 | REL | REL proto-oncogene, NF-kB subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT639474 | SLC6A4 | solute carrier family 6 member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT644056 | IQCE | IQ motif containing E | ![]() |
![]() |
2 | 2 | ||||||
MIRT651652 | VWA1 | von Willebrand factor A domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651866 | UNC119B | unc-119 lipid binding chaperone B | ![]() |
![]() |
2 | 2 | ||||||
MIRT653490 | SLC43A2 | solute carrier family 43 member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT657039 | KCNJ6 | potassium voltage-gated channel subfamily J member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT657985 | GAN | gigaxonin | ![]() |
![]() |
2 | 2 | ||||||
MIRT672117 | ATP6V0A2 | ATPase H+ transporting V0 subunit a2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT683583 | GSTCD | glutathione S-transferase C-terminal domain containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT688689 | CPS1 | carbamoyl-phosphate synthase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695375 | NSA2 | NSA2, ribosome biogenesis homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT696351 | EIF2S3 | eukaryotic translation initiation factor 2 subunit gamma | ![]() |
![]() |
2 | 2 | ||||||
MIRT700614 | PRKAA2 | protein kinase AMP-activated catalytic subunit alpha 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703512 | FKBP15 | FK506 binding protein 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT705051 | C5orf15 | chromosome 5 open reading frame 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT705180 | BTG1 | BTG anti-proliferation factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT709409 | FBXL20 | F-box and leucine rich repeat protein 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT721053 | DCC | DCC netrin 1 receptor | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|